Abstract

Novel pyrrolidine derivatives of formula (I), to processes for their production, their use as pharmaceuticals in the treatment of neoplastic diseases, inflammatory and immune system disorders and to pharmaceutical compositions comprising them.

Information

Application ID	2241/CHENP/2005
Invention Field	GENERAL ENGINEERING
Date of Application	2005-09-13
Publication Number	35/2007

Applicants

Name	Address	Country	Nationality
NOVARTIS AG	LICHTSTRASSE 35 CH-4056 BASEL SWITZERLAND	Switzerland	Switzerland

Inventors

Name	Address	Country	Nationality
GARCIA-ECHEVERRIA, CARLOS	ENGELGASSE 126 CH-4052 BASEL SWITZERLAND	Switzerland	Switzerland
KANAZAWA, TAKANORI	27-8-203, HIGASHI-ARAI TSUKUBA-SHI IBARAKI PREF 305-0033 JAPAN	Japan	Japan
KAWAHARA, EIJI	4-20, INARIMAE TSUKUBA-SHI IBARAKI PREF 305-0061 JAPAN	Japan	Japan
MASUYA, KEIICHI	1-1-1, TSUKUHO, TSUKUBA-SHI IBARAKI PREF 300-3257 JAPAN	Japan	Japan
MATSUURA, NAOKO	2-4-1-507, AMAKUBO TSUKUBA-SHI IBARAKI PREF 305-0005 JAPAN	Japan	Japan
MIYAKE, TAKAHIRO	2-4-1-102, AMAKUBO TSUKUBA-SHI IBARAKI PREF 305-0005 JAPAN	Japan	Japan
OHMORI, OSAMU	2-4-6-406, SENGEN TSUKUBA-SHI IBARAKI PREF 305-0047 JAPAN	Japan	Japan
UMEMURA, ICHIRO	2-3-7-406, NINOMIYA TSUKUBA-SHI IBARAKI PREF 305-0051 JAPAN	Japan	Japan

Specification

Pvrimidine Derivatives
The present invention relates to novel pyrimidine derivatives, to processes for their production, their use as pharmaceuticals and to pharmaceutical compositions comprising them.

wherein
each of R°, R\ R2,and R3 independently is hydrogen, c1-C8alkyi, C1-C8alkenyl, C2-Cealkinyl, C3-Cecycloalkyl, C3-C8cycloaIkylC1-C8alkyl, Cs-C-ioaryld-Cealkyi* hydroxyCrCealkyl, C1-C8alkoxyC1-C8alkyl, aminoC1--C8alkyl, haloC1-C8alkyl, unsubstituted or substituted Cs-C10aryl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1, 2 or 3 hetero atoms selected from N, 0 and S, hydroxy, C1-C8aIkoxy, hydroxyC1-C8alkoxy, d1-C2alkoxyCrCealkoxy, haioC1-C8aIkoxy, unsubstituted or substituted C5-C10arylCrCsalkoxy, unsubstituted or substituted heterocyclyloxy, or unsubstituted or substituted heterocyclylCr C8alkoxy, unsubstitued or substituted amino, C1-C8aIkylthio, c1-C8alkylsuifinyl, C1-C8aIkyIsuIfonyI, C5-C10aryisulfonyl, halogen, carboxy,c1-C8alkoxycarbonyl, unsubstitued or substituted carbamoyl, unsubstitued or substituted sulfamoyl, cyano or nitro;
or R° and R\ R1 and R2, and/or R2 and R3 form, together with the carbon atoms to which they are attached, a 5 or 6 membered carbocyclic or heterocyclic ring comprising 0,1, 2 or 3 heteroatoms selected from N, O and S;
R4 is hydrogen or d-C8alkyl;
each of R5 and R6 independently is hydrogen, CrCealkyi, C1--C8aikoxyd-Csalkyl, halod-dialkyl, C1-C8alkoxy, halogen, carboxy, d-C8alkoxycarbonyl, unsubstitued or substituted carbamoyl, cyano, or nitro;
each of R7, R8, RB, and R10 independently is d-Ceaikyl, d-Caalkenyl, d-Caalkinyl, C3-C8cycioalkyl, C3-CecycloalkylC1-C8aIkyl, Crdoaryld-CBalkyl, hydroxyCrCealkyl, d-C8alkoxyd-Cealkyl, aminoC1-C8alkyl, haloC1-C8alkyl, unsubstituted or substituted C5-C10aryl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1, 2 or 3

hetero atoms selected from N, 0 and S, hydroxy, C1-C8alkoxyT hydroxyd-Cealkoxy, Cr C8alkoxyC1-C8alkoxy, haloCVCealkoxy, unsubstituted or substituted CrCioaryiC-rCealkoxy, unsubstituted or substituted heterocyclyioxy, or unsubstituted or substituted heterocyclyld-C8aIkoxy, unsubstitued or substituted amino, C1-C8aIkylthio, C1-C8aikylsulfinyI, Cr Ceaikylsulfonyl, C1--C8oarylsulfonyl, halogen, carboxy, C1-C8alkoxycarbonyl, unsubstitued or substituted carbamoyl, unsubstitued or substituted suifamoyl, cyano or nitro; wherein R7, R8 and R9 independently of each other can also be hydrogen;
or R7 and R8, R8 and R8, and/or Rs and R10 form together with the carbon atoms to which they are attached, a 5 or 6 membered carbocyclic or heterocyclic ring comprising 0,1, 2 or 3 heteroatoms selected from N, O and S;
A is C or N, most preferably C; - and salts thereofr -
The general terms used hereinbefore and hereinafter preferably have within the context of this disclosure the following meanings, unless otherwise indicated:
Where the plural form is used for compoundspsalts, and the like, this is taken to mean also a single compound, saltbr the like."
Any asymmetric carbon atoms may be present in the (R)-, (S)- or (Reconfiguration, preferably in the (R)- or (S)-configuration. The compounds may thus be present as mixtures of isomers or as pure isomers, preferably as enantiomer-pure diastereomers.
The invention relates also to possible tautomers of the compounds of formula I.
Ci-C8alkyi denotes a an alkyl radical having from 1 up to 8, especially up to 4 carbon atoms, the radicals in question being either linear or branched with single or multiple branching; preferably, CrCaa!kyI is butyl, such as n-butyl, sec-butyl, isobutyl, tert-butyl, propyl, such as n-propyl or isopropyl, ethyl or methyl; especially methyl, propyl or tert-butyl.
CrCealkenyl denotes a an alkenyl radical having from 2 up to 8, especially up to 5 carbon
atoms, the radicals in question- being either linear or branched with single or multiple branching;
preferably, C2-C8alkenyl is pentenyl, such as 3-methyl-2-buten-2-yi, butenyl, such as 1- or 2-butenyl or 2-buten-2-yI, propenyl, such as 1-propenyl or allyl, or vinyl.

C1-C8alkinyI denotes a an alklnyl radical having from 2 up to 8, especially up to 5 carbon atoms, the radicals in question being either linear or branched; preferably, CrC8aIkinyl is propinyi, such as 1-propinyi or propargyl, or acetylenyl.
(VCecycloalkyl denotes a cycloalkyl radical having from 3 up to 8 carbon atoms, such as cyclopropyl, cyclobutyi, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl, preferably cyclopropyl, cyclopentyl or cyclohexyl.
d-Csalkoxy is especially methoxy, ethoxy, isopropyloxy, or tert-butoxy.
HydroxyCi-Cgalkyl is especially hydroxymethyl, 2-hydroxyethyl or 2-hydroxy-2-propyL
HydroxyC1-C8alkoxy is especially 2-hydroxyethoxy or 3-hydroxypropoxy.
d-CealkoxyC1-C8alkoxy is especially 2-methoxyethoxy.
C1-C8alkoxyC1-C8aIkyl is especially methoxymethyl, 2-methoxyethyl or 2-ethoxyethyI:
Halogen is preferably fluorine, chlorine, bromine, or Iodine, especially fluorine, chlorine, or
bromine. - . „
HaloC1-C8alkyl is preferably chloroC1-C8alkyl orfluoroCrC8aikyl, especially trifluoromethyl or pentafluoroethyl.
HaloC1-C8alkoxy is preferably chloroC1-C8C8alkoxy orfluoroC1-C8alkoxy, especially trifiuoromethoxy.
CrC8alkoxycarbonyl is especially tert-butoxycarbonyl, iso-propoxycarbonyl, methoxycarbonyl or ethoxycarbonyl.
Unsubstitued or substituted carbamoyl is carbamoyl substituted by one or two substituents selected from hydrogen, CrQjalkyl, C1=-CBalkenyl, C2-C8alkinyl, CrC8cycloaIkyl, C3-CscycloalkylCrCBalkyl, Cs-CtoaryiCrCaalkyl, hydroxyCrCBaIkyl, d-CealkoxyCrCsalkyl, halod-

carboxy, CrCealkoxycarbonyt, carbamoyl, sulfamoyl, cyano or nitro; preferably phenyl, tolyl, trifluoromethylphenyl, methoxyphenyl, dimethoxyphenyl, methylenedioxyphenyl, chlorophenyl or bromophenyl, whereby the substituents may be in ortho, meta or para position, preferably meta or para.
CrCioaryloxy is especially phenoxy or methoxyphenoxy, e.g. p-methoxyphenoxy.
C5-C10arylCrCaalkyI is especially benzyl or 2-phenyIethyl.
Cs-CioarylCrCealkoxy is especially benzyloxy or 2-phenylethoxy.
Unsubstitued or substituted 5 or 6 membered heterocyclyl comprising 1, 2 or 3 hetero atoms
selected from N, 0 and S may be unsaturated, partially unsaturated or saturated, and further
condensed to a benzo group or a 5 or 6 membered heterocyclyl group, and may be bound
through a hetero or a carbon atom, and is, for example, pyrrolyl, indolyi, pyrrolidinyl, imidazolyl,
benamidazolyl, pyrazolyl, triazolyl, benzotriazolyl, tetrazolyl, pyridyl, quinolinyl, isoquinoiinyl,
1,2,3,4-tetrahydroquinolinyl, piperidyl, pyrimidinyl, pyrazinyl, piperazinyl, purinyl, tetrazinyl,
oxazolyl, isoxaiyl, morpholinyl, thiazolyl, benzotttazolylr oxadiazolyl, and benzoxadiazolyl.
Substituents considered are CrCealkyl, hydroxyCi-Cealkyl, Ci-CealkoxyCrCealkyI, Cr
CealkoxyCrCsalkoxy, haloCrC8aikylt hydroxy, amino, substituted amino, CrC^alkoxy, Halogen;
carboxy, CrCBalkylcarbonyl, Ci-Csalkoxycarbonyl, carbamoyl, GrC8alkylcarbamoyl5 cyano, oxo,
or unsubstitued or substituted 5 or 6 membered heterocyclyl as defined in this paragraph. 5 or 6
membered heterocyclyl preferably comprises 1 or 2 hetero atoms selected from N, 0 and S, ■"
and is especially indolyi, pyrrolidinyl, pyrroiidonyi, imidazolyl, N-methylimidazolyl, benzimidazolyl, S,S-dioxoisothiazoIidinyl, piperidyl, 4-acetylaminopiperidyl, 4-methylcarbamoylpiperidyl, 4-piperidinopiperidyi, 4-cyanopiperidyl, piperazinyl, N-methylpiperazinyl, N-(2-hydroxyethyl)piperazinylx morpholinyl, 1-aza-2,2-dioxo-2-thiacyclohexyi, or sulfolanyl.
In unsubstituted or substituted heterocyclyloxy, heterocyclyl has the meaning as defined above, and is especially N-methyl-4-piperidyloxy. In unsubstituted or substituted heterocyclylCi-Cealkoxy, heterocyclyl has the meaning as defined above, and is especially 2-pyrrolidinoethoxy, 2-morphoiinoethoxy, 3-morphoIinopropoxy, 1-methyl-piperidin-3-yimethoxyt 3-(N-methylpiperazino)propoxy or 2-(1-imidazolyl)ethoxy.

In a 5 or 6 membered carbocyclic or heterocyclic ring comprising 0,1,2 or 3 heteroatoms selected from N, O and S, and formed by two adjacent substituents together with the benzene ring, the ring may be further substituted, e.g. by CrCealkyl, CrCealkoxy, haIoCrC6alkyI, hydroxy, amino, substituted amino, CrC6alkoxy, halogen, carboxy, CrCBaIkoxycarbonyl, carbamoyl, cyano, or oxo. The two adjacent substituents forming such a ring are preferably propylene, butylene, l-aza-2-propylidene, 3-aza-1-propylidene, 1,2-diaza-2-propylidene, 2,3-diaza-1-propylidene, 1-oxapropylene, 1-oxapropylidene, methyienedioxy, dffluoromethylene-dioxy, 2-aza-1-oxopropylene, 2-aza-2-methyl-1-oxopropylene, 1-aza-2-oxopropylene, 2-aza-1,1-dioxo-1-thiapropylene or the corresponding butylene derivatives forming a 6 membered ring.
Salts are especially the pharmaceutical acceptable .salts of compounds of formula I.
Such salts are formed, for example, as acid addition salts, preferably with organic or inorganic ^ acids, from compounds of formula I with a basic nitrogen atom, especially the pharmaceutical^ v acceptable salts. Suitable inorganic acids are, for example, halogen acids, such as hydrochloric acid, sulfuric acid, or phosphoric acid. Suitable organic acids are, for example, carboxylic, phosphorite, sulfonic or sulfamic acids, for example acetic acid, propionic acid, octanoic acidr decanoic acid, dodecanoic acid, glycoiic acid, lactic acid, fumaric acid, succinic acid, adipic acid, pimelic acid, suberic acid, azelaic acid, malic acid, tartaric acid, citric acid, amino acids, such as glutamic add oraspartic acid, maleic acid, hydroxymaleic acid, methyimaleicacid, _:_-..::^rv^ cyciohexanecarboxylic add, adamantanecarboxylic add, .benzoic acid, salicylic acid, 4- :^.^ aminosalicylic add, phthalic acid, phenylacetic acid, mandelic add, dnnamic acid, methane- or -ethane-sulfonic add, 2-hydroxyethanesulfonic add, ethane-1,2-disulfonic acid, benzenesuifonic acid, 2-naphthalenesulfbnic acid, 1,5-naphthalene-disuIfonic acid, 2-, 3- or 4-methylbenzenesuifonic acid, methylsulfuric add, ethyisulfuric acid, dodecylsulfuric acid, N-cyclohexylsuifamic add, N-methyl-, N-ethyl- or N-propyl-sulfamic acid, or other organic protonic acids, such as ascorbic acid.
For isolation or purification purposes it is also possible to use pharmaceuticaiiy unacceptable salts, for example picrates or perchlorates. For therapeutic use, only pharmaceuticaiiy acceptable salts or free compounds are employed (where applicable in the form of pharmaceutical preparations), and these are therefore preferred.-

In view of the close relationship between the novel compounds in free form and those in the form of their salts, including those salts that can be used as intermediates, for example in the purification or identification of the novel compounds, any reference to the free compounds hereinbefore and hereinafter is to be understood as referring also to the corresponding salts, as appropriate and expedient.
The compounds of formula I have valuable pharmacological properties, as described hereinbefore and hereinafter.
In formula I the following significances are preferred independently, collectively or in any combination or sub-combination. In each of the following significances A is C or N preferably C: -- -
(a) each of Raor R2 independently is hydrogen, CrC6alkyl, e.g. methyl, ethyl or isopropyl, _
hydroxyCi-Cealkyl, e.g. hydroxyethyl or hydroxybutyl, haloCf-Csalkyl, e.g. trifluoromethyl, unsubstituted or substituted C5-C10aryl, e.g. phenyl or methoxyphenyl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, O and S, e.g. morpholino, plperidino," piperazino or N-methylpiperazino, GpCealkoxy, e.g.-methoxy, ethoxy or isopropoxy, haloCt-Csalkoxy, e.g. trlfluoromethoxy, C^-Cioaryloxy, e.g., phenoxy, unsubstituted or substituted heterocyclyloxy, e.g. 1-methyM-piperidyloxy, — unsubstituted or substituted heterocyc!ylCrC8alkoxy, e.g. 2-(1-imidazolyi)ethoxy, 3-morpholinopropoxy or 2-morpholinoethoxy, unsubstituted or substituted amino, e.g. -methylamihb; dimethylamino or acetylamino, Ct-Cealkylsulfonyl, e.g. methylsulfonyl,
halogen, e.g. fluoro or chloro, unsubstituted or substituted carbamoyl, e.g
cyclohexylcarbamoyl, piperidinocarbonyl, piperazinocarbonyl, N-methylpiperazinocarbonyl or morpholinocarbonyl, unsubstituted or substituted sulfamoyl, e.g. sulfamoyl, methyisulfamoyl or dimethylsulfamoyl; preferably hydrogen, piperazino, N-methylpiperazino or 1-methyl-4-piperidyloxy, in particular hydrogen;
(b) R1 is hydrogen, CrC8alkyl, e.g. methyl, ethyl or isopropyl, hydroxyCrCaalkyl, e.g.
hydroxyethyl or hydroxybutyl, haIoCrC8alkyl, e.g. trlfluoromethyl, unsubstituted or substituted Cg-C^ary!. e.g. phenyl or methoxyphenyl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, O and S, e.g. morpholino, piperidino, piperazino or N-methylpiperazino, CrCealkoxy, e.g. methoxy, ethoxy or isopropoxy, haloCrCealkoxy, e.g. trlfluoromethoxy, Cs-C10aryloxy, e.g. phenoxy, unsubstituted or substituted heterocvclvloxv. e.a. l-methvl-4-Dioeridvloxv. unsuhstituted or

