Abstract
The present invention relates to isolation of a leucine-rich-protein gene from pigeonpea and its overexpression in organisms, preferably yeast and Arabidopsis to induce multiple abiotic stress tolerance.Fig: 1-9.
Information
| Application ID | 1803/CHE/2008 |
| Invention Field | TRADITIONAL KNOWLEDGE BIOTECHNOLOGY |
| Date of Application | 2008-07-28 |
| Publication Number | 51/2012 |
Applicants
| Name | Address | Country | Nationality |
|---|---|---|---|
| OSMANIA UNIVERSITY | HYDERABAD, 500 007, ANDHRA PRADESH, INDIA | India | India |
Inventors
| Name | Address | Country | Nationality |
|---|---|---|---|
| KHAREEDU VENKATESWARA RAO | CENTRE FOR PLANT MOLECULAR BIOLOGY OSMANIA UNIVERSITY HYDERABAD, 500 007, ANDHRA PRADESH, INDIA | India | India |
| BHYRI PRIYANKA | CENTRE FOR PLANT MOLECULAR BIOLOGY OSMANIA UNIVERSITY HYDERABAD, 500 007, ANDHRA PRADESH, INDIA | India | India |
| KAMBAKAM SEKHAR | CENTRE FOR PLANT MOLECULAR BIOLOGY OSMANIA UNIVERSITY HYDERABAD, 500 007, ANDHRA PRADESH, INDIA | India | India |
| VUDEM DASHA VANTHA REDDY | CENTRE FOR PLANT MOLECULAR BIOLOGY OSMANIA UNIVERSITY HYDERABAD, 500 007, ANDHRA PRADESH, INDIA | India | India |
Specification
FIELD OF THE INVENTION
The present invention relates to isolation of a leucine-rich-protein gene from pigeonpea and its overexpression in organisms, preferably yeast and Arabidopsis to induce multiple abiotic stress tolerance.
BACKGROUND OF THE INVENTION & PRIOR ART
Abiotic stresses imposed by drought, salinity and extreme temperatures act as major impediments and pose serious threat to the growth and productivity of diverse crop plants worldwide, with devastating socio-economic consequences. These stresses are invariably characterized by dehydration resulting from decreased availability of water to plant cells. Plants upon exposure to different stresses were found to exhibit a wide range of responses at molecular, cellular and whole plant levels (Bohnert and Slien. 1999: Greenvvay and Munns. 1980: Hasegawa et al.. 2000: Yeo. 1998: Zhu el al.. 1997). The concomitant occurrence of multiple abiotic stresses, in comparison to any individual stress, proves deleterious to plants grown under field conditions. Nevertheless, not much is known about the molecular mechanisms underlying the acclimation of plants to combination(s) of more than one stress (Rizhsky el al., 2004). To tide over different environmental conditions, plant species have evolved suitable adaptive mechanisms and show wide variation in their ability to withstand abiotic stresses, owing to their inherent genetic plasticity (Bartels and Ramanjulu. 2005: Yamaguchi-Shinozaki and Shinozaki. 2006).
In model plants, significant information has been accumulated on biochemical and molecular analyses of gene regulation under different abiotic stresses. Drought, salinity, extreme temperatures and oxidative stress result in complex stimuli of varied nature that are often interconnected, and hence these stresses might induce similar damages at cellular level (Rodriguez et al., 2005). Furthermore, plant stress responses to various abiotic factors have been found difficult to dissect, as defense responses require regulatory changes for activation of multiple genes involved in different metabolic pathways (Bohnert et al., 2006). Functions of various genes that respond to abiotic stresses have been elucidated at physiological, biochemical and molecular level (Hasegawa el al., 2000; Shinozaki and Yamaguchi-Shinozaki, 2000; Zhu. 2002). Different genes that are involved in signalling and regulatory pathways of stress response (Kim et al., 2007; Saijo et al., 2000; Shinozaki et al., 2003) genes that encode proteins conferring stress tolerance (Nelson et al., 2007; Sunkar et ai, 2003) and genes coding for enzymes mediating metabolic pathways for synthesis of specific stress-responsive metabolites of (Kavi Kishore et al., 1995; Park et al., 2004), have been utilized for production of abiotic stress tolerant transgenic plants.
