Sign In to Follow Application
View All Documents & Correspondence

Silk Fibroin Composite Matrix As A Scaffold For Tissue Regeneration

Abstract: Disclosed herein are silk fibroin composite matrixes as scaffolds in tissue regeneration and the process for preparation thereof.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
28 December 2023
Publication Number
26/2025
Publication Type
INA
Invention Field
BIO-MEDICAL ENGINEERING
Status
Email
Parent Application

Applicants

Serigen Mediproducts Private Limited
Plot 39, Electronic Coop Estate, Off Satara Road Pune - 411009 Maharashtra, India

Inventors

1. NISAL, Anuya Amol
1006-B, Anusha Residency, Sus Road, Sutarwadi, Pune-411021, Maharashtra, India
2. SHUKLA, Swati Govind
1003, Suvarnpushpa Apartments, A wing, Mandar Society, Sahakar Nagar 1, Pune-411009, Maharashtra, India,
3. SAYYAD, Raeesa
F1A,603, Basera Bldg, Narendra Park, Naya Nagar, Mira Road (E), Thane-401107, Maharashtra, India,
4. DESHPANDE, Rucha Vikram
N-304, Hill View Residency, Jijai Nagar, Pune-411038, Maharashtra, India

Claims

1. A biocompatible silk fibroin composite matrix for tissue regeneration comprising; i. Lyophilized Regenerated Silk Fibroin; and/or ii. One or more non-woven mesh of said silk fibroin; and/or iii. One or more woven mesh of said silk fibroin.

2. The silk fibroin composite as claimed in claim 1, wherein the composites comprises of; i. Lyophilized regenerated silk fibroin (LR) of thickness 1 to 3 mm, grammage of 5-35 mg/cm2 and porosity of > 90-98%; and/or ii. One or more non-woven mesh/es (NW) with thickness of 0.2 to 3.0mm each, weight of 5-25mg/cm2 and porosity of 70-90%; and/or iii. One or more woven mesh/es (W2XC), each with a pitch ranging between 1mm-10mm in XY direction and/or layer/s woven at angles ranging from 30 to 60 deg to X and Y direction (XY-CC), thickness of 0.2 to 3.0 mm; grammage of 1-10 mg/cm2 and porosity of 80 - 99%.

3. The silk fibroin composite as claimed in claim 1, wherein said silk fibroin composite is three dimensional.

4. The silk fibroin composite as claimed in claim 1, wherein said silk fibroin composite is prepared by the process comprising; i. Preparing the silk fibroin solution by boiling the Bombyx mori pure bivoltine silk hanks in alkaline solution until removal of sericin and obtaining the pure fibroin fibres; ii. Vacuum drying the pure fibroin fibres of step (i); iii. Dissolving the dried silk fibroin in LiBr followed by dialysis to obtain the silk fibroin solution with 4wt% – 6wt% concentration; iv. Diluting the solution of step (iii) with DI water to obtain 0.1wt% to 6wt% of silk fibroin (SF); v. Converting said regenerated silk fibroin solution of step (iv) to lyophilized and/or woven mesh and /or non-woven mesh composites as desired.

5. The process for preparing the Lyophilized Regenerated Silk Fibroin (LR-S1) composite comprising; i. Freezing the regenerated silk fibroin solution (SF) obtained in claim 4 in appropriate concentration in the mold at a temperature in the range of -10°C to -80°C for 1-24 hours; and ii. Lyophilizing at -55°C to -80°C for 5-24 hours to obtain LR-S1 followed by annealing and sterilization using steam sterilization before use.

6. The process for preparing the non-woven silk fibroin mesh (NW-S2) composite comprising; i. Using the pure silk fibroin fibres obtained in claim 4 and soaking the silk fibroin fibres in distilled water for 4-24 hours and beating to obtain the pulp; and ii. Preparing the non-woven mesh from said pulp using hand sheet former machine and drying to obtain NW-S2 followed by steam sterilization before use.

7. The process for preparing the woven silk fibroin meshes (W2XC-S3) composite comprising; i. Weaving the continuous monopoly/ multiply silk fibroin thread using a pitch in the range of 1mm to 10mm to obtain mesh consisting of single layer woven in XY direction and single layer woven in criss-cross direction (at angles ranging from 30 to 60 deg to XY); and ii. Applying silk fibroin solution (SF) obtained in claim 4 in appropriate concentration on to the woven mesh for sticking the threads together and drying to obtain W2XC-S3 followed by annealing and sterilization using steam (autoclaving) before use.

