DESC:FIELD OF THE INVENTION
[1] The present invention pertains to the field of biopharmaceuticals and discloses a synthesis of 5’UTR for improved expression of proteins and peptides. More particularly the present invention focuses on the stabilization and high translatability of m-RNA for providing vaccines and gene therapy.

BACKGROUND AND PRIOR ART OF THE INVENTION
[2] In modern days, genetic vaccination and gene therapy have revolutionized modern medicine by enabling the production of therapeutic proteins through nucleic acid injection. mRNA and plasmid DNA are key components of genetic vaccines, with mRNA vaccines using in-vitro transcribed mRNA. Stability and translatability of mRNA are crucial for effective protein production. mRNA structures, such as hairpin structures near the 5' cap, upstream open reading frames (uORFs), and 5'-terminal oligopyrimidine tract (TOP) sequences in 5' UTRs, can influence translation efficiency.

[3] Similarly in case of gene therapy, nucleic acids are administrated to the patient leading to translation of encoded protein/peptide or alternatively the specific cells of patient are harvested and transfected in vitro and re-administered to the patient.

[4] Furthermore, upstream open reading frames (uORFs) can also destabilize mRNA. 5'-terminal oligopyrimidine tract (TOP) sequences regulate translation and are found in the 5’ UTRs of most translation-related genes.

[5] Since 5’UTR plays important role in translation thus the bioavailability of target therapeutic peptide or antigen. Thus it is desired to have 5’UTRs which increase the translatability of the mRNA to reduce the cost by reducing the dosage.

[6] US Patent Application No. 11875876 discloses a novel 5' UTR sequences designed for controlling gene expression in diverse contexts. Additionally, it introduces methods for engineering and screening the 5' UTR sequences to identify specific properties of interest. Furthermore, this invention offers a high-throughput approach for designing, screening, and optimizing novel 5' UTR sequences, allowing precise control over protein expression levels.

[7] European Patent Application No. 2535419 discloses a synthetic 5' UTRs composed of two polynucleotide fragments. In this, the first fragment includes at least one splice site from a eukaryotic gene, specifically the second intron of a sarco/endoplasmic reticulum calcium ATPase gene. The second fragment encompasses a portion of the 5' untranslated region (5'UTR) of a eukaryotic casein gene. Furthemore, when positioned between a promoter and a transgene within an expression vector, these synthetic 5' UTRs enhance transgene expression. Additionally, this invention provides vectors containing these synthetic 5' UTRs and outlines methods for increasing transgene expression using these constructs.

[8] PCT Application No. 2023101508 discloses a synthetic nucleic acid molecule featuring a 5'-UTR (5' untranslated region) designed to enhance translation efficiency. This invention focuses on a specific motif within the 5'-UTR polynucleotide to improve translation efficiency. The invention provides an isolated 5'-UTR polynucleotide with a specific nucleic acid sequence represented by the formula AG[N22]GCCACC. This advancement has promising implications for vaccine and therapeutic compositions aimed at preventing various diseases.

[9] Richard N. Bamford et al. published a study in the Journal of Immunology entitled " The 5’ untranslated region, signal peptide, and the coding sequence of the carboxyl terminus of IL-15 participate in its” multifaceted translational control" in 1998. The study investigates factors affecting the translation of IL-15 mRNA. It reveals that not only the AUG-rich 5' untranslated region (UTR) but also the nucleotide and protein sequences of the IL-15 signal peptide and carboxyl terminus impact IL-15 translation efficiency. Substituting the signal peptide of IL-15 with that of IL-2 significantly enhances IL-15 protein levels, while a similar modification reduces IL-2 protein production. Additionally, adding an epitope tag to the IL-15 coding sequence boosts its protein production. Combining these modifications and removing the 5' UTR results in a substantial 250-fold increase in IL-15 synthesis. In overall, these findings suggest that cells may store translationally inactive IL-15 mRNA, which can be rapidly activated in response to infections or other stimuli for efficient translation.