0 and S, e.g. morpholino, piperidino, piperazlno or N-methylpiperazino, CrC8alkoxy, e.g. methoxy, ethoxy or isopropoxy, haloCrC8aIkoxy, e.g. trffiuoromethoxy, C5-C10arytoxy, e.g. phenoxy, unsubstituted or substituted heterocyclyloxy, e.g. 1-methyI-4-piperidyloxy, unsubstituted or substituted heterocyclylCrCsalkoxy, e.g. 2-(1-imidazolyI)ethoxy, 3-morpholinopropoxy or 2-morpholinoethoxy, unsubstituted or substituted amino, e.g. methylamino, dimethyiamino or acetylamino, CrCsalkylsulfonyl, e.g. methylsulfonyl, halogen, e.g. fluoro or chloro, unsubstituted or substituted carbamoyl, e.g. cyclohexylcarbamoyl, piperidinocarbonyl, piperazinocarbonyl, N-methylpiperazinocarbonyl or morpholinocarbonyl, unsubstituted or substituted sulfamoyl, e.g. sulfamoyl, methylsulfamoyl or dimethylsulfamoyi; preferably hydrogen, methyl, isopropyl, trifluoromethyl; phenylVmethoxyphenyl, piperidino, piperazino,N-methylpiperazino, morpholino, methoxy, ethoxy, isopropoxy, phenoxy, 3-morpholinopropoxy, 2-morphonnoethoxy, 2-(1-irriidazoIyI)ethoxy, dimethyiamino, fluoro, morpholinocarbonyl, piperidinocarbonyl, piperazinocarbonyl or cyclohexylcarbamoyl;
(i) R8 is hydrogen, CrCsalkyl, e.g. methyl, ethyl or isopropyl, hydroxyCrC8aIkyl, e.g.
hydroxyethyl or hydroxybutyl, haloCt-Caalkyl, e-9- trifluoromethyl, Cs-Cioaryl, e.g. phenyl or methoxyphenyirunsubstituted or substituted 5 or 6 membered heterocydyl comprising 1 or 2 hetero atoms selected from N, 0 and S, e.g; morpholino, piperidino, piperazino or N-methylpiperazino, Ci-Caalkoxy, e.g. methoxy, ethoxy or isopropoxy, haIoCrC8aIkoxy, e.g. " trifluoromethoxy, Cs-Cioaryloxy, e.g. phenoxy, unsubstituted or substituted heterocyclyloxy, e.g. 1-methyl-4-piperidyIdxy,~unsubstituted or substituted heterocyclylCi-C8alkbxy, e.g. 2-(1-imidazolyl)ethoxy, 3-morpholinopropoxy or 2-morpholinoethoxy, unsubstituted or substituted amino, e.g. methylamino or dimethyiamino, CrC8alkylsulfonyk e.g. methylsulfonyl, halogen, e.g. fluoro or chloro, unsubstituted or substituted carbamoyl, e.g. cyclohexylcarbamoyl, piperidinocarbonyl, piperazinocarbonyl, N-methylpiperazinocarbonyl or morpholinocarbonyl, unsubstituted or substituted sulfamoyl, e.g. sulfamoyl, methylsulfamoyl or dimethylsulfamoyi, cyano, or nitro; preferably hydrogen, methyl, piperidino, piperazino, N-methylpiperazino, morpholino, methoxy, ethoxy, trifluoromethoxy, phenoxy, 1-methyI-4-piperidyloxy, 3-morpholinopropoxy, 2-morpholinoethoxy, 3-(N-methylpiperazino)-propoxy, methylamino, fluoro, chloro, sulfamoyl or nitro;
0) R10 is d-Cealkyl, e.g. methyl, ethyl or butyl, hydroxyCi-CealkyI, e.g. hydroxyethyl or hydroxybutyl, haloCrC8alkyl, e.g. trifluoromethyl, d-C8aIkoxy, e.g. methoxy or ethoxy, unsubstituted or substituted heterocyclylCrC8alkoxy, e.g. 2-(1-imidazolyl)ethoxy, unsubstituted or substituted amino, e.g. methylamino or dimethyiamino, halogen, e.g. fluoro

or chloro; carboxy, carbamoyl, or unsubstituted or substituted sulfamoyl, e.g. sulfamoyl, methylsulfamoyl or dimethylsulfamoyt; preferably methyl, butyl, methoxy, ethoxy, 2-(1-imidazolyi)ethoxy, methylamino, dimethylamino or fluoro; and (k) each pair of adjacent substltuents R7 and R8, or R8 and R9 or R9 and R1D, are ~NH-CH=CH-, -CH=CH-NH-, -NH-N=CH-, -CH=N-NH-, -CH2-CH2-CHr, -CH2-CH2-CH2-CH2-, -Chfe-CHs-0-, -CH=CH-0-, -OCH2-0-, or -0-CF2-0-; preferably the pair of adjacent substltuents R7 and R8 or R8 and R9 being -O-CH2-O- or the pair of adjacent substltuents R9 and R10 being -NH-CH=CH-, -CH=N-NH-, -CHrCH2-CH2-, -CHrCH^CHrCHr or-0-CF2-0-.
More preferred are the following meanings, independently, collectively or In any combination or
sub-combinations^-^^T-'^^r—'-^- -—^r- ^ ---J;-::""-——-- v-.vr-r.r —•- ■— I
(a') each of R° or R^Hndependently is hydrogen, Ci-Cfialkyl, e.g; methyl, ethyl or isopropyl,
haloCrCBalkyJre.g..trifluoromethyl, unsubstituted or substituted 5 or 6 membered
heterocyclyl comprising.l.or 2 hetero atoms selected from N, O and S, e.g. morpholino,
piperidino, piperaano or N-methylpiperazino, d-Caalkoxy, e.g. methoxy, ethoxy ^sr
isopropoxy, unsubstituted or substituted heterocyclyloxy, e.g. lHDethyI-4-piperidyloxy,
unsubstituted or substituted heterocydylCrCealkoxy, e.g. 2-(1-imldazolyI)ethoxy, 3-^ ^
moipholinopropoxy or 2-morpholinoethoxy, unsubstituted or substituted amino, e.g."
methylamino, dimethylamino or acety!amino,-halogen, e.g. fluoro or chloro; preferably
hydrogen, piperazlno, N-methylpiperazino or 1-methyl-4-piperidyloxy, in particular ^
hyarogen; -_::= __ :u-~ ■.!■■:- _ - __, - _;--_„" ■-._;■—_:
(b') R1 is hydrogen, Cy-Caa'kyli e.g, methyl, ethyl or isopropyl, haIoCrCBalkyl, e.g.-
trifluoromethyl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, O and S, e.g. morpholino, piperidino, piperazino or IM-methylpiperazino, Ct-Cealkoxy, e.g. methoxy, ethoxy or isopropoxy, unsubstituted or substituted heterocyclyloxy, e.g. l-methyl-4-piperidyIoxy, unsubstituted or substituted heterocyclylCrCealkoxy, e.g. 2-(1-imidazolyI)ethoxyI 3-morphoIinopropoxy or 2-morpholinoethoxy, unsubstituted or substituted amino, e.g. methylamino, dimethylamino or acetylamino, halogen, e.g. fluoro or chloro; preferably hydrogen, piperazino, N-rnethylpiperazino, morpholino, 1-methyW-piperidinyloxy, 3-morpholinopropoxy or 2-
morpholinoethoxy, in particular hydrogen; - - -
(c') R3 is hydrogen, d-Cealkyl, e.g. methyl or ethyl, haloCi-Cealkyl, e.g. trifiuoromethylr
unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 heteroatoms selected from N, O and S, e.g. 2-pyrrolidonyl or S,S-dioxoisothiazolidinyl, d-Csaikoxy, e.g

methoxy, substituted amino, e.g. acetyiamino, acetyl-methyl-amino, benzoylamino, methylsulfonylamino or phenylsulfonylamino, Ci-Csalkylsulfonyl, e.g. methylsulfonyl, Cr Cloarylsulfony!, e.g. phenylsulfonyl, halogen, e.g. fluoro or chloro, carboxy, substituted or unsubstituted carbamoyl, e.g. carbamoyl, methylcarbamoyl or dimethylcarbarnoyl, unsubstltuted or substituted sulfamoyl, e.g. sulfamoyl, methylsulfamoyl, propylsulfamoyl, isopropylsulfamoyl, isobutylsulfamoyl, cyclopropylmethyl-sulfamoyl, 2,2,2-trifluoroethylsulfamoyl, dimethylsulfamoyl or morpholinosulfonyl; preferably sulfamoyl, methylsulfamoyl or propylsulfamoyl;
(d1) each pair of adjacent substituents R° and R1, or R1 and R2, or R2 and R3 are -CH^NH-CO-, -
CH2-NH-SO2-, -CHrCHrSOr, -0-CHrO-, or-0-CF2-0-, and such pairs wherein hydrogen
in NH is replaced by CrCealkyl; preferably the pair of adjacent substituents R° and R\ or R1
and R2 being -0-CH2-0-, and the pair of adjacent substituents R2 and R3 being -CH2-NH-
CO-or-CHr^lH-S02-r\ "
(e*) R4 is hydrogen;
(f) R is hydrogen,_haiogen, e.g. chloro or bromo, haloCrCealkyl, e.g. trifluoromethyl, or nitro; preferably hydrogen, chloro, bromo, trifluoromethyl or nitro; in particular chloro or bromo;
(g1) Re is hydrogen;
(IV) each of R7 and R9 independently is hydrogen, CrCsalkyl, e.g. methyl, ethyl or isopropyl, haloCi-Cgalkyt, e.g. trifluoromethyl, unsubstltuted or substituted Cs-Cioaryl, e.g. phenyl or methoxyphenyf, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, O and S, e.g. morpholino, piperidino, piperazino or N-methylpiperazino, CrCealkoxy, e.g. methoxy, ethoxy or isopropoxy, unsubstituted or substituted heterocyclyloxy, e.g. 1-methyl-4-piperidyIoxy, unsubstituted or substituted heterocyclylCi-Caalkoxy, e.g. 2-(1-imidazoIyI)ethoxy, 3-morpholinopropoxy or 2-morpholinoethoxy, unsubstituted or substituted amino, e.g. methylamino, dimethylamino or acetylamino, halogen, e.g. fluoro or chloro, unsubstituted or substituted carbamoyl, e.g. cyclohexylcarbamoyl, piperidinocarbonyl, piperazinocarbonyl, N-methylpiperazinocarbonyl or morpholinocarbonyl, unsubstituted or substituted sulfamoyl, e.g. sulfamoyl, methylsulfamoyl or dimethylsulfamoyl; preferably hydrogen, methyl, isopropyl, trifluoromethyl, phenyl, o-, m- or p-methoxyphenyl, piperidino, piperazino, N-methylpiperazino, morpholino, methoxy, ethoxy, isopropoxy, phenoxy, 3-morpholinopropoxy, 2-morphoiinoethoxy, 2-(1-imidazolyl)ethoxy, dimethylamino, fluoro, morpholinocarbonyl, piperidinocarbonyl, piperazinocarbonyl or cyclohexylcarbamoyl;

(0 RB is hydrogen, CrCsalkyl, e.g. methyl, ethyl or isopropyl, haloCf-Caaikyl, e.g. trifluoromethyl, Ce-Cioaryl, e.g. phenyl or methoxyphenyl, unsubstituted or substituted 5 or 6 mernbered heterocyclyl comprising 1 or 2 hetero atoms selected from N, O and S, e.g. morpholino, piperidino, piperazino or N-methyipiperazino, d-Csalkoxy, e.g. methoxy, ethoxy or isopropoxy, haloCi-Cealkoxy, e.g. trifluoromethoxy, Cs-Cnoaryloxy, e.g. phenoxy, unsubstituted or substituted heterocyclyloxy, e.g. l-methyI-4-piperidyloxy, unsubstituted or substituted heterocyclyld-Csalkoxy, e.g. 2-(1-imidazolyI)ethoxy, 3-morphoIinopropoxy or 2-rnorpholinoethoxy, unsubstituted or substituted amino, e.g. methylamino or dimethylamino, halogen, e.g. fluoro or chioro, unsubstituted or substituted sulfamoyl, e.g. sulfamoyl, methylsulfamoyl or dimethylsuffamoyl, or nitro; preferably hydrogen, methyl, piperidino, piperazino, N-methylpiperazino, morpholino, methoxy, ethoxy, trifluoromethoxy, phenoxy, 1-methyl-4-piperidyloxy, 3-morphoIinopropbxy, 2-morpholinoethoxy, 3-(N-methylpiperazino)-propoxy, methylamino, fluoro, chioro, sulfamoyl or nitro;
(j') R10 is CrCsalkyl, e.g. methyl, ethyl or butyl, haloCrC8alkyl, e.g. trifluoromethyl, d-C8alkoxy, e.g. methoxy or ethoxy, unsubstituted or substituted heterocydylCi-C8a!koxy, e.g. 2-(1-ImidazolyOethoxy" unsubstituted or substituted amino, e.g. methylamino or dimethylamino, halogen, e.g. fluoro or chioro; preferably methyl, butyl, methoxy, ethoxy, 2-(1-imidazolyljethoxy, methylamino, dimethylamino or fluoro; and
(k') %ach pair of adjacent substituents R7 and R8, or R6 and R9 or R9 and R10, are -NH-CH=CH-, r -CH=CH-NH-, -NH-N=CH-, ^CHsN-NH-r-CHz-CHrCHz-i -CHr^HrCH^CH^, -0-CH2-0-, or -OCF2-O-; preferably the pair of adjacent substituents R7 and R8 or R8 and R9 being -O-CH2-O- or the pair of adjacent substituents R9 and R10 being -NH-CH=CH-, -CH=N-NH-, -" CHz-CHz-CHn -CH2-CHrCH2-CHr or -O-CFz-O.
Most preferred as compounds of the formula I are those wherein the substituents have the meaning given in the Examples.
The present invention also provides a process for the production of a compound of formula I, comprising reacting a compound of formula II

If one or more other functional groups, for example carboxy, hydroxy or amino, are or need to be protected in a compound of formula II or III, because they should not take part in the reaction, these are such groups as are usually used in the synthesis of peptide compounds, cephalosporins and penicillins, as well as nucleic acid derivatives and sugars.
The protecting groups may already be present in precursors and should protect the functional groups concerned against unwanted secondary reactions, such as substitution reaction or solvolysis. It is a characteristic of protecting groups that they lend themselves readily, Le. without undesired secondary reactions, to removal, typically by solvolysis, reduction, photolysis or also by enzymtfactivity, for example under conditions analogous to physiological conditions; ^ and that they are not present in the end-products; The specialist knows, or can easily establish, which protecting groups are suitable with the reactions mentioned hereinabove-;
Salts of a compound of formula I with a salt-forming group may be prepared in a manner known per se. Acid addition salts of compounds of formula I may thus be obtained by treatment with an acid or with a suitable anion exchange reagent - ± ^i:n
Salts can usually be converted to compounds in free form, e.g. by treating with suitable basic agents, for example with alkali metal carbonates, alkali metal hydrogencarbonates, or alkali -metal hydroxides, typfcally potassium carbonate or sodium TiydroxideT- '-
Stereoisomer^ mixtures, e.g; mixtures of diastereomers, can be separated into their corresponding isomers in a manner known per se by means of suitable separation methods. Diastereomeric mixtures for example may be separated into their individual diastereomers by means of fractionated crystallization, chromatography, solvent distribution, and similar procedures. This separation may take place either at the level of a starting compound or in a compound of formula I itself. Enantiomers may be separated through the formation of diastereomeric salts, for example by salt formation with an enantiomer-pure chiral acid, or by means of chromatography, for example by HPLC, using chromatographic substrates with chiral ligands.
It should be emphasized that reactions analogous to the conversions mentioned in this chapter may also take place at the level of appropriate intermediates.