Predictions made from climate models point to abrupt fluctuations in weather conditions triggered by the long-term effects of global warming (Cook et al., 2007; Salinger et al., 2005). It is, therefore, imperative to design and evolve improved versions of crop plants that can withstand the detrimental effects of changing environmental factors, and to ensure sustainable crop productivity by minimizing crop yield losses. As such it is mandatory to search for and identify novel candidate genes with multiple stress tolerance by accessing diverse gene pools.
The present disclosure overcomes the limitations of prior art and discloses a gene which can induce multiple stress tolerance in organisms.
OBJECTIVES OF THE PRESENT INVENTION
The main objective of the present invention is to obtain a leucine-rich protein gene comprising nucleotide sequence as set forth in SEQ ID No.l.
Another objective of the present invention is to obtain a leucine-rich protein gene comprising nucleotide sequence as set forth in SEQ ID No.l, wherein said gene is Cajanus leucine-rich protein gene, preferably Cajanus cajan leucine-rich protein gene (cclr).
Yet another objective of the present invention is to obtain a ribonucleic acid (RNA) transcribed from nucleotide sequence set forth in SEQ ID No. 1.
Still another objective of the present invention is to obtain a polypeptide protein translated from RNA transcribed from nucleotide sequence set forth in SEQ ID No. 1.
Still another objective of the present invention is to obtain a vector comprising nucleotide sequence as set forth in SEQ ID No. 1.
Still another objective of the present invention is to obtain a host comprising nucleotide sequence as set forth in SEQ ID No. 1.
Still another objective of the present invention is to obtain Saccharomyces cerevisiae INVSC1 containing Cajanus cajan leucine-rich protein gene (cclr) deposited with MTCC, Chandigarh having accession no. MTCC 5433.
Still another objective of the present invention is to obtain a method of inducing tolerance in organisms.
STATEMENT OE THE PRESENT INVENTION
Accordingly, the present invention relates to leucine-rich protein gene comprising nucleotide sequence as set forth in SEQ ID No.l; a ribonucleic acid (RNA) transcribed from nucleotide sequence set forth in SEQ ID No. 1; a polypeptide protein translated from RNA transcribed from nucleotide sequence set forth in SEQ ID No.l; a vector comprising nucleotide sequence as set forth in SEQ ID No.l; a host comprising nucleotide sequence as set forth in SEQ ID No.l; Saccharomyces cerevisiae INVSC1 containing Cajanus cajan leucine-rich protein gene (cclr) deposited with MTCC, Chandigarh having accession no. MTCC 5433; and a method of inducing tolerance in organisms, said method comprising step of transforming said organism with Cajanus leucine-rich protein gene (clr), preferably Cajanus cajan leucine-rich protein gene (cclr).
BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
Fig. 1 (A): Sequence homology of Pigeonpea-CcLR protein with proline-rich protein of Phaseolus vulgaris (Pvr5); (B) Sequence homology of the carboxyl end of CcLR protein from 49 to 130 aa to protease inhibitor, seed storage and lipid transfer (I/IT) family proteins, extensin-like proteins, pEARLI 1-like protein besides other proline-rich plant proteins.
Fig. 2: Southern Blot analysis of cclr revealed single hybridization signals of varied size ranging from >3Kb to 9Kb.
Fig. 3 (A-D): Northern Blot analysis to investigate the stress-inducible nature of cclr.
Fig. 4 (A-B): Expression of cclr in yeast.
Fig. 5: Growth curves indicating significant increase in CcLR expressing yeast cells.
Fig. 6: Transformation of Arabidopsis with cclr driven by CaMV 35S / rd 29A promoters.
Fig. 7: An amplicon of ~400bp representing cclr expression observed in different transgenic lines.
Fig. 8: Overexpression of cclr in Arabidopsis; transgenic varieties showing increased growth as compared to the wild type.
Fig. 9 (A-C): Comparison of survival rate, root length and biomass production; Transgenic lines showing maximum survival rate, increased root length and enhanced biomass production as compared to the wild type plants.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to a leucine-rich protein gene comprising nucleotide sequence as set forth in SEQ ID No. 1.