[10] Celine Jousse et al published a study in the Journal of Nucleic Acids Research "Inhibition of CHOP translation by a peptide encoded by an open reading frame localized in the chop 5’UTR" in 2001. This study investigates a novel mechanism of inhibiting CHOP (C/EBP homologous protein) translation. Furthermore, it focuses on a peptide encoded within an open reading frame that is situated in the 5' untranslated region (UTR) of the CHOP gene. Furthermore, this peptide was found to have the unique ability to hinder the translation of CHOP. The study sheds light on a previously undiscovered regulatory element in the CHOP gene's 5' UTR, offering valuable insights into the complex mechanisms governing gene expression and protein synthesis. However, this inhibition mechanism could have implications for research in cellular stress responses and potentially lead to the development of new therapeutic strategies.

[11] However, while prior arts have explored various 5' UTRs, there is still a need for further improvements in translation efficiency. The present invention aims to generate a 5' UTRs that can be further used in the field of gene therapy and genetic vaccines. The UTRs described in the present invention aim to enhance post-transcriptional protein/peptide translation from mRNA in mammalian cells.

OBJECTIVES OF INVENTION
[12] Accordingly, the primary objective of the present invention is to provide an mRNA molecule for vaccines and gene therapy.

[13] Another objective of the present invention is to create an mRNA molecule with a modified 5' UTR that exhibits an enhanced in vivo translation efficiency.

SUMMARY OF THE INVENTION
[14] From a broad perspective, the present invention focuses on gene therapy and genetic vaccines and centers around the utilization of UTRs to enhance the post-transcriptional translation of proteins and peptides from mRNA in mammalian cells.

[15] Furthermore, the present invention concerns the 5' UTRs of mRNA, which have the capacity to significantly enhance protein and peptide expression. In the rapidly evolving landscape of molecular medicine, particularly within DNA/RNA vaccines and therapeutics, 5' UTRs play a pivotal role in governing in vivo translatability and mRNA stability.

[16] In another aspect, the present invention discloses the creation of a synthetic 5' UTRs that enhance the post-transcriptional translation of proteins and peptides in mammalian cells.

[17] In still another aspect, the present invention involves an mRNA molecule featuring a 5' cap, synthetic 5' UTR, coding region encoding a polypeptide or protein, 3' UTR, and a Poly(A) tail.

[18] In yet another aspect, the synthetic 5' UTR can be selected from one of the sequences listed in Seq ID 1-8.

[19] Furthermore, the present invention discloses a method for expressing the mRNA within a host cell, which entails transfecting the host cell with in vitro transcribed mRNA and culturing the host cells under conditions suitable for producing the desired protein or peptide.

[20] In summary, the present invention focuses on gene therapy and genetic vaccines by harnessing synthetic 5' UTRs to significantly enhance the post-transcriptional translation of proteins and peptides from mRNA in mammalian cells, with the potential to advance molecular medicine, particularly in the realm of DNA/RNA vaccines and therapeutics. Additionally, the method involves the creation of mRNA molecules featuring synthetic 5' UTRs, offering a promising avenue for improving protein expression in host cells, as demonstrated through in-vitro transcription and transfection experiments with A549 cells.

[21] In yet another aspect, the present mRNA from sequence 25-33 can exhibits luciferase activity ranging from 10000-160000 RLU.

BRIEF DESCRIPTION OF THE DRAWINGS
[22] The invention has other advantages and features which will be more readily apparent from the following detailed description of the invention and the appended claims, when taken in conjunction with the accompanying drawings, in which:

[23] Figure 1: depicts the the relative translation efficiency of mRNAs in A549 cells.

SOURCE OF BIOLOGICAL MATERIAL
[24] The sequences are synthetic one not from any organism.

DETAILED DESCRIPTION OF THE INVENTION
[25] While the invention has been disclosed concerning certain embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the scope of the invention. In addition, many modifications may be made to adapt to a particular situation or material to the teachings of the invention without departing from its scope.

[26] Throughout the specification and claims, the following terms take the meanings explicitly associated herein unless the context clearly dictates otherwise. The meaning of "a", "an", and "the" include plural references. The meaning of "in" includes "in" and "on." Referring to the drawings, like numbers indicate like parts throughout the views. Additionally, a reference to the singular includes a reference to the plural unless otherwise stated or inconsistent with the disclosure herein.