8. The process for preparing the W2XC-R (S4) composite comprising; i. Placing the woven silk fibroin mesh (W2XC) in a mold and pouring silk fibroin solution obtained in claim 4 on to said woven mesh; and ii. Freezing the composite at a temperature ranging between -10°C to -80°C for 1-24 hours and further freeze drying at -55°C to -80°C for 5-24 hours to obtain the W2XC-R composite followed by annealing and sterilization using steam (autoclaving) before use.

9. The process for preparing the NW+R (S5) composite comprising; i. Preparing the silk fibroin non-woven mesh (NW); ii. Placing the silk fibroin non-woven mesh of step (i) in a mold and pouring the silk fibroin solution obtained in claim 4 in appropriate concentration on to said non-woven mesh; and iii. Freezing the composite at a temperature ranging between -10°C to -80°C for 1-12 hours and further freeze drying at -55°C to -80°C for 5-24 hours and sterilizing the NW+R composite before use.

10. The process for preparing the NW-W2XC-NW-R (S6) composite comprising; i. Preparing two silk fibroin non-woven mesh (NW), woven mesh (W2XC), and the silk fibroin (SF) solution; ii. Placing the single woven mesh (W2XC) sandwiched between two non-woven (NW) meshes in a mold and pouring the silk fibroin solution obtained in claim 4 in appropriate concentration; iii. Freezing the composite at a temperature ranging between -10°C to -80°C for 1-12 hours and further freeze drying at -55°C to -80°C for 5-24 hours and steam sterilizing the NW-W2XC-NW-R composite before use.

11. The process for preparing the W2XC-NW-R (S7) composite comprising; i. Preparing one silk fibroin woven mesh (W2XC), a non-woven mesh(NW) and the silk fibroin solution; ii. Placing the non-woven mesh (NW) in a mold and placing the woven mesh (W2XC) on top of said non-woven mesh (NW) followed by pouring silk fibroin solution obtained in claim 4 in appropriate concentration; and iii. Freezing the composite at a temperature ranging between -10°C to -80°C for 1-12 hours and further freeze drying at -55°C to -80°C for 5-24 hours and annealing and sterilizing the W2XC-NW-R composite by steam sterilization before use.

12. Use of the silk fibroin composites as claimed in any one of the preceding claims 1-11 as scaffolds for regeneration and / or repair of damaged tissues such as skin, vessels, tendons, cartilage, bone or organs temporarily or permanently interconnected or grafted to the organism.

13. A method of regenerating and/or repairing the damaged tissues comprising using the silk fibroin composite matrix as claimed in any one of the preceding claims 1-11 as scaffolds

Specification

DESC:FIELD OF THE INVENTION
The present invention relates to silk fibroin composite matrix as scaffolds in tissue regeneration and to the process for preparation thereof.

BACKGROUND OF THE INVENTION
Tissue engineering involves use of scaffolds for regeneration and/or repair of damaged tissue. These meshes / matrices play a crucial role in tissue regeneration by providing a scaffold for cells to grow, proliferate and function. These matrices should have appropriate mechanical properties sufficient to withstand the stresses experienced by the native tissue. During surgical procedures, it is common practice to suture these scaffolds to nearby tissues. Therefore, it is important for these matrices to possess suturability and conformability, allowing them to be securely sutured and adapt to the surrounding tissue. In addition, it is also desirable that the matrices can be cut to the desired shape and size during the surgical procedure. Along with the mechanical properties, they should support cellular adhesion and have porosity suitable for cell migration, cell-cell interaction, and nutrient transport (Bonferoni MC et al., 2021). These matrices are easy to use and do not require two surgeries as in the case of autografts.
Acellular dermal matrix (ADM) and collagen matrices are currently used for soft tissue regeneration. They are easy to use, and do not require two surgeries. But use of ADMs or collagen matrices impose the high risk of infection transmission and complications like seroma, skin necrosis, haematoma, poor angiogenesis, poor tissue integration and implant loss. Other synthetic meshes are also explored for soft tissue regeneration application. Owing to the woven/knitted thread structure, they do not offer sufficient surface area for cell attachment and tissue integration resulting in complications such as capsular contracture, seroma, implant loss etc.
Thus, there is indeed a need for development of a matrix that has desired mechanical properties, appropriate surface textures, possess suturability, conformability and optimal porosity. The matrix should also support cellular adhesion, proliferation, collagen deposition and new blood vessel formation (angiogenesis), ultimately resulting in soft tissue regeneration.
Silk fibroin (SF) is a natural biopolymer extracted from silkworm Bombyx mori. SF is an attractive biomaterial for tissue engineering due to biocompatibility, ease of processability, tuneable mechanical properties and resorption rates (Vepari et al., 2007; Nguyen et al., 2019; Sun W et al., 2021). SF can be processed into various forms to support hard and soft tissue regeneration to achieve different porosities, mechanical properties and biological properties.
In view of the advantageous properties of the silk fibroin as biomaterial in bioengineering, the present inventors felt that there is a scope in the art to provide silk fibroin composite matrix as scaffolds for tissue regeneration. Incorporation of non-woven and/or woven meshes along with lyophilized silk fibroin can be used to tailor the properties of silk fibroin matrix to optimize matrix cell interactions. This can enhance cell adhesion and proliferation and subsequently stimulate the formation of blood vessels and collagen deposition, leading to improved tissue regeneration. This remains the objective of the invention.