In another embodiment of the present invention, said gene is Cajanus leucine-rich protein gene, preferably Cajanus cajan leucine-rich protein gene (cclr). said gene imparts multiple abiotic stress tolerance in organisms selected from a group comprising yeast, Arabidopsis, tobacco and rice species.
In yet another embodiment of the present invention, said abiotic stress is selected from a group comprising high temperature, low temperature, drought, salinity, oxidative stress, osmotic stress, chemical agents and combinations thereof.
In still another embodiment of the present invention, said high temperature is in the range of about 40 - 46"C, preferably about 42 °C, said low temperature is in the range of about 8-12°C, preferably about 10°C and said salinity is in the range of about 0.2 - 1M, preferably about 0.3 M.
In still another embodiment of the present invention, said chemical agents are selected from a group comprising polyethylene glycol (PEG), LiCl, abscisic acid (ABA), mannitol and combinations thereof.
In still another embodiment of the present invention, said PEG is at a concentration ranging from about 5-25%, preferably about 20%, said LiCl is in the range of about 10 -200 mM, preferably about 150 mM, said ABA is in the range ol about 10 - 200 mM, preferably about 100 mM and said mannitol is in the range of about 100 - 500 mM, preferably about 300mM.
In still another embodiment of the present invention, said nucleotide sequence as set forth in SEQ ID No.l is full length cDNA clone obtained by 5' and 3' Rapid amplification of cDNA ends (RACE PCR).
In still another embodiment of the present invention, said cDNA clone is about 731 bp in length with coding sequence of about 396 bp.
The present invention also relates to a ribonucleic acid (RNA) transcribed from nucleotide sequence set forth in SEQ ID No. 1.
The present invention also relates to a polypeptide protein translated from RNA transcribed from nucleotide sequence set forth in SEQ ID No.l.
In another embodiment of the present invention, said polypeptide comprises about 131 amino acids, of which there are about 21 leucine residues.
The present invention also relates to a vector comprising nucleotide sequence as set forth in SEQ ID No A.
In another embodiment of the present invention, said vector is selected from a group comprising pYES2/NTC, pRT 100, pBI121, pSBl 1 and pCAMBIA.
The present invention also relates to a host comprising nucleotide sequence as set forth in SEQ ID No.l.
The present invention also relates to Saccharomyces cerevisiae INVSC1 containing Cajanus cajan leucine-rich protein gene (cclr) deposited with MTCC, Chandigarh having accession no. MTCC 5433.
The present invention also relates to a method of inducing tolerance in organisms, said method comprising step of transforming said organism with Cajanus leucine-rich protein gene (clr), preferably Cajanus cajan leucine-rich protein gene (cclr).
In another embodiment of the present invention, said organisms are selected from a group comprising yeast, Arabidopsis, tobacco and rice species.
In yet another embodiment of the present invention, said organisms are transformed with vectors comprising nucleotide sequence as set forth in SEQ ID No. 1 and transformation of organism is carried out under regulation of promoter selected from a group comprising gal promoter, rd 29 A promoter and CaMV35S.
Pigeonpea (Cajanus cajan L) is a major grain legume crop of tropical and subtropical regions of the world, and grows well in hot and humid climates. It has an excellent deep root system with profuse laterals and is well known as the most drought tolerant, salinity and alkalinity tolerant crop among legumes (Nene and Sheila, 1990). To isolate stress-inducible genes, a highly drought tolerant pigeonpea variety has been used as a potential source of stress-tolerance genes. In this study, we have isolated a stress-responsive Cajanus cajan leucine-rich-protein encoding gene (cclr) from PCR-subtract cDNA library and validated its functionality in heterologous systems. Overexpression of clr in yeast cells furnished ample tolerance to multiple stresses. Similarly, transgenic Arabidopsis plants expressing CcLR protein exhibited explicit tolerance against different abiotic stresses.