The compounds of formula I, including their salts, are also obtainable in the form of hydrates, or their crystals can include for example the solvent used for crystallization (present as solvates).

wherein R\ R2, R3, R4, R5 and Re are as defined above, and Y1 and Y2 are identical or different
leaving groups as defined above for Y. The reaction conditions are those mentioned above for
the reaction of a compound of formula II with a compound of formula III. "-■ "- "
The compounds of formula IV and V are known or may be produced in accordance with known
procedures. - -
The compounds of formula I and their pharmaceutically acceptable salts exhibit valuable pharmacological properties when tested in vitro in cell-free kinase assays and in cellular assays, and are therefore useful as pharmaceuticals. In particular, the compounds of the invention are inhibitors of Focal Adhesion Kinase, and are useful as pharmaceuticals to treat conditions caused by a malfunction of signal cascades connected with Focal Adhesion Kinase, in particular tumors as described hereinbelow.
Focal Adhesion Kinase (FAK) is a key enzyme in the integrin-mediated outside-in signal - - ■ cascade (D. Schlaepfer et al., Prog Biophys Mol Biol 1999, 71,435-478). Interaction between cells and extracellular matrix (ECM) proteins is transduced as intracellular signals important for growth, survival and migration through cell surface receptors, integrins. FAK plays an essential

role in these integrin-mediated outside-in signal cascades. The trigger in the signal transduction cascade is the autophosphorylation of Y397. Phosphorylated Y397 is a SH2 docking site for Src family tyrosine kinases. The bound c-Src kinase phosphorylates other tyrosine residues in FAK. Among them, phsophorylated Y925 becomes a binding site for the SH2 site of Grb2 small adaptor protein. This direct binding of Grb2 to FAK is one of the key steps for the activation of down stream targets such as the Ras-ERK2/MAP kinase cascade. *
The inhibition of endogenous FAK signalling results in reduced motility and in some cases induces cell death; On the other hand, enhancing FAK signalling by exogenous expression increases oelhnotiltty and transmitting a cell survival signal from ECM. In addition FAK is.^-v-' overexpressed in invasive and metastatic epithelial, mesenchymal, thyroid and prostate cancers. Consequently, an inhibitor of FAK is likely tot>e a drug for anti-tumor growth and metastasis. The compounds of the invention are thus indicated, for example, to prevent and/or treat a vertebrate and more particularly a mammal, affected by a neoplastic disease, in particular: breast tumor, cancer of the bowel (colon and rectum), stomach cancer and cancer of the ovary and prostate, non-small cell lung cancer, small cell lung cancer, cancer of liver, melanoma, bladder tumor and cancer of head and neck.
The relation between FAK Inhibition and immuno-system is described e.g. in GA van Seventer et al., Eur. J.-lmmunol; 2001, 31,1417-1427. Therefore, the compounds of xhe invention are, for example, useful to prevent and/or treat a vertebrate and more particularly a mammal, affected by immune system disorders, diseases or disorders mediated by T lymphocytes, B lymphocytes, mast cells and/or eosinophils e.g. acute or chronic rejection of organ or tissue alio- or xenografts, atherosclerosis, vascular occlusion due to vascular injury such as angioplasty, restenosis, hypertension, heart failure, chronic obstructive pulmonary disease, CNS disease such as Alzheimer disease or amyotrophic lateral sclerosis, cancer, infectious disease such as AIDS, septic shock or adult respiratory distress syndrome, ischemia/reperfusion injury e.g. myocardial infarction, stroke, gut ischemia, renal failure or hemorrhage shock, or traumatic shock. The agent of the invention are also useful in the treatment and/or prevention of acute or chronic inflammatory diseases or disorders or autoimmune diseases e.g. rheumatoid arthritis, osteoarthritis, systemic lupus erythematosus, Hashimoto's thyroiditis, multiple sclerosis, myasthenia gravis, diabetes (type i and II) and the disorders associated with therewith;-" ~ respiratory diseases such as asthma or inflammatory liver injury, inflammatory glomerular injury, cutaneous manifestations of immunologically-mediated disorders or illnesses, inflammatory and

hyperproliferative skin diseases (such as psoriasis, atopic dermatitis, allergic contact dermatitis, irritant contact dermatitis and further eczematous dermatitises, seborrhoeic dermatitis), inflammatory eye diseases, e.g. Sjoegren's syndrome, keratoconjunctivitis or uveitis, inflammatory bowel disease, Crohn's disease or ulcerative colitis.
Compounds of the invention are active in a FAX assay system as described in the Examples, and show an inhibition IC50 in the range of 1 nM to 100 nM. Particularly active are the compounds Example No, 3-12 and No. 3-17 described hereinbelow showing IC50 vales in the range of 1 to 5 nM.
Some of the compounds of the invention exhibit also ZAP-70 (zeta chain-associated protein of 70 kD) protein tyrosine kinase inhibiting activity. ZAP-70 protein tyrosine kinase interaction of the agents of the invention may be demonstrated by their ability to prevent phosphorylation of e.g. LAT-11 (linker for activation of T cell) by human ZAP-70 protein tyrosine kinase in aqueous solution, as described in the Examples. The compounds of the invention are thus also indicated for the prevention or treatment of disorders or diseases where ZAP-70 inhibition inhibition play a role.
Compounds of the invention are active in a ZAP-70 assay system as described in the Examples, and show an inhibition IC50 in the range of 1 pM to 10 pM, e.g. the compounds Example No. 2 and No. 3-2 described hereinbelow.
Compounds of the present invention are also good inhibitors of the IGF-IR (insulin like growth factor receptor 1) and are therefore useful in the treatment of IGF-1R mediated diseases for example such diseases include proliferative diseases, such as tumours, like for example breast, renal, prostate, colorectal, thyroid, ovarian, pancreas, neuronal, lung, uterine and gastrointestinal tumours as well as osteosarcomas and melanomas. The efficacy of the compounds of the invention as inhibitors of IGF-IR tyrosine kinase activity can be demonstrated using a cellular "Capture ELISA". In this assay the activity of the compounds of the invention against Insulin-like growth factor I (IGF-I) induced autophosphoryiation of the IGF-IR is determined.
The compounds of the present invention also exhibit powerful inhibition of the tyrosine kinase activity of anaplastic lymphoma kinase (ALK) and the fusion protein of NPM-ALK. This protein tyrosine kinase results from a gene fusion of nucleophosmin (NPM) and the anaplastic lymphoma kinase (ALK), rendering the protein tyrosine kinase activity of ALK ligand-

independent. NPM-ALK plays a key role in signal transmission in a number of hernatopoetic and other human cells leading to hematological and neoplastic diseases, for example in anaplastic large-cell lymphoma (ALCL) and non-Hodgkin's lymphomas (NHL), specifically in ALK+ NHL or Alkomas, in inflammatory myofibroblastic tumors (IMT) and neuroblastomas. (Duyster J et al. 2001 Oncogene 20, 5623-5637). In addition to NPM-ALK, other gene fusions have been identified in human hematological and neoplastic diseases; mainly TPM3-ALK (a fusion of nonmuscle tropomyosin with ALK).
The inhibition of ALK tyrosine kinase activity can be demonstrated using known methods,
for example using the recombinant kinase domain of the ALK in analogy to the^EGF-R,; f*
kinase assay described in J. Wood et al. Cancer Res. §0, 2178*2189 (2000). In vitro ■■- --
enzyme assays using GST-ALK protein tyrosine kinase are performed in 96-weII plates as^
a filter binding assay in 20 mM TrisHCI, pH = 7,5, 3 mM MgCI2,40 mM MnCI2,1-mM DTT;
0.1 pCi/assay (=30 pi) [T^PJ-ATP, 2 pM ATP, 3 pg/ml poly (Glu, Tyr4:1) Poly-EY: {Sigma
P-0275), 1 % DMSO, 25 ng ALK enzyme. Assays are incubated for 10 min at ambient
temperature. Reactions are terminated by adding 50 pi of 125 itiM EDTA, and the reaction-
mixture is transferred onto a MAIP Multiscreen plate (Miliipore, Bedford, MA, USA),
previously wet with methanol, and rehydrated for 5 min with H20. Following washing (0.5
% H3PO4), plates are counted in a liquid scintillation counter. IG50 values are calculated by ~
linear regression-analysis of the percentage inhibition. Compared with the controLwithout --=
inhibitor, the compounds of formula I inhibit the enzyme activity by 50 % (IC50), for y- -^
example in a concentration of from 0.001 to 0.5 ^LM, especially from 0.01 to 0.1 \M:
The compounds of formula I potently inhibit the growth of human NPM-ALK overexpressing murine BaF3 cells (DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany). The expression of NPM-ALK is achieved by transfecting the BaF3 cell line with an expression vector pClneo™ (Promega Corp., Madison Wl, USA) coding for NPM-ALK and subsequent selection of G418 resistant cells. Non-transfected BaF3 cells depend on IL-3 for cell survival. In contrast NPM-ALK expressing BaF3 cells (named BaF3-NPM-ALK hereinafter) can proliferate In the absence of IL-3 because they obtain proliferative signal through NPM-ALK kinase. Putative inhibitors of toe NPM-ALK kinase therefore abolish the^ growth signal and result In antiproliferative activity. The antiproliferative activity of putative" ^~ Inhibitors of the NPM-ALK kinase can however be overcome by addition of IL-3 which provides growth signals through an NPM-ALK independent mechanism. [For an analogous cell system

using FLT3 kinase see E Weisberg et al. Cancer Cell; 1,433-443 (2002)]. The inhibitory activity
of the compounds of formula I is determined, briefly, as follows: BaF3-NPM-ALK cells
(15,000/micratltre plate well) are transferred to 96-well microtitre plates. The test compounds
[dissolved in dimethyl sulfoxide (DMSO)] are added in a series of concentrations (dilution series)
in such a manner that the final concentration of DMSO is not greater than 1 % (v/v). After the
addition, the plates are incubated for two days during which the control cultures without test
compound are able to undergo two cell-division cycles. The growth of the BaF3-NPM-ALK cells
is measured by means of Yopro™ staining [T Idziorek et al. J. Immunol. Methods; 185: 249-258
(1995)]: 25 pi of lysis buffer consisting of 20 mM sodium citrate, pH 4.0,26.8 mM sodium
chloride, 0.4 % NP40, 20 mM EDTA and 20 mM is added to each well. Cell lysis is completed
within 60 min at room temperature and total amount of Yopro bound to DNA is determined by :
measurement using the Cytofluor II 96-well reader (PerSeptive Biosysterns) with the following
settings: Excitation (nm) 485/20 and Emission (nm) 530/25.
IC50 values are determined by a computer-aided system using the formula: - ■----
IC50 = [(ABStert- ABS8tari)/(ABSCortn)i - ABS^rt)] x 100. (ABS = absorption)
The )C50 value in those experiments is given as that concentration of the test compound in "
question that results In a cell count that is 50 % lower than that obtained using the control "" "~~^ without inhibitor. The compounds of formula I exhibit inhibitory activity with an IC50 in the range from approximately 0.01 to 1 ^iM.
The antiproliferative acton of the compounds of formula I can also be determined in the human KARPAS-299 lymphoma cell line (DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany) [described in WG Dirks et al. int. J. Cancer 100. 49-56 (2002)] using the same methodology described above for the BaF3-NPM-ALK cell line. The compounds of formula I exhibit inhibitory activity with an IC50 in the range from approximately 0.01 to 1 /iM.
The action of the compounds of formula I on autophosphorylation of the ALK can be determined in the human KARPAS-299 lymphoma cell line by means of an immunoblot as described in WG Dirks et al. Int. J. Cancer 100,49-56 (2002). Inlhat test the compounds of formula I exhibit an IC5o of approximately from 0.001 to 1 pM.

Among the compounds of formula 1,2-[5-chloro-2-(2-methoxy-4-morphoIin-4-yl-phenylamino)-pyrimidin-4-yIamino]-N-methyl-benzamide is an especially potent ALK inhibitor, in that this compound inhibits the growth of the BaF3-NPM-ALK cells with an IC50 of 97 nM. Further specifically preferred compounds that inhibit the tyrosine kinase activity of anaplastic lymphoma kinase (ALK) are the compounds described hereinafter in the examples 7A and 7B, as well as 7-2, 7-15, 7-36, 7-39, 7-44 and 7-52, respectively, all of which are having an ICB0 within the range from <0.5 to 200 nM.
For the above uses In the treatment of neoplastic diseases and immune system disorders the -
required dosage wll of course vary depending on the mode trfadministration, tha ■particular^" —
condition to be treated and the effect desired, in general, satisfactory results are indicated to be
obtained systemically at daily dosages of from about 0.1 to about 100 mg/kg body weight. An ^^
indicated daily dosage in the larger mammal, -e.g. humans, is in the range from about 0.5 mg to
about 2000 mg, conveniently administered, for example, in divided doses up to four times a day^
or in retard form. .bw-:... ".--vnc^.. -r^i=;:- ••■i^.v ■•■?. ^c^i-v^ r; ^v a ^~,::\-,i-
The compounds of the invention may be administered by any conventional route, in particular--parenterally, for example in the form of injectable solutions or suspensions, enteraliy, preferably orally, for examplein the form of tablets or capsules, topically,. e.g. in theform of Jotions, geisr-ii:: ^ ointments or creamsror in a nasal or a suppository form. Pharmaceutical compositions comprising a compound of the invention in association with at least one pharmaceutical acceptable carrier or diluent may bemanufectured jn conventional manner by mixing with a pharmaceutically,. „ __^r. acceptable carrier or diluent. Unit dosage forms for oral administration contain, for example, from about 0.1 mg to about 500 mg of active substance. Topical administration is e.g. to the skin. A further form of topical administration is to the eye.
The pharmaceutical compositions of the present invention are prepared in a manner known per se, for example by means of conventional mixing, granulating, coating, dissolving or lyophilizing processes.
Preference is given to the use of solutions of the active ingredient, and also suspensions or —
dispersions, especially isqtonjc aqu^ or suspensions whiclvfor„ __. _-. --:
example in the case of lyophiiized compositions comprising the active ingredient alone or together with a carrier, for example mannitol, can be made up before use. The pharmaceutical

compositions may be sterilized and/or may comprise excipients, for example preservatives, stabilizers, wetting agents and/or emulsifiers, solubliizers, salts for regulating osmotic pressure and/or buffers and are prepared in a manner known per set for example by means of conventional dissolving and lyophilizing processes. The said solutions or suspensions may comprise viscosity-increasing agents, typically sodium caitoxymethylceliulose, carboxymethylcellulose, dextran, polyvinylpyrrolidone, or gelatins, or also solubliizers, e.g. Tween 80® (polyoxyethylene(20)sorbitan mono-oleate).
Suspensions in oil comprise as the oil component the vegetable, synthetic, or semi-synthetic oils customary for injection purposes. In respect of s_uch, special mention may be made of liquid fatty add esters that contain,as the acid component a long-chained fatty acid havingi from 8 to 22, especially from 12 to 22, carbon atoms, for example lauric acid, tridecylic acid, myristic acid, pentadecylic acid, palmitic acid, margaric acid, stearic acid, arachidic acid, behenic acid or corresponding unsaturated acids, for example oleic acid, elaidic acid, erucic acid, brassidic acid or linoleic acid, if desired with the addition of antioxidants, for example vitamin E, p-carotene or 3,5-di-tert-butyi-4-hydroxytoluene. The alcohol component of these fatty acid esters has a maximum of 6 carbon atoms and is a monovalent or polyvalent, for example a mono-, di-or trivalent, alcohol, for example methanol, ethanol, propanol, butanol or pentanol or the isomers thereof, but especially glycol and glycerol. As fatty acid esters, therefore, the following are _ mentioned: ethyl oleate, isopropyl.myristatejsopropy! palmitate, "Labrafil M 2375" ....„._..,..___ (polyoxyethylene glycerol), "Labrafil Ml 944 CS" (unsaturated polyglyco|ized glycerides prepared by aicoholysis of apricot kernel oil and consisting of glycerides and polyethylene glycol ester), "Labrasol" (saturated polyglycoiized glycerides prepared by aicoholysis of TCM and consisting of glycerides and polyethylene glycol ester; all available from Gattefoss§, France), and/or "Miglyol 812" (triglyceride of saturated fatty acids of chain length C8 to C12 from HQIs AG, Germany), but especially vegetable oils such as cottonseed oil, almond oil, olive oil, castor oil, sesame oil, soybean oil and more especially groundnut oil.
The manufacture of injectable preparations is usually carried out under sterile conditions, as is the filling, for example, into ampoules or vials, and the sealing of the containers.
Pharmaceutiqal„compositipn^fo)[, oral administration can be obtained, for example, by^ combining the active ingredient with one or more solid carriers, if desired granulating a resulting