[27] The figures and protocols have been represented where appropriate by conventional representations in the drawings, showing only those specific details that are pertinent to understanding the embodiments of the present invention so as not to obscure the disclosure with details that will be readily apparent to those of ordinary skill in the art having the benefit of the description herein, UTRs (Untranslated Regions), Cypridina luciferase (CLuc) an enzyme and untranslated regions (UTRs).

[28] As used herein, “bioavailability” refers to the proportion of a drug, nutrient, or other substance that enters the bloodstream when introduced into the body, thus becoming available for its intended biological effect.

[29] As used herein, “translatability” refers to the ability of given mRNA to produce protein/peptide in-vitro and in-vivo.

[30] As used herein, “gene-therapy” is a medical technique that involves the alteration, manipulation, or replacement of a person's genes to treat or prevent diseases. It is a cutting-edge approach that aims to correct genetic mutations or introduce new genes into a patient's cells to address underlying genetic disorders.

[31] As used herein, “bioavailability” refers to the extent and rate at which a drug, nutrient, or other substance is absorbed by the body's circulatory system and becomes available for its intended physiological or therapeutic effect.

[32] As used herein, “Cypridina luciferase” an enzyme derived from the marine organism Cypridina noctiluca, commonly known as the sea firefly or marine firefly. This enzyme is often used as a bioluminescent reporter in scientific research.

[33] As used herein, “A549 cells” widely used type of human epithelial cell line that was originally derived from a lung carcinoma in 1972.

[34] In one embodiment, the present invention is centered around the fields of gene therapy and genetic vaccines, with a primary focus on enhancing the post-transcriptional translation of proteins and peptides derived from mRNA in mammalian cells. This innovative approach leverages the utilization of UTRs to achieve this goal.

[35] Another embodiment of the present invention as illustrated in Fig.1 which representing the relative translation efficiency of mRNAs in A549 cells.

[36] In still another embodiment of the present invention, the present invention introduces the concept of synthetic 5' UTRs designed to augment the post-transcriptional translation of proteins and peptides within mammalian cells.

[37] Furthermore, the 5' UTRs are embedded in an mRNA molecule, featuring essential components such as a 5' cap, synthetic 5' UTR, a coding region encoding a polypeptide or protein, a 3' UTR, and a Poly(A) tail.

[38] In yet another embodiment of the present invention, the synthetic 5' UTR can be selected from a set of sequences listed in Seq ID 1-8. Furthermore, the present invention discloses a method for expressing mRNA within a host cell, involving the transfection of the host cell with in vitro transcribed mRNA. The host cells are then cultured under conditions suitable for producing the desired protein or peptide.

[39] In yet another embodiment of the present invention coding SEQ ID NO. 1 is: GGGCCCUGUAUCUGUUAGUAGAUUGCGUAGUUGAAGCC.

[40] In still another embodiment of the present invention coding SEQ ID NO. 2 is:GGGCCUGUGAAGGUAGCCUGAUAGAUACUCCGGUCUGUGAUAGGGUCUCUAACGCAGUGCUCUGUGACGCAGACACUGUUUAACGUGAUAGAGCGGGAAC.

[41] In yet another embodiment of the present invention coding SEQ ID NO. 3 is:GGGCCAUCGUAUAGAGUCGUACUUUAGCUUACGUUAUCGAUUGCAUUCUGAAAUCGUUAAGC.

[42] In still another embodiment of the present invention coding SEQ ID NO. 4 is:GGGCCACCGUUAACGCGUAGUGAGUAGUUAUCUAGUUAGUGAGCGAAUAGGUUUAAUAGCUUAUAACAUGCUCUUCAAUAUGAAUCAUUCUAUGAGCAAC.

[43] In yet another embodiment of the present invention coding SEQ ID NO. 5 is:AGGAUACGUAAUCAUUCGUAGUGACGUUGAUACUACGAAUGUUCGCGAACAUGAGUCAUCUGAGUCAGGCAACC.

[44] In still another embodiment of the present invention coding SEQ ID NO. 6 is:AGGACUGUGAUCUUGACUUAGUGAAUCGCAUUCUGCAGUCUGCAUUAAUCGCAAACAUGAAUCUUGUUGAC.