A full-length cDNA encoding a leucine-rich protein, designated as Cujamis cujun leucine-rich protein gene (cclr), preferably Cajamis cujun leucine-rich protein gene (cclr) has been isolated from the cDNA library of pigeonpea plants subjected to drought stress. Southern analysis disclosed single copy nature of the clr gene in the pigeonpea genome. Northern analysis revealed increased expression of clr in PEG. NaCl, cold and ABA treated plants compared to weak signals observed in untreated plants, suggesting stress-responsive nature of cclr. Accumulation of higher levels of cclr transcripts under PKG stress, compared to NaCl and cold stress, amply establish that clr is regulated by a drought-stress-inducible promoter. In yeast. CcLR protein imparted marked tolerance against abiotic stresses exerted by PHG. high temperature, salinity and UC1. Further, clr has been cloned downstream to CaMV35S and rd29A promoters, and introduced into Arubidopsis through vacuum infiltration. Transgenic Arabidopsis lines expressing Clr. when subjected to mannitol. NaCl. LiCl and heat (42'C) stress, developed into healthy plants with profuse root system and enhanced biomass in contrast to weak stunted plants observed in the wild type, owing to the profound effect of CcLR affording abiotic stress tolerance at whole plant level. The multipotent cclr gene, first of its kind to serve as a prime candidate gene to fortify crop plants with exotic stress tolerance.
The invention is further described with the help of following examples: however, these examples should not be construed to limit the scope of the invention.
EXAMPLE 1
Characterization of Cajanus cajan leucine-rich protein gene (cclr)
A partial cDNA clone (clone 21) of 309 bp (Ace no-CK394831) was obtained from the cDNA library of pigeonpea plants subjected to 20% PEG stress (-1.01±().02Mpa) employing PCR-based cDNA subtraction. A full-length cDNA clone of 731 bp with 5"and 3" untranslated regions was obtained, by 5* and 3" RACE PCR. that codes for a polypeptide of 131 amino acids (Figure 1A). Analysis of the protein revealed a maximum number of 21 leucines followed by 16 prolines. Based on amino acid profile, the cDNA clone was designated as Cajunus cajan leucine-rich protein encoding gene (cclr). The CcLR protein showed maximum identity of >80% with the 14 kD proline-rich protein (Pvr5) of Phaseolous vulgaris. Although CcLR showed significant homology with Pvr5. a stretch of eleven amino acids (aa) at the N-lerminus of CcLR was found dissimilar with that of Pvr5 (Figure 1A). Whereas, the carboxyl end of CcLR protein from 49 to 130 aa disclosed substantial homology to protease inhibitor, seed storage and lipid transfer (LIP) family proteins, extensin-like proteins. pEARLI 1 -like protein besides other proline-rich plant proteins (Figure IB). To assess the nature o\~ cclr. the genomic DNA was digested independently with Bum\\\. EcoRl. ///Will and Sail enzymes, and probed with the cclr coding sequence. Southern analysis revealed single hybridization signals of varied size ranging from >3Kb to 9Kb (Figure 2). To investigate the stress-inducible nature of cclr. northern blot analysis was done using the RN'A isolated from plants treated with NaCl (1M) / PEG (20%)/ cold (4(,C)/ABA (20&50uM) along with untreated plants. Increased accumulation of clr transcripts was detected in stressed plants in comparison with the unstressed controls. Among three stresses, plants subjected to PEG exhibited maximum cclr transcripts followed by NaCl while it was least under cold stress (Figure 3A-C). Increases were also observed in cclr transcripts when plants were treated with ABA (Figure 3D). In various stress treatments, significantly higher accumulation ofcclr transcripts was detected in the roots than in the leaves of stressed plants.
EXAMPLE 2
Expression of clr in yeast confers abiotic stress tolerance
Yeast (Saccharomyccs cerevisiae) was used to assess the effect of CcLR expression against heat, salinity and osmotic stress. Yeast cells containing cclr under the regulation of GAL promoter expressed a polypeptide of >14kD which was absent in the yeast transformed with vector (pYES2/NT C) alone (Figure 4A). Yeast strain harbouring pYES2/NTC-i'c/r along with the control (pYES2/T\IT C) were subjected to different stresses induced by PEG. Mannitol. NaCl. LiCl. cold (8°C) and heat (42(IC). Under normal conditions, the growth pattern of pYES2/NTC-ic7r yeast was found similar to that of control yeast containing vector alone (figure 4B). Control yeast cells, however, failed to grow when subjected to 20% PEG /1.0 M NaCl / 100 mM LiCl ' heat (42°C) stress conditions. Whereas, yeast cells expressing cclr under identical stress conditions showed normal growth as evidenced by the colony size (Figure 4B). Also. CcLR expressing yeast cells, when grown under similar stress conditions in the liquid medium, exhibited significant increases in growth rates as compared to the control yeast which showed negligible/no growth as indicated by OD6oo values (Figure 5). On the other hand, cclr-yeast cells subjected to cold stress (8°C-12°C) showed growth after 48 h of culture.