mixture, and processing the mixture or granules, if desired or necessary, by the inclusion of additional excipients, to form tablets or tablet cores.
Suitable carriers are especially fillers, such as sugars, for example lactose, saccharose,
mannitol or sorbitol, cellulose preparations, and/or calcium phosphates, for example tricalcium
phosphate or calcium hydrogen phosphate, and also binders, such as starches, for example
corn, wheat, rice or potato starch, methylcellulose, hydroxypropyl methylcellulose, sodium
carboxymethylcellulose, and/or polyvinylpyrrolidone, and/or, if desired, disintegrators, such as
the above-mentioned starches, also carboxymethyl starch, crosslinked polyvinylpyrrolidone,
algintc acid or a salt thereof, such as sodium alginate. Additional excipients are especially flow
i conditioners and lubricants, for example silicic afctd, talc, stearic acid or salts thereof, such as
i
magnesium or calcium stearate, and/or polyethylene] glycol, or derivatives thereof.
Tablet cores can be provided with suitable, optionally enteric, coatings through the use of, inter alia, concentrated sugar solutions which may comprise gum arabic, talc, polyvinylpyrrolidone, polyethylene glycol and/or titanium dioxide, or exiting solutions in suitable organic solvents or solvent mixtures, or, for the preparation of enteric coatings, solutions of suitable cellulose preparations, such as acetyicellulose phthalate or hydroxypropylmethylcellulose phthaiate. Dyes or pigments may be added to the tablets or tablet coatings, for example for identification
purposes or to indicate different doses of active ingredient.
t
i-
Pharmaceutical compositions for oral administration jalso include hard capsules consisting of gelatin, and also soft, sealed capsules consisting of gelatin and a plasticizer, such as glycerol or sorbitol. The hard capsules may contain the active ingredient in the form of granules, for example in admixture with fillers, such as com starch, binders, and/or giidants, such as talc or magnesium stearate, and optionally stabilizers. In soft capsules, the active ingredient is preferably dissolved or suspended in suitable liquid excipients, such as fatty oils, paraffin oil or liquid polyethylene glycols or fatty acid esters of ethylene or propylene glycol, to which stabilizers and detergents, for example of the polyoxyethylene sorbitan fatty acid ester type, may also be added.
Pharmaceutical compositions suitable for rectal administration are, for example, suppositories that consist of a combination of the active ingredient and a suppository base. Suitable

suppository bases are, for example, natural or synthetic triglycerides, paraffin hydrocarbons, polyethylene glycols or higher alkanols.
For parenteral administration, aqueous solutions of an active ingredient in water-soluble form, for example of a water-soluble salt, or aqueous injection suspensions that contain viscosity-increasing substances, for example sodium carboxymethylcellulose, sorbitol and/or dextran, and, if desired, stabilizers, are especially suitable. The active ingredient, optionally together with excipients, can also be in the form of a lyophilizate and can be made into a solution before parenteral administration by the addition of suitable solvents.
Solutbns such as are used, for example, for parenteral administration can also be employed as Infusion solutions.
Preferred preservatives are, for example, antioxidants, such as ascorbic acid, or microbicides,
such as sorblc acid or benzoic acid. r .._... -
The compounds of the invention may be administered as the sole active ingredient or together with other drugs useful against neoplastic diseases or useful in immunomodulating regimens. For example, the agents of the invention may be used in accordance with the invention in combination with pharmaceutical compositions effective in various diseases as described above, e.g. with cyclophosphamide, 5-fluorouracil, fiudarabine, gemcitabine, cisplatinum, carboplatin, vincristine, vinblastine, etoposide, irinotecan, paclitaxel, docetaxel, rituxan, doxorubicine, gefitinib, or imatinlb; or also with cyclosporins, rapamycins, ascomycins or their immunosuppressive analogs, e.g. cyclosporin A, cyclosporin G, FK-506, siroiimus or everoiimus, corticosteroids, e.g. prednisone, cyclophosphamide, azathioprene, methotrexate, gold salts, sulfasalazine, antimalarials, brequinar, ieflunomide, mizoribine, mycophenolic acid, mycophenolate, mofetil, 15-deoxyspergualine, immuno-suppressive monoclonal antibodies, e.g. monoclonal antibodies to leukocyte receptors, e.g. MHC, CD2, CD3, CD4, CD7, CD25, CD28, CD40, CD45, CD58, CD80, CD86f CD152, CD137, CD154, ICOS, LFA-1, VLA-4 or their ligands, or other immunomodulatory compounds, e.g. CTLA41g.
In accordance with the foregoing, the present invention also provides:
(1) A compound of the invention for use as a pharmaceutical;

(2) a compound of the invention for use as a FAK inhibitor, an ALK inhibitor and/or ZAP-70 inhibitor, for example for use in any of the particular indications hereinbefore set forth;
(3) a pharmaceutical composition, e.g. for use in any of the indications herein before set forth, comprising a compound of the invention as active ingredient together with one or more pharmaceutically acceptable diluents or carriers;
(4) a method for the treatment of any particular indication set forth hereinbefore in a subject in need thereof which comprises administering an effective amount of a compound of the invention or a pharmaceutical composition comprising same;
(5) the use of a compound of the invention for the manufacture of a medicament for the treatment or prevention of a disease or condition in which FAK, ALK and/or ZAP-70 activation •-"-" plays a role or is implicated; : ---■—-tr - ■-=—?■-•-;Hr-:-----r ^ ----- -- ---;?"-- :-•—•.—
(6) the method as defined above under (4) comprising co-administration, e.girconcomitantiy 6r in sequence, of a therapeutically effective amount of a compound of the invention and one or more further drug substances,-said further drug substance being useful in any of the particular -indications set forth hereinbefore;- r v^,v--< -.^IT V^HLA -;..;( -n-iov: ■-.
(7) a combination comprising^ therapeutically effective amount of a compound of the invention oi and one or more further drug substances; said further drug-substance being useful in any of the particular indications set forth hereinbefore;; - ■ *■-■-—■ ,.^; ^ ,.,,.._.,..,;,,.,
(8) use of a compound of the invention for the manufacture of a medicament for the treatment :« or prevention of a disease which responds to inhibition of the anaplastic lymphoma kinase;
(9) the use according to (8), wherein the disease to be treated is selected from anaplastic large-cell lymphoma, nocnHodgkia's lymphomasr inflamm^ory myofibroblastic tumors and- - - -neuroblastomas;

(10) the use according to (8) or (9), wherein the compound is 2-[5-chloro-2-(2-methoxy-4-morpholin-4-yl-phenylamino)-pyrimidin-4-ylam[no]-N-methyl-benzamide or a pharmaceutically acceptable salt thereof, or any of the the compounds described hereinafter in the examples or a pharmaceutically acceptable salt of any one of these;
(11) a method for the treatment of a disease which responds to inhibition of the anaplastic lymphoma kinase, especially a disease selected from anaplastic large-cell lymphoma, non-Hodgkin's lymphomas, inflammatory myofibroblastic tumors and neuroblastomas, comprising administering an effective amount of a compound of the invention, especially 2-[5-chloro-2-(2-methoxy-4-moipholirr-^ or a-- - -^ pharmaceutically acceptable salt thereof.

Additionally preferred a compound according to the present invention that is useful as herein
before described is a compound specifically mentioned in the examples.
Additional specifically preferred compounds according to the present invention that are useful
either as FAK inhibitor, as ALK inhibitor or for inhibition of both and which may be prepared
essentially according to the methods described hereinbefore are the following:
2-[5-chloro-2-(2-methoxy-4^
benzamide,
^-(^[MlBipiperidinyM'-yl^
pyrimidine-2,4-diaminel
245-Chloro-2-[2HTiethoxy^{4-^^
isopropyl-benzenesulfonamide; ^ ---;-- - ,: -
2-[5-Bromo-2-(2-methoxy-5-mo
benzenesuifonamide
2-{2-[5-(1-Acetyl-pipendin4^
methyl-benzenesulfonamide, N-[5-Bromo-2-(2,5-2-methoxy-phe
benzenesuifonamide, ~ ~~
2-[5-Chloro-2-(5-fluoro-2HTiethoxy-phenylamino)-pyrimidin-4-ylamino]-N-isobutyl-
benzenesutfonamide, and
2^5-Chloro-2-[2-methoxy-5-(4-methyl-piperazin-1-ylmethyl)-phenylamino]"pyrimid^
N-methyl-benzenesulfonamide.
The invention also provides a compound of formula 2-{5-ChIoro-2-[4-(3-methylamino-pyrroIidin-1-yI)-phenylamino]-pyrimidin-4-ylamino}-N-isopropyI-benzenesulfonamide
The following Examples serve to illustrate the invention without limiting the invention in its scope.

Examples
Abbreviations
AcOH = acetic acid, ALK = anaplastic lymphoma kinase, ATP = adenosine 5-triphosphate,
brine = saturated sodium chloride solution, BSA = bovine serum albumin, DiAD = diisopropyl
azodicarboxylate, DtPCDI = N.N'-diisopropylcarbodiimid, DMAP = 4-dimethyIaminopyridine,
DMF = N,N-dimethylformamidef DTT = 1,4-d*rthio-D,L-threitoi, EDTA = ethylene diamine
tetraacetic acid, Et = ethyl, EtOAc = ethyl acetate, EtOH = ethanol, Eu-PT66 = LANCE™
europium-W1024-labelled anti-phosphotyrosine antibody (Perkin Elmer), FAK = Focal Adhesion
Kinase, FRET = fluorescence resonance energy transfer, HEPES = N-2-hydroxyethyl-
piperazine-N-2-ethanesulfonic acid, HOAt = 1-fiydroxy-7-azabenzbtriazoie, Me = methyl, RT-
PCR = reverse transcription polymerase chain reaction, SA-(SL)APC = Streptavidin conjugated
to SuperLight™ aIlop^roc^"nin^(Perkih Elmer), ^libsL = substituted; TBTU £ 0-(benk>triazol-1- ^
ylJ-N.N.^N'-tetramel^ THF = tetrahydrbfuran^: " :: ^:

To a solution of 2-(2f hydrogen chloride (17.0 mmol). After the reaction mixture is stirred at 110°C for 4 hours and cooled to room temperature, the mixture is neutralized with IN aqueous NaOH solution and Retracted with EtOAc (100 mLx3).
The organic layer is washed with brine, dried over Na2S04 and concentrated under reduced
pressure. The resulting black solid is washed with EtQH (90 mL), then purified with silica gel
column chromatography (CH2CI2J0 CH2QJ2.: AcOEW:2) to give 2-[5-chloro-2-(2-methoxy-4-
morpholin^yl-phenyiamino^ as a pale yellow solid.
1H-NMR (400MHz, DMSO-d6, 5): 2.80 (d, 3H, J = 4.52 Hz), 3.10-3.20 (m, 4H), 3.78 (s, 3H), 3.70-3.80 (m, 4H), 6.49 (dd^1H,^
8.04, 8.04 hfe)t IMS&x 1HJJ,=8.56 Hz^ 7.71 (dd, 1H,J = ^04,1.48 Hz), 8^o]s, 1H), 8.13(8,""" 1H), 8.59 (dJH, J = 8r04Ji)8JB8-8.75 (m, 1H), 11.59 (S, 1H). MS/7^469, 471 (M+1)V ,; v _
The following 2-[5-Chloro-2-(substituted phenylamino)-pyrimidin-4-ylamino}-N-methyI-benzamide are prepared from 2-(2,5-Dichloro-pyrimidin-4-ylamino)-N-methyI-benzamide and the corresponding aniline following the procedure of Example 7A.

N-Methyl-7-nirto-2,3^ihydroisoindolB~1-onet At room temperature, a solution of methyl 2-bromomethyl-6-nitrobenzoate (1.26 g, 4.63 mmol) in THF (13 mL) is treated with 2M soln. of methylamine in THF (14 mL), stirred for 5 hf diluted with EtOAc (100 mL)t washed with sat. aqueous solution of NaHC03 05 mL) and brine (15 mL)» dried (M9S04)» and evaporated. A flash chromatography (30 g of silica gel; Ch^C^/EtOAc 1:1) gives N-MethyI-7-nirto-2,3-dihydroisoindole-1-one (0.561 g, 2.92 mmol) in 63%. Yellow solid. Rf (CH2Cl2/EtOAc 1:1) 0.46.
1H-NMR (400 MHz, CDCI3) 3.21 (s), 4.44 (s), 7.63 - 7.69 (m, 2 H), 7.70 - 7.75 (m, 1 H).
7-Amino-H-methyl-2,3-dihydroisoindole~1-one. At room temperature, a solution of N-Methyl-7-nirto-2,3-dihydroisoindole-1-one (561.0 mg, 2.92 mmol) in EtOAc (8.4 mL) is treated with SnCl2-2H20 (2.68 g), stirred at 80*C under reflux for 5 h, and treated with 30 mL of 5N NaOH
at 0*C. After the both layers are separated, the aqueous layer is extracted with EtOAc (2x8 mL), the combined extracts are washed with brine (5 mL), dried (MgSC>4), and evaporated to
give 7-Amino-N-methyl-2I3-dihydroisoindole-1-one (455.9 g, 2.81 mmol) in 96%. Yellow solid.
Rf (CH2CI2/EtOAc 1:1) 0.53.1 H-NMR (400 MHz, CDCI3) 3.12 (s), 4.28 (s), 5.20 (br. s), 6.56 (cf,
J = 8.0), 6.68 (d, J = 8.0), 7.21 (dd, J = 8.0, 8.0).
7-(4-Am/no-2,5^/cfcfo^ At 0"C, a"
solution of 7-Amino-N-methyl-2f3-dihydroisoindole-1-one (232.6 mg, 1.43 mmol) in DMF (2.0 mL) is treated with 60% NaH (89.8 mg), stirred at the same temperature for 1.5 h, treated with a solution of 2,4,5-trichlropyrimidine (0.557 g) in DMF (3.5 mL), stirred for 1 h, and warmed to room temperature. After furthermore stirring for 13 h, the mixture is treated with sat. aqueous NH4CI (6 mL), and the resulting brown precipitates are collected by a filtration, followed by
washing with H20, hexane, and CH3CN to give 7-(4-Amino-2,5-dichloropyrimidin-4-yl)amino-N-
methyl-2,3-dihydroisoindole-1-one (130.2 g, 0.416 mmol) in 26%. Brown solid. Rf
(CH2CI2/EtOAc 1:1) 0.50. ^H-NMR (400 MHz, CDCI3): 3.22 (s), 4.43 (s), 7.15 (d, J = 8.0), 7.59 {dd, J = 8.0, 8.0), 8.24 (s), 8.71 (d, J = 8.0), 11.05 (br. $).

washed with H20, and dried under reduced pressure to give an intermediate (4.80 g) (10.96 mmol, 91%) as yellow solid.
NMR (400MHz, DMSO-d6,8): 3.10-3.20 (m, 4H), 3.70-3.80 (m, 4H), 3.93 (s, 3H), 6.53 (dd, 1H, J = 9.08, 2.0 Hz), 6.70 (d, 1H, J = 2.0 Hz), 7.49-7.54 (m, 1H), 7.67 (d, 1H, J = 8.56 Hz), 7.89 (s, 1H), 7.85-7.95 (m, 1H), 8.23 (d, 1H, J = 9.08 Hz), 8.26 (d, 1H, J = 8.56Hz), 12.60 (s, 1H).
To a 1M solution of methylamine in THF (560 jd, 0.56 mmol) is added 82 mg of the obtained intermediate (0.187 mmol) followed by 1M solution of NaHMDS in THF (560 fil, 0.56 mmol) dropwise. After the reaction mixture is stirred for 10 minutes, 5 mL of H20 is added and extraction is performed with AcOEt The organic layer is washed with brine, dried over Na2S04l concentrated under reduced pressure, and purified by silica gel column chromatography (Hexane: AcOEt=1:1 to AcOEt) to give the title compound as a pale yellow solid. Data are given in Example 7A.
By repeating the procedures described above using appropriate'starting materials and conditions the following compounds are obtained as identified below.