SUMMARY OF THE INVENTION
In accordance with the above, the present invention provides biocompatible silk fibroin composite matrix for tissue regeneration comprising;
Lyophilized Regenerated silk fibroin (LR) ; and/or
Non-woven mesh of said silk fibroin; and/or
Woven mesh of said silk fibroin.
In an aspect, the silk fibroin composite of the present invention with its characteristics is given below:

Composite No. Composite type Description Thickness (mm) Grammage (mg/cm2) Porosity
(%)
S1 LR Lyophilized regenerated silk fibroin 1-3 5-35 90-98%
S2 NW Non-woven mesh 0.2 to 3 5-25 70-90%
S3 W2XC Woven Mesh with a Pitch (i.e. the distance between the two woven fibres) in the range of 1mm to 10mm; XY-CC (Direction of woven fibers) 0.2 to 3 1-10 80-99%
S4 W2XC-R Woven Mesh with a Pitch (i.e. the distance between the two woven fibers) in the range of 1mm to 10mm; XY-CC (Direction of woven fibers) + Lyophilized regenerated silk fibroin 1.0 to 3.0 9-12 85-95%
S5 NW+R Non-Woven mesh + Lyophilized regenerated silk fibroin 1.0 to 3.0 18-24 85-95%
S6 NW-W2XC-NW-R Non-woven mesh + Woven (with a Pitch i.e. the distance between the two woven fibers in the range of 1mm to 10mm; XY-CC (direction of woven fibers)) + Non-woven mesh + Lyophilized regenerated silk fibroin 1.0 to 3.0 25-35 75-80%
S7 W2XC-NW-R Woven Mesh (with a Pitch i.e. the distance between the two woven fibers in the range of 1mm to 10mm; XY-CC (Direction of woven fibers)) + Non-woven mesh + Lyophilized regenerated silk fibroin 1.0 to 3.0 15-22 85-95%
S8 W2XC-R* Woven Mesh with a Pitch (i.e. the distance between the two woven fibers) in the range of 1mm to 10mm; XY-CC (Direction of woven fibers) + Lyophilized regenerated silk fibroin + Annealed using organic solvent and ethylene oxide sterilized 1.0 to 3.0 9-12 85-95%
Legend:
XY- indicates one layer each woven in X and Y direction i.e. perpendicular to each other
CC - Indicates one layer each woven at various angles (30 to 60 deg.) to X and Y direction i.e. criss-cross to the X-Y layer
In an aspect, the silk fibroin composite matrix of the present invention possesses suturability and conformability thereby allowing them to be securely sutured and adapt to the surrounding tissue.
In another aspect, the silk fibroin composite matrix can be cut to required shape and size during surgical use.
In another aspect, the present invention provides a method for preparing the silk fibroin composites comprising;
Preparing the pure silk fibroin fibers by boiling the Bombyx mori pure bivoltine silk fibers in alkaline solution until removal of sericin and obtaining the pure silk fibroin fibers;
Vacuum drying the pure silk fibroin fibers of step (i);
Dissolving the dried silk fibroin in LiBr followed by dialysis to obtain the silk fibroin (SF) solution with 2wt% – 10wt% concentration;
Diluting the solution of step (iii) with DI water to obtain 0.1wt% to 10wt% of silk fibroin (SF) solution;
Converting said silk fibroin (SF) solution of step (iv) using a process of lyophilization to form composite containing this lyophilized regenerated SF with woven mesh and /or non-woven mesh as desired; and
Annealing the silk fibroin composite matrices from step (v) followed by sterilizing to obtain the desired product.
In another aspect, the process for preparing the Lyophilized Regenerated Silk Fibroin (LR-S1) comprising;
Freezing the silk fibroin (SF) solution as prepared above in suitable concentration in the mold at a temperature in the range of -10°C to -80°C for 1-24 hours; and
Lyophilizing at -55°C to -80°C for 5-24 hours to obtain the desired product followed by annealing and sterilization before use.