[45] In yet another embodiment of the present invention coding SEQ ID NO. 7 is:AGGACUGUGAUCUUGACUUAGUGAAUCGCAUUCUGCAGUCUGCAUUAAUCGCAAACGUGAAUCUUGUUGAC.

[46] In still another embodiment of the present invention coding SEQ ID NO. 8 is: AGGACUGUGUACUUAACUUAGUGUAUCGCAUACUGACGUCUGCAUUAAUGGCAGAC.

[47] In yet another embodiment of the present invention to ensure the successful production of the desired protein or peptide, host cells are cultured under conditions that facilitate the transcription of the mRNA.

[48] Furthermore, the present invention involves a method for expressing the mRNA selected from 25-33 within a host cell by transfecting it with an expression vector containing an appropriate promoter and a synthetic gene construct featuring a synthetic 5' UTR, coding region encoding a polypeptide, 3' UTR, and polyA signal sequence. The host cells are then cultured under conditions suitable for the transcription of the mRNA and the production of the desired protein or peptide.

[49] In another embodiment of the present invention, the present mRNA from sequence 25-33 can exhibits luciferase activity ranging from 10000-160000 RLU.

[50] However, in overall, the present invention offers a invention that is dedicated to the domains of gene therapy and holds significant promise for advancing molecular medicine, especially in the context of DNA/RNA vaccines and therapeutic inventions.

EXAMPLES
[51] The following examples, which include preferred embodiments, will serve to illustrate the practice of this invention, it being understood that the particulars shown are by way of and for purpose of illustrative discussion of preferred embodiments of the invention.

Example 1: Synthesis of 5’UTRs:
The Cypridina luciferase (CLuc) was amplified from pCMV-CLuc 2 using primers SeqID 10 and 11. The amplified CLuc was digested with NcoI restriction enzyme ligated with different synthetic T7 promoter- 5’UTRs with compatible overhangs. Ligated products were used as template for PCR amplification of synthetic T7 CLuc constructs with different 5’UTRs. T7 CLuc constructs with 5’UTRs SeqID 1-4 were amplified using primers SeqID 12 and 15 and 5’UTRs SeqID 5-8 were amplified using primers SeqID 13 and 15. Whereas, the control pCMV-CLuc 2 (5’UTR SeqID 9) was amplified using primers SeqID 14 and 15. The PCR amplified T7 CLuc constructs with 5’UTRs SeqID 1-9 were confirmed by sequencing and given SeqID16-24 respectively. The reverse primer SeqID 15 provided a uniform polyA 70 tail.

Example 2: In-vitro transcription of mRNA:
[52] The in-vitro transcription of mRNA was carried out using the HiScribe T7 ARCA mRNA Kit (NEB) according to manufacturer’s instruction and purified using GeneJET RNA Cleanup and Concentration Micro Kit (Thermo Scientific). mRNA was transfected into A549 cells using Lipofectamine™ MessengerMAX™ Reagent (Thermo Scientific) and assayed for luciferase activity using Pierce Cypridina Luciferase Flash Assay Kit (Thermo Scientific), as described. The method including the steps of:
(a) cell transfection include the steps including: seeded 70-80% cells ~10,000 cells/well in a 96-well plate in DMEM media with 10% FBS. Incubated plates at 37°C in 5% CO2 for 24 hours. Thereafter, in MCT tube added 300 µL DMEM incomplete media and 9.0 µL Lipofectamine MessengerMAX reagent and mixed. Furthermore prepared 10 MCT tubes 1 for control and 9 for RNA. Add in each tube 15 µL DMEM incomplete media and 150 ng RNA and mixed well. Added to each tube 15 µL lipofectamine solution from step 2 to make RNA-lipid complex. Incubated at room temperature for 15 min. Meanwhile removed the media from cell plate and add fresh 90 µL DMEM incomplete media. Then added 10 µL of RNA–lipid complex in each well in triplicates from step 3 so that each well get 50 µg of respective mRNA. Lastly, incubated cells for 24 hours at 37°C in 5% CO2 in a cell culture incubator.
(b) Cypridina luciferase flash ssay include the steps including: To make working solution for 30 reactions, added 15 µL of 100X Vargulin to 1500 µL of Cypridina Flash Assay Buffer. Thereafter, added 20µL/well of media from transfected plate to a white 96-well plate and added 50µL of Working Solution to each well. Then immediately after adding the reagent, light output was detected using a microplate luminometer.