To a solution of 2-(Propane-1-sutfonyl)-phenyiamine (3.69g, 18.5 mmol) of N,N-dimethylformamide (40ml), sodium hydride (1.48g, 37 mmol) Is added portionwise at 0°C. After stirring, 2,4,5-trichloropyrimidine (2.1 mLf 18.5 mmol) is added. The mixture is stirred at 0°C for 30 minutes and is further stirred at room temperature for 7hrs. After adding saturated aqueous ammonium chloride, the mixture is poured into water and extracted twice with ethyl acetate. The organic layer is washed with brine, dried over sodium sulfate, and evaporated in vacuo. The residue is purified by silica gel column chromatography (n-hexane - ethyl acetate gradient) to afford the title compound as colorless solids.
1H-NMR (CDCl3), 5 (ppm): 0.99 (t, 3H), 1.77 (d, 2H), 3.07-3.11 (m, 2H), 7.26 (s, 1H), 7.32 (ddd, 1H), 7.73 (ddd, 1H), 7.95 (dd, 1H), 8.31 (s, 1H), 8.61 (dd, 1H), 9.94 (bs, 1H). Rf (n-hexane : ethyl acetate = 3:1): 0.63



Example 36-16
Synthesis of substituted amines which are commercially not available:
Preparation of S-amino-ff-methoxv^methvlbiphenvl
To a solution of 4-methoxyphenyI-boronic acid (500 mg, 329 mmol) in toluene (5.2 mL) and
ethanol (1.3 mL), potassium carbonate (910 mg, 6.58 mmol), tetrakis(triphenylphosphine)-
palladium (228.1 mg, 0.099 mmol) and 4-bromo-1-me%l-2-nitrobenzene (711 mg, 3.29 mmol)
are added and stirred at 100'C for 7 hours. The mixture is poured into water and extracted with
ethyl acetate two times. The organic layer is washed with water and then brine, dried over
magnesium sulfate, and evaporated in vacuo. The residue is purified with silica gel column
chromatography (n-hexane: ethyl acetate = 5:1) to afford the ^-methoxy-^methyl-S-nitro-
biphenyl as a yellow solid.
1H-NMR (5, ppm) : 2.62 (s, 3H), 3.86 (s, 3H), 7.02-6.98 (m, 2H), 7.37 (d, 1H), 7.54 (dd, 2H),
7.68 (dd, 1H), 8.18 (d, 1H). Rf (hexane: ethyl acetate = 3:1): 0.40.
A suspension of 4-methoxy-4-methyl-3-nitrobiphenyl (630 mg, 2.95 mmol) and 10% palladium
on charcoal (63 mg, 0.059 mmol) in methanol (6 mL) is stirred under hydrogen atmosphere for
12 hours. Palladium catalyst is removed by filtration and the resulting solution is evaporated in
vacuo to afford the title compound.
1H-NMR (6, ppm): 2.20 (s, 3H), 3.84 (s, 3H), 6.87 (d, 1H), 6.89 (dd, 1H), 6.95 (d, 2H). 7.09 (d,
1H), 7.48 (d, 2H). Rf (n-hexane: ethyl acetate = 1:1): 0.50.
Preparation of 4-f3-amino-4>methvlbenzovn-piPerazine-1-carboxvlic acid tert-buM ester

To a solution of 4-methyl-3-nitro-benzoic acid (300 mg, 2.76 mmoi), N-butoxycarbonyl-piperazine (340 mg, 1.83 mmoi) in DMF (3.0 mL), triethyiamine (300 n L, 3.59 mmoi), TBTU (800 mg, 2.49 mmoi) and HOAt (270.5 mg.1.99 mmoi) are added and stirred at room temperature for 24 hours. The mixture is poured into water and extracted twice with ethyl acetate. The organic layer is washed with water and then brine, dried over magnesium sulfate, and evaporated in vacuo. The residue is purified with silica gel column chromatography (n-hexane : ethyl acetate = 5:1) to afford 4-(4-methyl-3-nitrobenzoyi>-pipera2ine-1-carboxyIic acid tert-butyl ester as a colorless solid.
1H-NMR (5, ppm): 1.47 (s, 9H), 2.64 (s, 3H), 3.28-3.88 (m, 8H), 7.42 (d, 1H), 7.56 (dd, 1H), 8.03 (d, 1H). Rf (hexane: ethyl acetate = 10:1): 0.13.
The title compound is obtained by reduction with hydrogen over 10% palladium on charcoal in methanol solution.
Preparation of 4-(3-amino-4-methvlphenviy-morpholine
To a solution of 4-bromo-1-methyl-2-nitrobenzene (225 mg, 1.04 mmoi), morpholine (125 /z L,
1.25 mmoi), and cesium carbonate (474.4 mg, 1.46 mmoi) in toluene, palladium diacetate (31.2
mg, 0.139 mmoi) and 2-(dk-butylphosphino)biphenyl (125 mg, 0.403 mmoi) are added and
stirred at 100°C for 5 hours. After cooling, the mixture is filtered to remove insoluble material.
The filtrate is poured into water and extracted with ethyl acetate twice. The organic layer is
washed with water and then brine, dried over magnesium sulfate, and evaporated in vacuo. The
residue is purified with silica gel column chromatography (n-hexane : ethyl acetate = 5:1) to
afford 4-(4-methyl-3-nitrophenyl)-morpholine as a yellow solid.
'H-NMR (5, ppm): 2.50 (s, 3H), 3.17-3.19 (m, 4H), 3.86-3.88(m, 4H). 7.04 (dd, 1H), 7.21 (d,
1H), 7.47 (d, 1H). Rf (hexane : ethyl acetate = 5:1): 0.20.
The title compound is obtained by reduction with hydrogen over 10% palladium on charcoal in
methanol solution.
Example 37: Synthesis of substituted amines which are commercially not available:
37-1
Preparation of 1-(3-Methoxv-4-nitro-phenvlVpiperdin-4-ol

To a solution of 5-bromo-1-methoxy-2-nitrobenzene (300 mg, 1.29 mmol) in dioxane, 1-acetyl piperazine (400mg, 3.12 mmol), cesium carbonate (1.0g, 3.07 mmol), palladium diacetate (29.0 mg, 0.129 mmol) and 2-(di-t-butylphosphino)biphenyl (77 mg, 0.258 mmol) are added and stirred at 100°C for 8 hours. After cooling, the mixture is filtered to remove insoluble material. The filtrate is poured into water and extracted with ethyl acetate twice. The organic layer is washed with water and then brine, dried over magnesium sulfate, and evaporated in vacuo. The residue is purified by silica gel column chromatography (n-hexane : ethyl acetate gradient) to afford 1-[4-(4-Methoxy- 3-nitro-phenyl)-piperazin-1-yi]-ethanone (319mg, 44%) as yellow solids. ^-NMR (400MHz, CDCfe, 6, ppm): 2.14 (s, 3H), 3.63 (ddd, 4H), 3.63 (t, 2H), 3.78 (t, 2H), 3.92 (s, 3H), 7.03 (d, 1H), 7.12 (d, 1H)r 7.4.1 (d, 1H). Rf (ethyl acetate): 0.18

u
To a solution of 4-piperidone hydrochloride monohydrate (10.0 g, 0.065mol) in DMF (80 mL) are added 4-Ruoro-2-methoxy-1-nitro-benzene (10.0 g, 0.058 mol) and potassium carbonate

(20.2 g), and the mixture is stirred at 70°C for 20 h. After a filtration, the filtrate is poured into H2O (ca 300 mL), and the resulting precipitates are collected by a filtration followed by washing
with H2O for several times to give title compound (8.98 g) in 61% yield. Orange solid. 1H-NMR (400 MHz, CDCI3, 5): 2.65-2.62 (4H, m). 3.81-3.78 (4H, m)t 3.98 (3H, s), 6.34 (1H, d), 6.45 (1H, cfcf),8.05(1Hfd),

To a solution of 1-(3-Methoxy-4-nitro-phenyl)-piperidin-4-one (4.96g, 0.020mol) in dichloroethane (50 ml) is added N-methylpiperazine (2.7ml, 0.024 mol) at 0 °C and the mixture is stirred at room temperature. After 4 h, sodium triacetoxy-borohydride (5.04g, 0.024moi) is added and the mixture is further stirred at room temperature for 24 h. After addition of 1N sodium hydroxide at 0 °C, the mixture is poured into water and extracted three times with dichioromethane. The organic layer is combined and extracted three times with 1N hydrochloride. The water layer is basified with 2N sodium hydroxide and extracted three times with dichioromethane. The organic layer is washed with brine, dried over sodium sulfate, and evaporated in vacuo to give the title compound as yellow solids (6.04g) in 91% yield.
1H-NMR (400 MHz, CDCI3, 6): 1.70-1.57 (2H, m), 2.03-1.93 (2H, m), 2.29 (3H, s), 2.55-2.38
(5H, m), 2.70-2.56 (4H, rn), 2.97 (2H, ddd), 3.97-3.92 (2H, m), 3.95 (3H, s). 6.31 (1H, of,), 6.42
(1H,cfc/), 8.00(1 H, oT).
41
Preparation of 4'-Methoxv-4-methvl-3-nitro-biDhenvl


To a solution of 4-methoxyphenyl-boronlc acid (500 mg, 3.29 mmol) in toluene (5.2 mL) and ethanol (1.3 mL), potassium carbonate (910 mg, 6.58 mmol), tetrakis(triphenyiphosphine)-palladium (228.1 mg, 0.099 mmol) and 4-bromo-1 -methyl- 2-nitrobenzene (711 mg, 3.29 mmol) are added and stirred at 100"C for 7 hours. The mixture is poured into water and extracted with ethyl acetate two times. The organic layer is washed with water and then brine, dried over magnesium sulfate, and evaporated in vacuo. The residue is purified with silica gel column chromatography (n-he>cane : ethyl acetate = 5 : 1) to afford the 4'-methoxy-4-methyl-3-nitro-biphenyl (630mg( 79%) as a yellow solid.
1H-NMR (400MHz, CDCI3) 5, ppm) : 2.62 (s, 3H), 3.86 (s, 3H), 7.02-6.98 (m,2H), 7.37 (d, 1H), 7.54 (dd, 2H), 7.68 (dd, 1H), 8.18 (d, 1H). Rf (hexane: ethyl acetate = 3:1): 0.40.

To a solution of 1-(3-Methoxy-4-nltro-phenyl)-piperidin-4-ol (300mg, 1.2 mmol) in N,N-dimethylformamide (3.0 mL), sodium hydride (1.52g, 3.8 mmol) is added. After stirring, 2-bromoethyl methyl ether (150(il, 1.6 mmol) is added and the mixture is further stirred at 70°C for 15 hours. After addition of saturated aqueous ammonium chloride, the mixture is poured into water and extracted twice with ethyl acetate. The organic layer is washed with brine, dried over sodium sulfate, and evaporated in vacuo. The residue is purified by silica gel column chromatography (n-hexane - ethyl acetate gradient) to afford 4-(2-Methoxy-ethoxy)-1-(3-methoxy-4-nitro-phenyi)-piperidine (111 mg, 29%) as a yellow oil.
1H-NMR (400MHz, CDCI3> 5, ppm): 1.52(t, 3H), 1.95-2.00(m, 2H), 1.70-1.79(ml 2H), 3.23(ddd, 2H), 3.58-3.64(m, 2H), 3.65-3.68(m, 2H), 3.64-3.72(m, 2H)? 3.95(s, 3H), 6.31(d, 1H), 6.42(dd, 1H), 8.00(d, 1H). Rf 0.53 (n-hexane: AcOEt=1:1).

Rf = 0.22 (methanol: dichloromethane = 1:4). 1H-NMR (400 MHz, CDCI3, 5, ppm): 1.84-1.92(m, 2H), 2.0-2.1 (m, 2H). 2.3-2.4 (m, 2H), 2.33 (s, 3H), 2.65-2.75(01, 2H), 3.94(8, 3H), 4.39-4.46(m, 1H), 6.49 (dd, 1H), 6.99 (d, 1H), 6.54 (d, 1H), 7.99 (d, 1H).

To a solution of 3-Methoxy-4-nitro-phenol (1.69g, 10 mmol) in DMF (25 mL) , 4-(2-ChIoroethyI)morpholine hydrochloride(2.05g, 11 mmol), K2C03(1.52g, 11 mmol), Kl(332mg, 2mmol) are added at room temperature. The mixture is heated to gentle reflux for 4 hours. The reaction mixture is cooled to room temperature and quenched with water. The resulting mixture is extracted twice with ethyl acetate and then the organic layer is successively washed with water and brine, dried over sodium sulfate, filtered and evaporated in vacuo to afford the crude compound in 90% yield (2.55g).
Rf = 0.11 (AcOEt only). 1H-NMR (400 MHz, CDCI3), 6 (ppm): 2.56-2.61 (m, 4H), 2.83(t, The reaction mixture is cooled to room temperature and quenched slowly with 1NHC1 aq at 0°C> The resulting mixture is extracted twice with ethyl acetate and then the organic layer is successively washed with brine, dried over sodium sulfate, filtered and evaporated in vacuo to afford the crude compound in 94% yield(15.9g).
Rf = 0.22 (methanol: dichloromethane = 1:4). 1H-NMR (400 MHz, CDCI3), 5 (ppm): 3.95(s, 3H). 5.49(8,1H), 6.44 (dd, 1H, J=8.8, 2.52Hz), 6.54 (d, 1H, J=2.52Hz), 7.96 (d, 1H J=8.6Hz).

3.72-3.76(m, 4H), 3.94(s, 3H), 4.18(t, 2H), 6.51 (del, 1H, J=9.08, 2.52Hz), 6.56 (d, 1H,
J=2.48Hz), 8.00 (d, 1H J=9.08Hz).
2H),

To a solution of 4-MethoxyphenoI (12.4g, 100 mmol) in AcOH (50 mL), AC2O (50mL) is added at room temperature. The mixture is heated to gentle reflux for 1.5 hour. The reaction mixture is cooled to room temperature and c.HN03(d=1.38,10mL) is added slowly at 0 °C. The mixture is heated to 55°C for 1.5h. The reaction mixture is cooled to room temperature and quenched with water at OoC. The resulting solid is filtered on Buchner funnel to afford the crude compound in 76% yield (16.0g).
Rf = 0.59 (AcOEt: n-Hexane = 3:7). 1H-NMR (400 MHz, CDCi3). 5 (ppm): 2.31 (s, 3H), 3.96(s, 3H), 7.08 (d, 1H, J=9.04Hz), 7.31 (dd, 1H, J=9.04, 3.04Hz), 7.96 (d, 1H J=3.04 Hz).

To a solution of Acetic acid 4-methoxy-3-nitro-phenyl ester (1.06g, 5 mmo!) in EtOH (20 mL), 1N IslaOH aq (5.5mL) is added at 0°C. The mixture is stirred at room temperature for 2 hours. The reaction mixture is quenched with AcOH and extracted twice with ethyl acetate. The organic layer is successively washed with water and brine, dried over sodium sulfate, filtered and evaporated in vacuo to afford the crude compound in quantitative yield (840mg). Rf = 0.59 (AcOEt: n-Hexane = 3:7). 1H-NMR (400 MHz, CDCI3), 5 (ppm): 3.91 (s, 3H), 6.99 (d, 1H, J=9.04Hz), 7.17 (dd, 1H, J=9.04, 3.00Hz), 7.38 (d, 1H J=3.04 Hz). .„ :.


To a solution of 4-Methoxy-3-nitro-phenol (1.01g, 6 mmo!) in DMF (15 mL) , 4-(2-Chloroethyl)morpholine hydrochloride (1.34g, 7.2mmoI), K2C03 (2.49g, 18mmoI), Kl(2.99g, 18mmol) are added at room temperature. The mixture is heated to 80°C for 4 hours. The reaction mixture is cooled to room temperature and quenched with saturated NH4CI solution in water. The resulting mixture is extracted twice with ethyl acetate and then the organic layer is successively washed with water and brine, dried over sodium sulfate, filtered and evaporated in vacuo to afford the crude compound in quantitative yield (1.70g). Rf = 0.14 (AcOEt only). 1H-NMR (400MHz, DMSO, 5, ppm): 2.36-2.51 (m, 4H), 2.67 (t, J=5.5, 2H), 3.52-3.60 (m, 4H), 3.86 (s, 3H), 4.11 (t, J=6.0, 2H), 7.25-7.29 (m, 2H), 7.46-7.49 (m, 1H).

To a solution of 4-(3-Methoxy-4-nitro-phenoxy)-1-methyl-piperidine (3.0g, 11.3 mmo!) in ethanol (50 mL), 5% palladium on carbon(300mg) is added under a nitrogen atmosphere. The reaction vessel is fitted with a balloon adapter and charged with hydrogen and evacuated three times until the reaction is under a hydrogen atmosphere. The reaction is allowed to stir overnight The reaction mixture is filtered through a pad of Celite and washed with methanol. The filtrate is concentrated in vacuo to afford 2-Methoxy-4-(1-methyl-piperidin-4-yloxy)-phenylamine in quantitative yield (2.7g).
Rf = Q.41 (methanol : dichloromethane = 1:1). 1H-NMR (400 MHz, CDCI3), 5 (ppm): 1.75-1.86(m, 2H), 1.92-2.05(m, 2H), 2.2-2.32 (m, 2H), 2.30 (s, 3H)f 3.4-3.7(brs, 2H), 3.82(s, 3H), 4.1-4.2(m, 1H), 6.37(dd, 1H), 6.46 (d, 1H), 6.61 (d, 1H).

To a solution of 4-methyl-3-nitro-benzoic acid (300 nig, 2.76 mmol), N-butoxycarbonyl-piperazine (340 mg, 1.83 mmol) in DMF (3.0 mL), triethylamine (300 vL, 3.59 mmol), TBTU
(800 mg, 2.49 mmol) and HOAt (270.5 mg,1.99 mmol) are added and stirred at room
temperature for 24 hours. The mixture is poured into water and extracted twice with ethyl
acetate. The organic layer is washed with water and then brine, dried over magnesium sulfate,
and evaporated in vacuo. The residue is purified with silica gel column chromatography (n-
hexane : ethyl acetate = 5 :1) to afford 4-(4-methyl-3- nitrobenzoyl)-piperazine-1-carboxylic add
tert-butyl ester as a colorless solid.
1H-NMR (5, ppm): 1.47 (s,9H), 2.64 (s, 3H), 3.88-3.28 (m, 8H), 7.42 (d, 1H), 7.56 (dd, 1H), 8.03
(d, 1H). Rf (hexane: ethyl acetate = 10:1): 0.13.
The title compound is obtained by reduction with hydrogen over 10% palladium on charcoal in
methanol solution.