EXAMPLE 3
Overexpression of clr in Arabidopsis affords multiple stress tolerance
To evaluate the functional role of clr in plants. Arabidopsis was transformed with clr driven by CaMV 35S / rd 29A promoters (Figure 6). PCR analysis employing genomic DNA from kanamycin tolerant Arabidopsis plants, using cclr primers, revealed -400 bp amplified fragment: while no such band was observed in wild type plants. Presence o\' cclr transcripts was monitored by RT PCR using total RNA from stressed rd29A-a7r lines and unstressed CaMV35S-cc7r lines as well as wild type plants, employing cclr-specific primers. An amplicon of -400bp representing cclr expression was observed in different transgenic lines (Figure 7). Four independent homozygous (TO CcLR expressing transgenic lines, viz.. CS1 and CS2 (CaMV35S-tr/r) and CR1 and CR2 (rd29-cr/r), were subjected to different stress treatments for seven days. Tolerance of transgenic plants to abiotic stress was analyzed by subjecting them to various concentrations of mannitol, NaCl and Lid. besides heat (42°C) and cold (8"C) stress. Under unstressed conditions. CaMV35S-cc/r and rd29A-cc/r transgenics exhibited comparable growth pattern as that of wild type plants. Transgenic lines grown under 200mM NaCl /300mM mannitol /lOniM LiCl /heat (42°C) conditions, in comparison with the wild type, showed notable increases in plant growth (Figure 8). By contrast. rd29A-tr/r transgenic lines failed to withstand the impact of heat stress. Alter stress treatments, plants were allowed to grow on MS medium/soil under normal conditions for twelve days to monitor plant survival and recovery efficiency. The recovered transgenic lines showed maximum survival rate, increased root length and enhanced biomass production as compared to the wild type plants (Figure 9). Furthermore, transgenic plants, when grown under stress conditions, could complete the reproductive cycle and set normal viable seeds while wild type plants failed to survive and/or enter the reproductive phase.
To sum up, a multifunctional cclr gene has been isolated from the subtracted cDNA library constructed from PEG-stressed pigeonpea plants. The cclr disclosed single copy nature and was induced in pigeonpea by different abiotic stress conditions. In yeast and Arabidopsis, expression of cclr imparted marked tolerance to PEG, mannitol, NaCl, high temperature and LiCl stress. The overall results authenticate that the Cajamis-slress-responsive gene affords surpassing multiple stress tolerance in heterologous systems. The exotic cclr, by virtue of its high-level tolerance against drought, salinity and high temperature, serve as a prime candidate gene, and as such may be deployed in the genetic enhancement of diverse crop plants.
The following nucleotide sequence is of Cajanus cajan leucine-rich protein gene (cclr)
SEP ID No. 1:
ATGGCTTCCAAGGCTGCACTCCTCTTATCCCTTAACATTCTCTTCTTCACTGTG
TTTAGCTCATCATACGTCCCATGCAGCCCACCCCCAAAAGTTCCAAAACACCC
ACCAGTCCCAAAGCCACCTTCCACAAAGTCTGGTACTTGTCCCAAAGACACC
C'rTAAGTTTGGTGTGTGTGCTAATCTGCTAGG'riTGGTAAACGTGAATCTTGG
GAAGCCACCAAAAACCCCATGCTGCTCTCTCATTGAGGGTCTTGCTGATCTTG
AAGCTGCAGTGTGCCTTTGCACCGCTCTCAAAGCTAATGTGTTGGGCATCAAC
CTCAATGTCCCCGTCAAGTTGAGCTTGTTACTCAACGTCTGTGGAAAGAAGAC
TCCTAAGGATTTCATCTGCGCTTAA
The following is the nucleotide sequence ol'RNA transcribed from SEP ID No. 1 of cclr.