Results:
[53] The Cypridina luciferase flash assay showed that A549 cells mRNAs with synthetic 5’UTRs exhibits a multifold increase in luciferase activity as compared to cells transected with mRNA having 5’ UTR of pCMV-CLuc 2.

[54] ADVANTAGES OF THE INVENTION
? The present invention focuses on enhancing the post-transcriptional translation of proteins and peptides derived from mRNA in mammalian cells. This can lead to increased protein expression, which is valuable in various applications, including gene therapy and genetic vaccines.

? Furthermore, the introduction of synthetic 5' UTRs provides versatility and customization in regulating protein expression, allowing for fine-tuned control of gene expression levels within mammalian cells and provide versatile synthetic 5' UTRs.

? Moreover, the present innovation has the potential to advance the field of molecular medicine, particularly in the development of DNA/RNA vaccines and therapeutic interventions, offering new avenues for the treatment of genetic disorders and diseases.

? Additionally, by selecting synthetic 5' UTR sequences from a set of predefined options, researchers can precisely control gene expression levels, allowing for tailored approaches in gene therapy and genetic vaccine development.

? In overall, the present invention enhances protein expression in mammalian cells, offering versatile control through synthetic 5' UTRs, with potential applications in gene therapy, genetic vaccines, and molecular medicine, as demonstrated by promising results in A549 cell experiments.

Dated this day of 07th November 2024
,CLAIMS:We claim,
1. A polynucleotide comprising a synthetic 5' untranslated region (5' UTR) with a sequence selected from a group of:
(SEQ ID NO. 1)
GGGCCCUGUAUCUGUUAGUAGAUUGCGUAGUUGAAGCC.

(SEQ ID NO. 2)
GGGCCUGUGAAGGUAGCCUGAUAGAUACUCCGGUCUGUGAUAGGGUCUCUAACGCAGUGCUCUGUGACGCAGACACUGUUUAACGUGAUAGAGCGGGAAC.

(SEQ ID NO. 3)
GGGCCAUCGUAUAGAGUCGUACUUUAGCUUACGUUAUCGAUUGCAUUCUGAAAUCGUUAAGC.

(SEQ ID NO. 4)
GGGCCACCGUUAACGCGUAGUGAGUAGUUAUCUAGUUAGUGAGCGAAUAGGUUUAAUAGCUUAUAACAUGCUCUUCAAUAUGAAUCAUUCUAUGAGCAAC.

(SEQ ID NO. 5)
AGGAUACGUAAUCAUUCGUAGUGACGUUGAUACUACGAAUGUUCGCGAACAUGAGUCAUCUGAGUCAGGCAACC.

(SEQ ID NO. 6)
AGGACUGUGAUCUUGACUUAGUGAAUCGCAUUCUGCAGUCUGCAUUAAUCGCAAACAUGAAUCUUGUUGAC.

(SEQ ID NO. 7)
AGGACUGUGAUCUUGACUUAGUGAAUCGCAUUCUGCAGUCUGCAUUAAUCGCAAACGUGAAUCUUGUUGAC.

(SEQ ID NO. 8)
AGGACUGUGUACUUAACUUAGUGUAUCGCAUACUGACGUCUGCAUUAAUGGCAGAC
wherein the polynucleotide exhibits a luciferase activity ranging from 10000-160000 RLU.

2. The polynucleotide of claim 1, wherein the polynucleotide comprises:
a) 5' cap;
b) synthetic 5' UTR;
c) 3' UTR;
d) a Poly(A) tail;
e) a sequence encoding a polypeptide; or
f) a combination thereof.

3. The polynucleotide of claim 1, wherein the polynucleotide is a mRNA molecule.

4. The polynucleotide, wherein the polynucleotide is a DNA molecule encoding mRNA containing sequence of claim 1.

Dated this day of 07th November 2024