To a suspension of 4-bromo-1-methyl-2-nitrobenzene (225 mg, 1.04 mmol), morphoiine (125 n
L, 1.25 mmol), and cesium carbonate (474.4 mg, 1.46 mmol) in toluene, palladium diacetate (31.2 mg, 0.139 mmol) and 2-(di-t-butylphosphino)biphenyl (125 mg, 0.403 mmol) are added and stirred at 100°C for 5 hours. After cooling, the mixture is filtered to remove insoluble material. The filtrate is poured into water and extracted with ethyl acetate twice. The organic layer is washed with water and then brine, dried over magnesium sulfate, and evaporated in

vacuo. The residue is purified with silica gel column chromatography (n-hexane : ethyl acetate =
5:1) to afford 4-(4-methyl-3-nitrophenyl}-morpholine as a yellow solid.
1H-NMR (5, ppm): 2.50 (s, 3H), 3,19-3.17 (m. 4H), 3.88-3.86 (m, 4H), 7.04 (dd, 1H), 7.21 (d,
1H), 7.47 (d, 1H). Rf (hexane: ethyl acetate = 5:1): 0.20.
The title compound is obtained by reduction with hydrogen over 10% palladium on charcoal in
methanol solution.

To a solution of 1.0 g (3.37 mmol) of 2-(2,5-dichloro-pyrimidin-4-ylamino)-/V-meth^-ben2amide in 15 mL of acetic acid are added 2-methoxy-4-morpholinoaniline dihydrochloride (1.9 gt 6.73 mmol) and 6.0 mL of 1N ethanoiic solution of hydrogen chloride (6.0 mmol). After the reaction mixture is stirred at 120°C for 16 hours and cooled to room temperature, aqueous NaHC03 solution is added to adjust the acidity between pH 5 and pH 6. The resulting precipitate is collected by a filtration and dried under reduced pressure to give 2-[5-chioro-2-(2-methoxy-4-morpholin-4-yl-phenyl-amino)-pyrimidin-4-ylamino]-benzoicacid (970 mg, 2.12 mmol, 63%) as ivory solid.
NMR (400MHz, DMSO-d6, 8): 3.10-3.20 (m, 4H), 3.78 (s, 3H), 3.70-3.80 (m, 4H), 6.52 (dd, 1H, J = 8.56, 2.52 Hz), 6.67 (d, 1H, J = 2.52 Hz), 7.08 (dd, 1H, J = 8.04, 8.04 Hz), 7.39 (d, 1H, J = 8.56 Hz), 7.35-7.45 (m, 1H), 7.99 (dd, 1H, J = 8.04,1.52Hz), 8.14 (s, 1H), 8.28 (s, 1H) 8.70-8.80 (m,1H).
Example 50: Sulfonamide moieties are prepared as follows:

Preparation of 2-amino-4-chloro-5-methvl-benzenesulfonvl chloride
To a solution of 2-amino-5-chioro-4-methyl-benzenesulfonic acid (3.0 g, 1.35 mmol) in
dichloroethane (10 mL) is added suifuryl chloride (4.4 mL, 3.83 mmol) and stirred at 60°C. After
one hour, thionyi chloride (1.3 mL) is added and the mixture is further stirred at 1O0°C for 7.0
hours. The mixture is poured into iced water and extracted with ether three times. The organic
layer is washed with water and then brine, dried over sodium sulfate, and evaporated in vacuo.
1H-NMR (8, ppm): 2.35 (s, 3H), 6.68 (s, 1H), 7.75 (s, 1H).
This substituted sulfonyl chloride is reacted with a suitable amine. On reaction e.g. with
methylamine, 2»amino-5-chloro-4,N-dimethylbenzenesulfonamide is formed.
Example 51
Preparation of 2-r5-bromO"2-f2-methoxv-4-morDholin-4-vi-DhenvlaminoVDvrimidin-4-vlamino1-
N. N-dimethvlbenznensulfonamide

To a solution of 2^5-Bromo-2-(2-metho;cy-4-morpholin-4-yl-phenylamino)-pyrimidin-4-ylamino]-N-methyl-benzenesulfonamide (Ex3-19) (1.0g, 1.82mmoI) in DMF (10mL), potassium carbonate (300mg, 2.17mmol) and iodomethane (116jii, 1.86mmoI) are added. The resulting suspension is stirred at 50°C for 1h. To the reaction mixture, water is added and extracted with ethyl acetate three times. The organic layer is washed with water, dried over sodium sulfate, and concentrated in vacuo. The residue is purified by aluminum oxide column chromatography (AcOEt) to afford the title compound (728mg, 71% yield).
NMR (400MHz, CDCI3, 8): 2.74 ((s, 6H), 3.05-3.18 (m, 4H), 3.84-3.93 (m, 4H), 3.88 (s, 3H), 6.43 (dd, 1H), 6.53 (d, 1H)t 7.24 (m, 1H), 7.31 (s, 1H), 7.56 (m, 1H), 7.87 (dd, 1H), 8.05 (d, 1H), 8.21 (s, 1H), 8.49 (d, 1H), 8.49 (d, 1H), 9.27 (s, 1H). Rf: 0.23 (AcOEt:Hexane=1:1).
Example 52
Preparation of 245-Bromo-2-f2H7iethoxv-4-morpholin^N4-phenvlaminoVpvrimidin-4-vlaminoV5-
fluoro-N-methvl-benzenesulfonamide


Preparation of 7-Fluoro-L1-dioxo-1,4-dihvdro-2H-1 X 6-benzoH .2.41thiadiazin-3-one
To a solution of chlorosutfonylisocyanate (1.2ml, 13.5mmol) in nitroethane (10mL), 4-
fluoroaniline (1.0g, 8.97mmoI) is added dropwise at 0°C and the reaction mixture is stirred for
30min. To the solution, aluminum chloride (1.3g, 9.87mmol) is added at 0°C and the mixtures
stirred at 100CC for 1 hour. After cooling to room temperature, water is added and the mixture is
extracted with ethyl acetate twice. The organic layer is washed with brine, dried over sodium
sulfate, and concentrated under reduced pressure. The resulting solids are collected by a
filtration and wahed with ether to give slightly gray solids (803.9mg, 41%).
NMR (400MHz, DMSO-d6, 5): 7.22-7.28 (m, 1H),~Z45-7.574m, 1H), 7.60 (m, 1H), 11.15-11.30
(m, 1H). Rf: 0.43 (MeOH:AcOEt=1:5).
Preoaration of 7-Fluoro-2-methvM. 1 -dioxo-1.4^dihvdro-2H-116~benzon .2,41thiadiazin-3-one
To a solution of 7-Fluoro-1,1-dioxo-1,4-dihydro-2H-1-^6-benzo[1,2,43thiadia2in-3-one (5.19g, 24.0mmol) in DMF (5QrnL), sodium hydride (1.04g( 26.0mnnol) and iodomethane (I.SmL, 24.0mmol) are added successively and the mixture is stirred for 1 hour at 70°C. After cooling to room temperature, the mixture is poured into water and the precipitate is collected by a filtration and washed with water and hexane, successively, to give slightly gray solids (5.38g, 94%). NMR (400MHz, DMSO-d6,5): 3.32 (s, 3H), 7.44 (dd, 1H), 7.75 (ddd, 1H), 7.94 (dd, 1H). Rf (MeOH:AcOEt = 1:5): 0.21. Rf: 0.39 (Hexane:AcOEt=1:1). Preparation of 2-Amino-5-fluoro-N-methvl-benzenesulfonamide 6.79g of 7-Huoro-2-methyi-1,1 -dioxo-1,4-dihydro-2H-1 X 6-benzo[1,2,4]thiadiazin-3-one
(29.5mmol) is dissolved in 20% aq. sodium hydroxide and the resulting solution is stirred at
100°C for 13.5 hours. The mixture is cooled to room temperature and poured into water. 78mL
of 5M HCI aq. is added and the precipitate is collected by a filtration and washed with water to
afford slightly purple solids (3.96g, 65%).
NMR (400MHz, CDCI3, 6): 2.60 (d, 3H)f 4.55-4.82 (m, 3H)f 6.74 (dd, 1H), 7.05-7.12 (m, 1H),
7.45 (dd, 1H). Rf: 0.41 (Hexane:AcOEt=1:1).
2-(5-Bromo-2-chloro-pvrimidin^-\4aminoV5-fluon>N-methvl-benzenesulfonarnide

The reaction of pyrimidine with 2-Amino-5-fluoro-N-methyl-benzenesulfonamide is performed in the same manner described in example B.
NMR (400MHz, CDC!3) 5): 2.67 (d, 3H), 4.56 (m. 1H), 7.36-7.45 (m, 1H)f 7.68 (dd, 1H), 8.39 (s, 1H), 8,42 (dd, 1H), 9.26 (s, 1H). Rf 0.59 (Hexane;AcOEt= 1:1).
2-r5-Bromo-2-(2-methoxv-4HTioroholin^^
methvl-benzenesutfonamide
The introduction of substituted aniline is performed according to the manner described in
Example A,
NMR (400MHz, CDCI3, 6): 2.65 (d, 3H), 3.09-3.16 (m, 4H), 3.87 (s, 3H), 4.50 (q, 1H), 6.41 (dd,
1H), 6.52 (d, 1H)f 7.25-7.33 (m, 2H), 7.69 (dd, 1H)f 7.95 (d, 1H), 8.20 (s, 1H), 8.37 (dd, 1H),
8.70 (s, 1H). Rf 0.30 (Hexane:AcOEt» 1:1)
Example 53: FAK Assay
All steps are performed in a 96-well black microtiter plate. Purified recombinant hexahistidine-tagged human FAK kinase domain is diluted with dilution buffer (50 mM HEPES, pH 7.5,0.01% BSA, 0.05% Tween-20 in water) to a concentration of 94 ng/mL (2.5 nM). The reaction mixture is prepared by mixing 10 pL 5x kinase buffer (250 mM HEPES, pH 7.5, 50 pM Na3V04l 5 mM DTT, 10 mM MgCI2, 50 mM MnCI2,0.05% BSA, 0.25% Tween-20 in water), 20 pL water, 5 pL of 4 pM biotinylated peptide substrate (Biot-Y397) in aqueous solution, 5 pL of test compound in DMSO, and 5 pL of recombinant enzyme solution and incubated for 30 min at room temperature. The enzyme reaction is started by addition of 5 pL of 5 pM ATP in water and the mixture is incubated for 3 hours at 37°C. The reaction is terminated by addition of 200 pL of detection mixture (1 nM Eu-PT66, 2.5 pg/mL SA-(SL)APC, 6.25 mM EDTA in dilution buffer), and the FRET signal from europium to allophycocyanin is measured by ARVOsx+L (Perkin Elmer) after 30 min of incubation at room temperature. The ratio of fluorescence intensity of 665 nm to 615 nm is used as a FRET signal for data analysis in order to cancel the colour quenching effect by a test compound. The results are shown as percent inhibition of enzyme activity. DMSO and 0.5 M EDTA are used as a control of 0% and 100% inhibition, respectively. IC50 values are determined by non-linear curve fit analysis using the OrlginPro 6.1 program (OriginLab).

The Biot-Y397 peptide (Btofin-SETDDYAEIID ammonium salt) is designed to have the same amino acid sequence as the region from S392 to D402 of human (GenBank Accession Number L13616) and is prepared by standard methods.
Purified recombinant hexahistidine-tagged human FAK kinase domain is obtained in the following way: FulHength human FAK cDNA is isolated by PCR amplification from human placenta Marathon-Ready™ cDNA (Clontech, No. 7411-1) with the 5' PCR primer (ATGGCAGCTGCTTACCTTGAC) and the 3' PCR primer (TCAGTGTGGTCTCGTCTGCCC) and subcloned into a pGEM-T vector (Promega, No. A3600). After digestion with Acclll, the purified DNA fragment is treated with Klenow fragment The cDNA fragment is digested with BamHi and cloned into pFastBacHTb plasmid (Invitrogen Japan K.K., Tokyo) previously cut with BamHI and Stu I. The resultant plasmid, hFAK KD (M384-G706)/pFastBacHTb, is sequenced to confirm its structure. The resulting DNA encodes a 364 amino acid protein containing a hexahistidine tag, a spacer region and a rTEV protease cleavage site at the N-terminal and the kinase domain of FAK (Met384-6ly706) from position 29 to 351. ~:
Donor plasmid is transposed into the bacuiovirus genome, using MaxEfficacy DHIOBac Ecoli cells. Bacmid DNA is prepared by a simple alkaline lysis protocol described in the Bac-to-Bac® Bacuiovirus Expression system (Invitrogen). Sf9 insect cells are transfected based on the protocol provided by the vendor (CellFECTIN®, invitrogen). The expression of FAK in each lysate is analysed by SDS-PAGE and Western blotting with anti-human FAK monoclonal antibody (clone #77 from Transduction Laboratories).
The virus clone that shows the highest expression is further amplified by infection to Sf9 cells. Expression in ExpresSF+® cells (Protein Sciences Corp., Meriden, Connecticut, USA) gives high level of protein with little degradation. Cell iysates are loaded onto a column of HiTrap™ Chelating Sepharose HP (Amersham Biosciences) charged with nickel sulfate and equilibrated with 50 mM HEPES pH 7.5, 0.5 M NaCI and 10 mM imidazole. Captured protein is eluted with increasing amounts of imidazole in HEPES buffer / NaCI, and further purified by dialysis in 50 mM HEPES pH 7.5,10% glycerol and 1 mM DTT.
Example 54: Cell-free ZAP-70 Kinase assay
The ZAP-70 kinase assay is based on time-resolved fluorescence resonance energy transfer
(FRET). 80 nM ZAP-70 are incubated with 80 nM Lck (lymphoid T-ceil protein tyrosine kinase)

and 4 }M ATP in ZAP-70 kinase buffer (20 mM Tris, pH 7.5,10 |oM NasVO* 1 mM DTT, 1 mM MnCb, 0.01 % BSA, 0.05 % Tween-20) for 1 hour at room temperature in a siliconized polypropylene tube. Then, the selective Lck inhibitor PP2 (1-tert-butyl-3-(4-diloro-phenyI)-1H-pyrazolo[3,4-d]pyrimidin-4-ylamine; Alexis Biochemicals) is added (final concentration 1.2 pM) and incubated for further 10 min. 10 JJL of this solution is mixed with the 10 pL biotinylated peptide LAT-11 (1 JIM) as substrate and 20 jxL of serial dilutions of inhibitors and incubated for 4 hours at room temperature. The kinase reaction is terminated with 10 yL of a 10 rnM EDTA solution in detection buffer (20 mM Tris, pH 7.5, 0.01 % BSA, 0.05 % Tween-20). 50 jiL europiurn-labelled anti-phosphotyrosine antibody (Eu-PT66; final concentration 0.125 nM); and 50 pL streptavidin-allophycocyanine (SA-APC; final concentration 40 nM) in detection buffer are added. After 1 hour incubation at room temperature fluorescence is measured on the Victor2 Multilabel Counter (Waliac) at 665 nm. Background values (low control) are obtained in the absence of test samples and ATP and are subtracted from all values. Signals obtained in the absence of test samples are taken as 100% (high control). The inhibition obtained in the presence of test compounds is calculated as percent inhibition of the high control. The concentration of test compounds resulting in 50% inhibition (IC50) is determined from the dose-response curves. In this assay, the agents of the invention have IC50 values in the range of 10 nM to 2 pM, preferably from 10 nM to 100 nM.
Recombinant ZAP-70 kinase is obtained as follows: A nucleic acid encoding full-length human -ZAP-70 (GenBank #L05148) is amplified from a Jurkat cDNA library by RT-PCR and cloned into the pBluescript KS vector (Stratagene, California, USA). The authenticity of the ZAP-70 cDNA insert is validated by complete sequence analysis. This donor plasmid is then used to construct a recombinant baculovirus transfer vector based on the plasmid pVL1392 (Pharmingen, California, USA) featuring in addition an N-terminal hexahistidine tag. Following co-transfection with AcNPV viral DNA, 10 independent viral isolates are derived via plaque-purification, amplified on small scale and subsequently analyzed for recombinant ZAP-70 expression by Western Blot using a commercially available anti-ZAP-70 antibody (Clone 2F3.1, Upstate Biotechnology, Lake Placid, NY, USA). Upon further amplification of one positive recombinant plaque, titrated virus stocks are prepared and used for infection of Sf9 cells grown in serum-free SF900 II medium (Life Technologies, Basel, Switzerland) under defined, optimized conditions. ZAP-70 protein is isolated from the iysate of infected Sf9 cells by affinity chromatography on a Ni-NTAcolumn (Qiagen, Basel, Switzerland).