UACCGAAGGUUCCGACGUGAGGAGAAUAGGGAAUUGUAAGAGAAGAAGUG
ACACAAAUCGAGUAGUAUGCAGGGUACGUCGGGUGGGGGUUUUCAAGGUU
UUGUGGGUGGUCAGGGUUUCGGUGGAAGGUGUUUCAGACCAUGAACAGGG
UUUCUGUGGGAAUUCAAACCACACACACGAUUAGACGAUCCAAACCAUUU
GCACUUAGAACCCUUCGGUGGUUUUUGGGGUACGACGAGAGAGUAACUCC
CAGAACGACUAGAACUUCGACGUCACACGGAAACGUGGCGAGAGUUUCGA
UUACACAACCCGUAGUUGGAGUUACAGGGGCAGUUCAACUCGAACAAUGA
GUUGCAGACACCUUUCUUCUGAGGAUUCCUAAAGUAGACGCGAAUU
We Claim:
1) A leucine-rich protein gene comprising nucleotide sequence as set forth in SEQ ID No.l.
2) The leucine-rich protein gene as claimed in claim 1, wherein said gene is Cajanus leucine-rich protein gene, preferably Cajanus cajan leucine-rich protein gene (cclr).
3) The leucine-rich protein gene as claimed in claim 1, wherein said gene imparts multiple abiotic stress tolerance in organisms selected from a group comprising yeast, Arabidopsis, tobacco and rice species.
4) The leucine-rich protein gene as claimed in claim 3, wherein said abiotic stress is selected from a group comprising high temperature, low temperature, drought, salinity, oxidative stress, osmotic stress, chemical agents and combinations thereof.
5) The leucine-rich protein gene as claimed in claim 4, wherein said high temperature is in the range of about 40 - 46°C, preferably about 42 °C, said low temperature is in the range of about 8-12°C, preferably about 10°C and said salinity is in the range of about 0.2 - 1M, preferably about 0.3 M.
6) The leucine-rich protein gene as claimed in claim 4, wherein said chemical agents are selected from a group comprising polyethylene glycol (PEG), LiCl, abscisic acid (ABA), mannitol and combinations thereof.
7) The leucine-rich protein gene as claimed in claim 6, wherein said PHG is at a concentration ranging from about 5-25%, preferably about 20%, said LiCl is in the range of about 10 -200 mM, preferably about 150 mM, said ABA is in the range of about 10 - 200 mM, preferably about 100 mM and said mannitol is in the range of about 100 - 500 mM, preferably about 300mM.
8) The leucine-rich protein gene as claimed in claim 1, wherein said nucleotide sequence as set forth in SEQ ID No.l is full length cDNA clone obtained by 5' and 3' Rapid amplification of cDNA ends (RACE PCR).
9) The leucine-rich protein gene as claimed in claim 8, wherein said cDNA clone is about 731 bp in length with coding sequence of about 396 bp.
10) A ribonucleic acid (RNA) transcribed from nucleotide sequence set forth in SEQ ID No.l.
11) A polypeptide protein translated from RNA of claim 11.
12) The polypeptide protein as claimed in claim 11, wherein said polypeptide comprises about 131 amino acids, of which there are about 21 leucine residues.
13) A vector comprising nucleotide sequence as set forth in SEQ ID No. 1.
14) The vector as claimed in claim 13, wherein said vector is selected from a group comprising pYES2/NTC, pRT 100, pBI121, pSBl 1 and pCAMBIA.
15) A host comprising nucleotide sequence as set forth in SEQ ID No. 1.
16) Saccharomyces cerevisiae INVSC1 containing Cajanus cajan leucine-rich protein gene (cclr) deposited with MTCC, Chandigarh having accession no. MTCC 5433.
17) A method of inducing tolerance in organisms, said method comprising step of transforming said organism with Cajanus leucine-rich protein gene (clr), preferably Cajanus cajan leucine-rich protein gene (cclr).
18) The method as claimed in claim 17, wherein said organisms are selected from a group comprising yeast, Arabidopsis, tobacco and rice species.
19) The method as claimed in claim 17, wherein said organisms are transformed with vectors comprising nucleotide sequence as set forth in SEQ ID No.l and transformation of organism is carried out under regulation of promoter selected from a group comprising gal promoter, rd 29A promoter and CaMV35S.