Recombinant His-tagged ZAP-70 is also available from PanVera LLC, Madison, Wisconsin, USA.
LAT-11 (linker for activation of T cell): The biotinylated peptide LAT-11 (Biotrrv-EEGAPDYEIMLQELN) used as a substrate in the ZAP-70 kinase assay is prepared in analogy to known methods of peptide synthesis. The N-a Fmoc group of Fmoc-Asn(Trt)-oxymethyl-4-phenoxymethyl-co(polystyrene-1%-divinyl-benzene)) content of Asn approx. 0,5 mmol/g, is cleaved using piperidine, 20% in DMF. Four equivalents per amino-group of Fmoc-amino acid protected in their side chains [Asp(OtBu), Giu(OtBu), Asn(Trt), GlnfTrt) and Tyr(tBu)] are coupled using DIPCDI and HOBt in DMF. After complete assembly of the peptide chain the terminal Fmoc-protecting group is removed with piperidine in DMF as before. L(+)-biotinyl-aminohexanoic acid is then coupled to the terminal amino group using DIPCDI and HOBt in DMF using four equivalents of the reagents for four days at RT. The peptide is cleaved from the" resin support and all side-chain protecting groups are simultaneously removed by using a reagent consisting of 5% dodecylmethyisulfide and 5% water in TFA for two hours at RT. Resin particles are filtered off, washed with TFA and the product is precipitated from the combined filtrates by the addition of 10 to 20 volumes of diethyl ether, washed with ether and dried. The product is purified by chromatography on a C-18 wide-pore silica column using a gradient of acetonitrile in 2% aqueous phosphoric acid. Fractions containing the pure compound are collected, filtered through an anron-exchange resin (Biorad, AG4-X4 acetate form) and" lyophilized to give the title compound. MS: 1958.0 (M-H)"1
Example 55: Phosphorylation levels of FAK
Phosphorylation levels of FAK at Tyr397 is quantified by the sandwich ELISA. Mouse mammary carcinoma 4T1 cells (1 x 105) are plated in wells of 96-well culture plates and incubated with or without various concentrations of inhibitors for 1 h in Duibecco's modified eagle medium containing 0.5% BSA. The medium is removed and cells are lysed in 200 pL 50 mM Tris-HCI, pH 7.4, containing 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCI, 1 mM EDTA, 1 mM PMSF, 1 mM Na3V04,1 mM NaF, 1 fig/mL aprotinin, 1 yg/mL leupeptin and 1 ng/mL pepstatin. After centrifLigation, the supernatants are subjected to a sandwich ELISA to quantify the phosphorylated FAK and total FAK. CeD lysates are applied to 96-well fiat-bottom ELISA plates which have been pre-coated with 100 |iL/welI of 4 jog/mL mouse monoclonal anti-FAK antibody (clone 77, Becton Dickinson Transduction Laboratories) in 50 mM Tris-HCI, pH 9.5, containing 150 mM NaCI for 18 h at 4DC and blocked with 300 \L of BIockAce (Dainippon Pharmaceuticals

Co.) diluted at 1:4 with H20 at room temperature for 2 h. After washing with TBSN (20 mM Tris-HCI, pH 8.3, containing 300 mM Nad 0,1% SDS and 0,05% NP-40), total FAK is detected with 100 yL of 1 jxg/ml anti-FAK polyclonal antibody (#65-6140, Upstate Biology Inc.), and phosphorylated FAK is detected with 100 jxL of 0.25 fig/fiL anti-phosphorylated FAK (Y397) antibody (Affinity BioReagents, #OPA1-03071) in BiockAce diluted at 1:10 with H20. After 1 h incubation at room temperature, plates are washed with TBSN and 100 ^L of biotinylated anti-rabbit IgG (#65-6140, Zymed Laboratoiies inc.) diluted at 1:2000 with BiockAce diluted at 1:10 with H20 is incubated at room temperature for 1 h. After washing with TBSN, ABTS solution substrate kit (#00-2011, Zymed Lobolatories Inc.) is used for color development Absorbance at 405 nm is measured after 20 min incubation at room temparature. The concentration of compound causing 50% reduction of phosphorylation level of FAK is determined.
Example 56: Anchoraae-lndeoendent tumor cell growth assay
Mouse mammary carcinoma 4T1 cells (5 x 103) are plated in 96-weli Ultra low Attachment
plates (#3474, Corning Inc.) in 100 jxL of Dulbecco's modified eagle medium containing 10%
FBS. Cells are cultured for 2 h and inhibitors are added at various concentrations in a final _
concentration of 0.1% DMSO. After 48 h, cell growth is assayed with the cell counting kit-8 (Wako Pure Chemical), which uses a water soluble tetrazoiium salt WST8, Twenty pL of the reagent is added into each well and cells are further cultured for 2 h. The optical density is measured at 450 nm. The concentration of compound causing 50 % inhibition of growth is determined.
Example 57: In vitro T cell migration assav:
Inhibitory activities of FAK inhibitors on tine mobility of immune cells are secured by the following in vitro study. That is, Jurkat T human leukemic cell line are placed at 1 x 105 cells in the upper chamber of Fluoroblok with 8 pm pores (Beckton Dickinson, UK), and are allowed to migrate by four hours cultivation at 37^}, in 95% air-5% CO2 depending on a concentration gradient of fetal bovine serum (10% FBS). Cell mobility is appraised through the number of cells migrated into lower chamber by labeling with calcein-AM (Molecular Probes, Netherlands) at 8 pg/ml in HBSS for 1 h. For evaluation of FAK inhibitors, both the upper and lower chambers are added with various concentrations of FAK inhibitors (0.03 -1 pM). IC50 values are calculated by the decrement of those fluorescent intensity compared to that in vehicle-treated group measured with Ascent (Ex: 485 nm, Em: 538 nm).

Example 58: Test for activity against IGF-I induced 1GF-IR autophosphorylation using the cellular "Capture ELISA" test The assay is conducted as follows:
For the assay NIH-3T3 mouse fibroblasts transfected with human IGF-IR cDNA (complete human IGF-IR cDNA: GenBank Ace. No. NM_000875), prepared as described in Kato et at, J. Biol. Chem. 268.2655-61,1993, are used. The cells which overexpress human IGF-IR are cultured in Dulbecco's minimal essential (DMEM) medium, containing 10 % Fetal Calf Serum (FCS). For the assay 5,000 cells/well are plated on day 1 on 96-well plates (Costar #3595) in normal growth medium and incubated for 2 days at 37°C in a standard C02 cell incubator. The density of the cells does not exceed 70-80 % at day 3. On day 3 the medium is discarded and the cells are incubated for 24 h in minimal medium (DMEM, containing 0.5 % FCS). Compounds of formula I [starting from 10 mM dimethyl sulfoxide (DMSO) stock solutions] are added to produce final concentrations of 0.01, 0.03, 0.19 0.3,1, 3 and 10 fiM to determine the IC50 value. The cells are incubated for 90 min in the presence of a compound of formula I. Thereafter the cells are stimulated with 50 pi IGF-I (final concentration of IGF-I in the well = 10 ng/ml; IGF-I is
i
obtained from Sigma; Product Code: I 3769) and jncubated for 10 min at 37°C.
-. .. 1
The medium is discarded and the cells are washed twice with PBS/O (=Phosphate-Buffered Saline without CaCI2) and lysed for 15 min on ice with 50 pl/well RIPA-buffer [50 mM Tris»HCI, pH=7.2,120 mM NaCI, 1 mM EDTA, 6 mM EGTA, 1% NP-40,20 mM NaF, 1 mM benzamidine, 15 mM sodium pyrophosphate, 1 mM Phenyl methyl sulphonyl fluoride (PMSF) and 0.5 mM Na3V04] and shaken for 10 min using a 96-welt plate shaker (=cellular extracts).
i 1 1
Packard HTRF-96 black plates are coated with 50 jol IGF-IR monoclonal Antibody (mAB) (Santa Cruz; Cat No.: SC-462) in a concentration of 5 pg/ml at 4°C overnight The plates are washed twice with 0.05% (v/v) Tween-20 in Phosphate-Buffered Saline (PBS) and once with nanopure H20. Blocking is done for 2 h at room temperature (RT) with 3% Bovine Serum Albumin (BSA) in TBS-T buffer (20 mM Tris^HCl, pH=7.6.137 mM NaCI, 0.05 % Tween-20). After blocking, the plates are washed once with nanopure H20.
Cellular extracts (40 pJ/well) are pipetted onto the precoated Packard plates, together with 40 jol of the anti-phosphotyrosine mouse mAB PY-20 conjugated with Alkaline Phosphatase (AP) (1:1000 diluted in RIPA buffer; the antibody is obtained from Transduction Labs; Cat No.: P11120).

After incubating the extracts and tine secondary antibody for 2 h at 4 °C, the extracts are discarded, the plates are washed twice with 0.05% (v/v) Tween-20 in PBS and once with nanopure water.
90 pj/well AP substrate (CDP-Star; obtained from Tropbq Cat. No.: MS100RY) are then added and the plates are incubated for 45 min at RT in the da*, followed by measuring AP activity in a Packard Top Count Microplate Scintillation Counter. The IC50 values for the compounds of formula I are calculated via linear regression analysis using the GraphPad Instat program (GraphPad Software, USA). IC50 values in the range of 5 nM to 1 jiM, especially in the range of 5 nM to 300 nM are found.
Example 59 In vivo activity in the nude mouse xenograft model: female or male BALB/c nude mice (5-8 weeks old, Charles River Japan, Inc., Yokohama, Japan) are kept under sterile conditions with water and feed ad libitum. Tumours are induced by subcutaneous injection of tumour cells (human epithelial cell line MIA PaCa-2; European Collection of Cell Cultures (ECACC), Salisbury, Wiltshire, UK, Catalogue Number 85062806; cell line from a 65 year old Caucasian male; undifferentiated human pancreatic carcinoma cell line) into left or right flank of mice under Forene* anaesthesia (Abbott Japan Co., Ltd., Tokyo, Japan). Treatment with the test compound is started when the mean tumor volumes reached approximately 100 mm3. Tumour growth is measured two times per week and 1 day after the last treatment by determining the length of two perpendicular axis. The tumour volumes are calculated in accordance with published methods (see Evans et a!., Brit. J. Cancer 45, 466-8, 1982). The anti-tumour efficacy is determined as the mean increase in tumour volume of the treated animals divided by the mean increase in tumour volume of the untreated animals (controls) and, after multiplication by 100, is expressed as delta T/C [%]. Tumour regression is reported as the mean changes of tumor volume of the treated animals divided by the mean tumor volume at start of treatment and, after multiplication by 100, is expressed as regression [%]. The test compound is orally administered daily with or without drug holidays.
As an alternative to ceil line MIA PaCa-2, another cell line may also be used in the same manner, for example:
- the 4T1 breast carcinoma cell line (ATCC Number CRL-2539; see also Cancer. 88(12 Supple), 2979-2988, 2000) with female BALB/c mice (injection into mammary fat pad).

On the basis of these studies, a compound of formula I according to the invention shows therapeutic efficacy especially against proliferative diseases responsive to an inhibition of a tyrosine kinase.
Example 60: Tablets
Tablets comprising 50 mg of active ingredient, for example one of the compounds of formula I described in Examples 1 to 131, and having the following composition are prepared in customary manner
Composition: -
active ingredient 50 mg
wheat starch 150 mg
lactose 125 mg
colloidal silicic jacid --==^ - 12.5 mg .
talc „™.,v. ■- 5r:rr,7. ■■:- _22.5rng: ----.-...-
magnesium stearate 2.5 mg
Total: 362.5 mg
Preparation: The active ingredient is mixed with a portion of the wheat starch, with the lactose and the colloidal silicic acid and the mixture is forced through a sieve. A further portion of the wheat starch is made into a paste, on a water bath, with five times the amount of water and the powder mixture is kneaded with the paste until a slightly plastic mass is obtained.
The plastic mass is pressed through a sieve of about 3 mm mesh size and dried, and the resulting dry granules are again forced through a sieve. Then the remainder of the wheat starch, the talc and the magnesium stearate are mixed in and the mixture is compressed to form tablets weighing 145 mg and having a breaking notch.
Example 61: Soft Capsules
5000 soft gelatin capsules comprising each 50 mg of active ingredient, for example one of the
compounds of formula I described in Examples 1 to 131, are prepared in customary manner
Composition:

active ingredient 250 g
Lauroglykol 2 litres
Preparation: The pulverized active ingredient is suspended in Lauroglykol® (propylene glycol laurate, Gattefoss6 SA, Saint Priest, France) and ground in a wet pulverizer to a particle size of approx. 1 to 3 nm. 0.419 g portions of the mixture are then dispensed into soft gelatin capsules using a capsule-filling machine.

wherein
each of Ro, R1, F2.ancl R3 independently is hydrogen, C1-C8alkyl, C1-C8alkenyl, C1-C8alkinyl, C3-C8cycloalkyl, C3
-CscycloalkylC3C8alkyl, C5-C10oarylC1-C8alkyI, hydroxyC2-Cealkyl, C1-C8alkoxyC1-C8a(kyl, aminoC1-C8alkyl, haloCrCea(kyl, unsubstituted or substituted C5-C10aryl, unsubstituted or substituted 5 or 6 membered heterocyclyi comprising 1, 2 or 3 hetero atoms selected from N, 0 and S, hydroxy, C1-C8alkoxy, hydroxyC1-C8aJkoxy, Cr C8alkoxyC1-C8salkoxy, haLoC1-C8alkoxy, unsubstituted or substituted C1-C8aryC1-C8alkoxy, unsubstituted or substituted heterocydyloxy, or unsubstituted or substituted heterocyciylCr Cealkoxy, unsubstitued or substituted amino, C1-C8alkyLthio, C1-C8aikylsulfinyl, d-C8alkylsuffonyI, C5-C10oarylsulfonyl, halogen, carboxy, C1-C8alkoxycarbonyl, unsubstitued or substituted carbamoyl, unsubstitued or substituted sulfamoyl, cyano or nitro; or
R° and R1, R1 and R2, and/or R2 and R3 form, together with the carbon atoms to which they are attached, a 5 or 6 membered carbocyclic or heterocyclic ring comprising 0,1, 2 or 3 heteroatoms selected from N, 0 and S;
R4 is hydrogen or C1-C8aIkyt;
each of R5 and R6independently is hydrogen, CrCsalkyl, C1-C8aIkoxyC1-C8aIkyl, haloCrCealkl, C1-C8alkoxy, halogen, carboxy, C1-C8aIkoxycarbonyl, unsubstitued or substituted carbamoyl, cyano, or nitro; and
each of R7, R8, R9, and R10 independently is C1-C8aLkyl, CrCBalkenyl, C2-C8alkinyl, C3-C8cycloaIkyl, C3-C8cycloalkylCrCsalkyl, C5-C10oarylC1-CealkyI, hydroxyCrC8aIkyl, C1-C8alkoxyC1-C8aIkylt aminoC1-C8aIkyI, haIoCrC8alkyIt unsubstituted or substituted C5-C10aryl, unsubstituted or substituted 5 or 6 membered heterocyclyi comprising 1, 2 or 3 hetero atoms selected from N, 0 and S, hydroxy, C1-C8alkoxy, hydroxyCrCealkoxy, d-C8aalkoxyC1-C8alkoxy, haloC1-C8alkoxy, unsubstituted or substituted C5-C10oarylCrCealkoxy, unsubstituted or substituted heterocydyloxy, or unsubstituted or substituted heterocyciylCr

C8alkoxy, unsubstttued or substituted amino, C1--C8alkylthio, C1--C8alkyIsulfinyl, C1-C8alkylsulfonyl, C5-C10arylsulfonyi, halogen, carboxy, C1-C10alkoxycarbonyl, unsubstitued or substituted carbamoyl, unsubstttued or substituted sulfamoyl, cyano or nitro; wherein R7, R8 and R9 independently of each other can also be hydrogen;
or R7 and R8, RB and R9, and/or Re and R10 fom together with the carbon atoms to which they are attached, a 5 or 6 membered carbocyclic or heterocyclic ring comprising 0, 1, 2 or 3 heteroatoms selected from N, 0 and S;
A is C or N;
and salts thereof.
2. A compound of formula I according to claim 1, wherein
each of R°or R2 independently is hydrogen, d-daikyl, hydroxyd-dalkyl, halod-dalkyl,
unsubstituted or substituted C5-C10aryl, unsubstituted or substituted 5 or 6 membered
heterocyclyl comprising 1 or 2 hetero atoms sejected from N, O and S, C1--C8alkbxy,
haloC1-C8alkoxy, C5--C10aryloxy, unsubstituted or substituted heterocyclyioxy, unsubstituted —
or substituted heterocyclylC1-C8alkoxy, unsubstituted or substituted amino, d-
C8alkylsulfonyl, halogen, unsubstituted or substituted carbamoyl, unsubstituted or ~
substituted sulfamoyl;
R1 is hydrogen, C1-C8alkyI, hydroxyd-dalkyl, halod-dalkyl, unsubstituted or substituted d-C10aryl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, O and S, C1-C8lkoxy, halod-dalkoxy, d-doaryloxy, unsubstituted or substituted heterocyclyioxy, unsubstituted or substituted heterocyclyld-dalkoxy, unsubstituted or substituted amino, C1-C8alkylsulfonyl, halogen, unsubstituted or substituted carbamoyl, unsubstituted or substituted sulfamoyl;
R3 is hydrogen, C1--C8alkyl, hydroxyC1-C8alkyl, halod-dalkyl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 heteroatoms selected from N, O and S, d-C8alkoxy, substituted amino,C1-C8alkylsulfonyl, C5-C10arylsuifonyl, halogen, carboxy, substituted or unsubstituted carbamoyl, unsubstituted or substituted sulfamoyl; or
each pair of adjacent substituents R° and R1, or R* and R2, or R2 and R3 is -CHrNH-CO-, -CH2-CH2-NH-CO-, -CH2-CO-NH-, -CH2-CHrCO-NH-, -CH2-NH-S02-, -CH2-CH2-NH-SOr, -CH2-SO2-NH-, -CH2-CH2-SO2-NH-, -CH2-CH2SO2, -CH2-CH2-CH2-SO2, -0-CH2-0-, or-O-CF2-O-, and such pairs wherein hydrogen in NH is replaced by d-daikyl;
R4 is hydrogen or C1-C8alkyl;
R5 is hydrogen; C1--C8alkyl, halogen, halod-dalkyl, cyano or nitro;

R6 is hydrogen;
each of R7 and R9 independently is hydrogen, C1-C8alkyl, hydroxyC1-C8alkyl, haloC1-C8alkyl, unsubstituted or substituted C5-C10aryl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, 0 and S, C1-C8aIkoxy, haioC1-C8aIkoxy, C5-C10aryloxy, unsubstituted or substituted heterocyclyloxy, unsubstituted or substituted heterocyciylC1-C8alkoxy, unsubstituted or substituted amino, C1-C8alkylsulfonyl, halogen, unsubstituted or substituted carbamoyl, unsubstituted or substituted sulfamoyl;
R8 is hydrogen, C1-C8aJkyi, hydroxyC1-C8aIkyl, haloCrCealkyl, C5-C10aryl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, O and S, C1-C8aIkoxy, haioC1-C8aIkoxy, C5-C10aryloxy, unsubstituted or substituted heterocyclyloxy, unsubstituted or substituted heterocydylCVCealkoxy, unsubstituted or substituted amino, C1-Cealkyisulfony!, halogen, unsubstituted or substituted carbamoyl, unsubstituted or substituted sulfamoyi, cyano, or nitro; and
R10 is C1-C8alkyl, hydroxyCrC8alkyI, haloCrCealkyl, C1-C8alkoxy, unsubstituted or substituted heterocyclylCt-Cealkoxy, unsubstituted or substituted amino, halogen, carboxy, carbamoyl, or unsubstituted or substituted sulfamoyi; or
each pair of adjacent substituents R7 and R8, or R8 and R9 or R9 and R10, is -NH-CH=CH-, -
CH=CH-NH-, -NH-N=CH-, -CH=N-NH-, -CH2-CH2CH2, -CH2-CH2CH2-CH2-, -CH2-CH2-O-
-CH=CH-0-,-O-CH2-O-, or-0-CF2-O-; -' '
A is C or N.
3. A compound of formula I according to claim 1, wherein
each of R°or R2 independently is hydrogen, C1-C8alkyl, haloC1-C8alkyl, unsubstituted or
substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, 0 and S, C1-C8alkoxy, unsubstituted or substituted heterocyclyloxy, unsubstituted or substituted heterocyclylC1-C8alkoxy, unsubstituted or substituted amino, or halogen;
R1 is hydrogen, C1-C8alkyl, haloC1-C8alkyl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, 0 and S, C1-C8aIkoxy, unsubstituted or substituted heterocyclyloxy, unsubstituted or substituted heterocyclylC1-C8alkoxy, unsubstituted or substituted amino, halogen;
R3 is hydrogen, C1-C8alkyl, haioC1-C8alkyl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 heteroatoms selected from N, O and S, C1--C8alkoxy,

substituted amino, C1-C8alkylsuIfonyl, C5--C10arylsulfonyl, halogen, carboxy, substituted or unsubstituted carbamoyl, or unsubstituted or substituted sulfamoyl; or
each pair of adjacent substituents R° and R1, or R1 and R2, or R2 and R3 is -CH2-NH-CO-, -CH2-NH-SO2-, -CH2-CH2-SOr. -O-CH2-O-, or -0-CFrO-t and such pairs wherein hydrogen in NH is replaced by C1-C8alkyl;
R4 is hydrogen;
R6 is hydrogen, halogen, haloC1-C8alkyl, or nitro;
R6 is hydrogen;
each of R7 and R9 independently is hydrogen, C1-C8aIkyl, haloCrCsalkyl, unsubstituted or
substituted CrCioaryl, unsubstituted or substituted 5 or 6 membered heterocyclyl
comprising 1 or 2 hetero atoms selected from N, O and S, C1-C8alkoxy, unsubstituted or
substituted heterocyclyioxy, unsubstituted or substituted heterocyclylC1-C8aIkoxyt
unsubstituted or substituted amino, halogen, unsubstituted or substituted carbamoyl, or
unsubstituted or substituted sulfamoyl; -
RB is hydrogen, C1-C8alkyl, haloC1-C8alkyI, CrCioaryl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, 0 and S, C1-C8alkoxy, haloC1-C8alkoxy, C5-C10aryloxy, unsubstituted or substituted heterocyclyioxy; unsubstituted or substituted heterocyclyiC1-C8alkoxy, unsubstituted or substituted amino, halogen, unsubstituted or substituted sulfamoyl, or nitro; and
R10 is C1-C8alkyl, haloC1-C8alkyl, C1-C8alkoxy, unsubstituted or substituted heterocyclylC1-Csalkoxy, unsubstituted or substituted amino, or halogen; or
each pair of adjacent substituents R7 and RB, or R8 and R9 or R9 and R10, is -NH-CH=CH-, -CH=CH-NH-, -NH-N=CH-, -CH=N-NH-, -CH2-CH2-CH2-, -CH2--CH2-CH2-CH2-, -O-CH2-O-, or -0-CFrO-;
A is C or N.
4. A compound of formula I according to claim 1, wherein
each of R°or R2 independently is hydrogen, piperazino, N-methylpiperazino or 1-methyl-4-
piperidyloxy; R1 is hydrogen, piperazino, N-methylpiperazino, morpholino, 1-methyl-4-piperidinyloxy, 3-
morpholinopropoxy or 2-morpholinoethoxy; R3 is sulfamoyl, methylsulfamoyl or propylsuifamoyl; or the pair of adjacent substituents R° and R1, or R1 and R2 is -O-CH2-O-, or the pair of adjacent
substituents R2 and R3 is -CH2-NH-CO- or -CH2-NH-SO2-;

R4 is hydrogen;
R5 is hydrogen, chloro, bromo, trifluoromethyl or nitro;
R6 is hydrogen;
each of R7 and R9 independently is hydrogen, C1-C8alky!, haloC1-C8alkyl, unsubstituted or substituted C5--C10aryl, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, O and S, C1-C8alkoxy, unsubstituted or substituted heterocyclyloxy, unsubstituted or substituted heterocydylC1-C8aIkoxy, unsubstituted or substituted amino, halogen, unsubstituted or substituted carbamoyl, or unsubstituted or substituted sulfamoyl;
R8 is hydrogen, C1-C8aIkyi, haloC1-C8alkyl, C5-C10aryI, unsubstituted or substituted 5 or 6 membered heterocyclyl comprising 1 or 2 hetero atoms selected from N, 0 and S, C1-C8alkoxy, haloC1-C8aIkoxy, C5-C10aryloxy, unsubstituted or substituted heterocyclyloxy, unsubstituted or substituted heterocyclyIC1-C8alkoxy, unsubstituted or substituted amino, halogen, unsubstituted or substituted sulfamoyl, or nitro; and
R10 is C1-C8alkyl, haioC1-C8alkyl, C1-C8alkoxy, unsubstituted or substituted heterocyclylCr C8alkoxy, unsubstituted or substituted amino, or halogen; or
each pair of adjacent substituents R7 and R8, or R8 and R9 or R9 and R10, is -NH-CH=CH-, -CH=CH-NH-, -NH-N=CH-, -CH=N-NH-, -CH2-CH2-CH2, -CH2-CH2-CH2-CH2-, -0-CH2-O-, or -O-CF2-O-;
A is C or N.
5. A compound of formula I according to claim 1, wherein
each of R°or R2 independently is hydrogen, piperazino, N-methylpiperazino or 1-methyl-4-piperidyloxy;
R1 is hydrogen, piperazino, N-methylpiperazino, morpholino, 1-methyl-4-piperidinyloxy, 3-morpholinopropoxy or 2-morpholinoethoxy;
R3 is sulfamoyl, methylsulfamoyl or propylsulfamoyl; or
the pair of adjacent substituents R° and R1, or R1 and R2 is -0-CH2-0-, or the pair of adjacent substituents R2 and R3 is -CH2-NH-CO- or -CH2-NH-SO2;
R4 is hydrogen;
R6 is hydrogen, chloro, bromo, trifluoromethyl or nitro;
R6 is hydrogen;
each of R7 and R9 independently is hydrogen, methyl, isopropyl, trifluoromethyl, phenyl, o-, trior p-methoxyphenyl, piperidino, piperazino, N-methylpiperazino, morpholino, methoxy,

ethoxy, isopropoxy, phenoxy, 3-morpholinopropoxy, 2-morphoIinoethoxy, 2-(l-
imidazolyI)ethoxy, dimethylamino, fluoro, morpholinocarbonyl, piperidinocarbonyl,
piperazinocarbonyl or cyclohexyicarbamoyl; R8 is hydrogen, methyl, plperidino, piperazino, N-methylpiperazino, morpholino, methoxy,
ethoxy, trifluoromethoxy, phenoxy, 1-methyl-4-piperidyloxy, 3-morpholinopropoxy, 2-
morpholinoethoxy, 3-(N-methylpiperazino)-propoxy, methylamino, fluoro, chloro, sulfamoyl
or nltro; and R10 is methyl, butyl, methoxy, ethoxy, 2-(1-imidazolyl)ethoxy, methylamino, dimethylamino or
fluoro; or the pair of adjacent substituents R7 and R8 or R8 and RB Is -OCH2-0- or the pair of adjacent
substituents R9 and R10 is -NH-CH=CH-, -CH=N-NH-, -CH2-CH2-CH2-i -CH2-CH2-CH2-CH2-
or-O-CF2-O; A is C or N.
6. A compound of formula I according to claim 1, wherein
each of R°, R1 or R* Is hydrogen;
R3 is sulfamoyl, methylsulfamoyl or propylsulfamoyl;
R4 is hydrogen;
R5 is chloro or bromo;
R6 is hydrogen; ...
each of R7 and Re independently is hydrogen, methyl, isopropyi, trifluoromethyl, phenyl, o-, m-
or p-methoxyphenyl, plperidino, piperazino, N-methylpiperazino, morpholino, methoxy,
ethoxy, isopropoxy, phenoxy, 3-morpholinopropoxy, 2-morphofinoethoxy, 2-(1-
imidazolyI)ethoxy, dimethylamino, fluoro, morpholinocarbonyl, piperidinocarbonyl,
piperazinocarbonyl or cyclohexyicarbamoyl; R8 is hydrogen, methyl, plperidino, piperazino, N-methylpiperazino, morpholino, methoxy,
ethoxy, trifluoromethoxy, phenoxy, l-methyl-4-piperidyIoxy, 3-morpholinopropoxy, 2-
morpholinoethoxy, 3-(N-methylpiperazino)-propoxy, methylamino, fluoro, chloro, sulfamoyl
or nitro; and R10 is methyl, butyl, methoxy, ethoxy, 2-(1-imidazolyl)ethoxy, methylamino, dimethylamino or
fluoro; or the pair of adjacent substituents R7 and R8 or R8 and R9 is -O-CH2-O-, or the pair of adjacent
substituents RB and R10 is -NH-CH=CH-, -CH=N-NH-, -CH2-CH2-CH2- -CH2-CH2-CH;rCH2-
or -O-CFrO-;

A is C or N.
7. The compound of formula I according to claim 1, wherein each of R°f R1 or R2 is hydrogen, R3
is methylsulfamoyl, R4 is hydrogen, R5 is brorno, R6 is hydrogen, each of R7 and R8 is methoxy, R9 is hydrogen, and R10 is methyl, and A Is C or N.
8. The compound of formula I according to claim 1, wherein each of R°, R1 or R2 is hydrogen, R3
is methylsulfamoyl, R4 is hydrogen, R6 is bromo, R6 is hydrogen, each of R7 and R8 is hydrogen, and the pair of adjacent substituents R9 and R10 is -CHr-CHrCHz-, and A is C or N.
9. The compound of formula 2-{5-Chloro-2-[4-(3-methylamino-pyrroiidin-1-yI)-phenylamino]-
pyrimidin-4-yiamino}-N-isopropyl-benzenesuIfonamide.

and, if desired, converting a compound of formula i, wherein the substituents have the meaning as defined in claim 1, into another compound of formula I as defined in claim 1;

and recovering the resulting compound of formula I in free from or as a salt, and, when required, converting the compound of formula I obtained in free form into the desired salt, or an obtained salt into the free form.
11. A pharmaceutical composition comprising a compound according to any one of claims 1 to 9, as active ingredient together with one or more pharmaceuticaily acceptable diluents or carriers.
12. The use of a compound according to any one of claims 1 to 9 for the manufacture of a medicament for the treatment or prevention of neoplastic diseases and immune system disorders.
13. A combination comprising a therapeutically effective amount a compound according to any one of claims 1 to 9 and one or more further drug substances, said further drug substance being useful in the treatment of neoplastic diseases or immune system disorders.
14. A method for the treatment of neoplastic diseases and immune system disorders in a subject In need thereof which comprises administering an effective amount of a compound according to any one of claims 1 to 9 or a pharmaceutical composition comprising same.
15. Use of a compound according to any one of claims 1 to 9 or a pharmaceuticaily acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of a disease which responds to inhibition of focal adhesion kinase or/and IGF-1 Receptor.
16. The use according to claim 15, wherein the disease to be treated is selected from proliferative disease.
17. The use according to claim 16, wherein the proliferative disease to be treated is selected from a tumor of, breast, renal, prostate, colorectal, thyroid, ovarian, pancreas, neuronal, lung, uterine and gastro-intestinal tumours as well as osteosarcomas and melanomas.
18. The use according to claim 15, wherein the disease to be treated is an immune disease.

Documents

Name	Date
2241-chenp-2005-pct.pdf	2011-09-04
2241-chenp-2005-form 5.pdf	2011-09-04
2241-chenp-2005-form18.pdf	2011-09-04
2241-chenp-2005-form 3.pdf	2011-09-04
2241-chenp-2005-form 26.pdf	2011-09-04
2241-chenp-2005-abstract.pdf	2011-09-04
2241-chenp-2005-form 1.pdf	2011-09-04
2241-chenp-2005-correspondnece-others.pdf	2011-09-04
2241-chenp-2005-claims.pdf	2011-09-04
11442-W45.pdf	2015-04-21
IN232653.pdf	2014-05-13
Form 27 [15-03-2016(online)].pdf	2016-03-15
Form 27 [29-03-2017(online)].pdf	2017-03-29
2241-CHENP-2005-RELEVANT DOCUMENTS [30-03-2018(online)].pdf	2018-03-30
CERTIFIED COPIES US 72 OR FOR CERTIFICATE US-147 AND RULE 133(2) [16-01-2017(online)].pdf	2017-01-16
CERTIFIED COPIES US 72 OR FOR CERTIFICATE US-147AND RULE 133(2) Copy-Online.pdf_1.pdf	2017-01-17
2241-chenp-2005-description(complete).pdf	2011-09-04
2241-CHENP-2005-FORM-26 [28-09-2018(online)].pdf	2018-09-28
CERTIFIED COPIES US 72 OR FOR CERTIFICATE US-147AND RULE 133(2) Copy-Online.pdf	2017-01-17
2241-CHENP-2005-RELEVANT DOCUMENTS [25-03-2019(online)].pdf	2019-03-25
2241-CHENP-2005-RELEVANT DOCUMENTS [25-09-2021(online)].pdf	2021-09-25
2241-CHENP-2005-RELEVANT DOCUMENTS [21-03-2020(online)].pdf	2020-03-21

Orders

Applicant

Section

Controller

Decision Date

URL