20) The leucine-rich protein gene, the ribonucleic acid, the polypeptide protein, the vector, the host, Saccharomyces cerevisiae INVSC1 and the method as substantially described herein with reference to examples and figures.
Documents
| Name | Date |
| 1803-che-2008 correespondence others-23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 claims-23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 OTHERS-23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 abstract-23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 FORM-2 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 SEQUENCE LISTING 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 OTHERS 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 FORM-18 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 CORRESPONDENCE OTHERS 04-02-2011.pdf | 2011-02-04 |
| 1803-CHE-2008 FORM-13 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 FORM-26 23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 form-5.pdf | 2011-09-03 |
| 1803-CHE-2008 FORM-1 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 DRAWINGS 23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 form-3.pdf | 2011-09-03 |
| 1803-CHE-2008 DESCRIPTION (COMPLETE) 23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 form-1.pdf | 2011-09-03 |
| 1803-che-2008 abstract.pdf | 2011-09-03 |
| 1803-che-2008 correspondence-others.pdf | 2011-09-03 |
| 1803-che-2008 claims.pdf | 2011-09-03 |
| 1803-CHE-2008 FORM-13 13-07-2012.pdf | 2012-07-13 |
| 1803-CHE-2008 CORRESPONDENCE OTHERS 13-07-2012.pdf | 2012-07-13 |
| 1803-che-2008 abstract-1.jpg | 2011-09-03 |
| 1803-che-2008 drawings.pdf | 2011-09-03 |
| 1803-CHE-2008 FORM-1 13-07-2012.pdf | 2012-07-13 |
| 1803-che-2008 description(complete).pdf | 2011-09-03 |
| 1803-che-2008 abstract-2.jpg | 2011-09-03 |
| Others.pdf | 2015-03-12 |
| Claims.pdf | 2015-03-12 |
| Abstract.pdf | 2015-03-12 |
| 1803-CHE-2008_EXAMREPORT.pdf | 2016-07-02 |
| Specification.pdf | 2015-03-12 |
| FER Response.pdf | 2015-03-12 |
| 1803-che-2008 correespondence others-23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 claims-23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 OTHERS-23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 abstract-23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 form-1.pdf | 2011-09-03 |
| 1803-CHE-2008 SEQUENCE LISTING 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 FORM-2 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 FORM-26 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 FORM-13 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 FORM-18 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 OTHERS 23-07-2009.pdf | 2009-07-23 |
| 1803-CHE-2008 FORM-1 23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 form-5.pdf | 2011-09-03 |
| 1803-CHE-2008 DRAWINGS 23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 form-3.pdf | 2011-09-03 |
| 1803-CHE-2008 CORRESPONDENCE OTHERS 04-02-2011.pdf | 2011-02-04 |
| 1803-CHE-2008 DESCRIPTION (COMPLETE) 23-07-2009.pdf | 2009-07-23 |
| 1803-che-2008 drawings.pdf | 2011-09-03 |
| 1803-che-2008 abstract-1.jpg | 2011-09-03 |
| 1803-che-2008 correspondence-others.pdf | 2011-09-03 |
| 1803-che-2008 abstract-2.jpg | 2011-09-03 |
| 1803-CHE-2008 FORM-13 13-07-2012.pdf | 2012-07-13 |
| 1803-CHE-2008 FORM-1 13-07-2012.pdf | 2012-07-13 |
| 1803-CHE-2008 CORRESPONDENCE OTHERS 13-07-2012.pdf | 2012-07-13 |
| Others.pdf | 2015-03-12 |
| Specification.pdf | 2015-03-12 |
| FER Response.pdf | 2015-03-12 |
| Claims.pdf | 2015-03-12 |
| 1803-CHE-2008_EXAMREPORT.pdf | 2016-07-02 |
| 1803-che-2008 abstract.pdf | 2011-09-03 |
| 1803-che-2008 description(complete).pdf | 2011-09-03 |
| 1803-che-2008 claims.pdf | 2011-09-03 |
| Abstract.pdf | 2015-03-12 |
Orders
| Applicant | Section | Controller | Decision Date | URL |