In another aspect, the processes for preparing the non-woven silk mesh (NW-S2) comprising;
Degumming (removal of sericin protein) the silk thread to obtain pure silk fibroin fibers as described above and soaking the pure silk fibroin fibers in water for about 4-24 hours and beating to obtain the pulp;
Preparing the non-woven (NW) mesh from said pulp using hand sheet former machine and drying followed by sterilization before use.
In yet another aspect, the process for preparing the woven silk meshes (W2XC-S3) comprising;
Weaving the continuous monopoly/multiply silk fibroin thread using a pitch in the range of 1mm to 10mm to obtain mesh consisting of single layer woven in XY direction and single layer woven in criss-cross direction (at angles ranging from 30 to 60 deg to XY); wherein pitch is the distance between two woven parallel silk fibroin threads; and.
Applying the silk fibroin solution (SF) as prepared above in suitable concentration on to the woven mesh for sticking the threads together and drying to obtain the desired product followed by annealing and sterilization before use.
In another aspect, the process for preparing the W2XC-R (S4) composite comprising;
Placing the woven silk fibroin mesh (W2XC) prepared as described above in a mold and pouring the silk fibroin (SF) solution as prepared above on to said woven mesh;
Freezing the composite at a temperature ranging between -10°C to -80°C for 1-24 hours and further freeze drying at -55°C to -80°C for 5-24 hours followed by annealing and sterilization of the W2XC-R composite before use.

In an aspect, the process for preparing the NW+R (S5) composite comprising;
Preparing the non-woven mesh (NW) and silk fibroin (SF) solution as described above;
Placing the silk fibroin non-woven mesh in a mold and pouring the silk fibroin solution as prepared above of suitable concentration on to said non-woven mesh;
Freezing the composite at a temperature ranging between -10°C to -80°C for 1-24 hours and further freeze drying at -55°C to -80°C for 5-24 hours followed by annealing and sterilization of the NW-R composite before use.

In another aspect, the process for preparing the NW-W2XC-NW-R (S6) composite comprises;
Preparing two silk fibroin meshes namely woven mesh (W2XC) - a non-woven mesh (NW) and the silk fibroin (SF) solution as described above;
Placing the single woven mesh (W2XC) sandwiched between two non-woven (NW) meshes in a mold and pouring the silk fibroin solution as prepared above of suitable concentration;
Freezing the composite of step (ii) at a temperature ranging between -10°C to -80°C for 1-12 hours and further freeze drying at -55°C to -80°C for 5-24 hours followed by annealing and sterilizing the NW-W2XC-NW-R composite before use.

In yet another aspect, the process for preparing the W2XC-NW-R (S7) composite comprising;
Preparing one silk fibroin woven mesh (W2XC) , a non-woven mesh (NW) and the silk fibroin solution as described above;
Placing the non-woven mesh(NW) in a mold and placing the woven mesh (W2XC) on top of said non-woven mesh(NW) followed by pouring silk fibroin solution as prepared above of suitable concentration;
Freezing the composite of step (ii) at a temperature ranging between -10°C to -80°C for 1-24 hours and further freeze drying at -55°C to -80°C for 5-24 hours followed by annealing and sterilizing the W2XC-NW-R composite before use.
In another aspect, the process for preparing the W2XC-R* (S8) composite comprising;
Placing the woven silk fibroin mesh (W2XC) prepared as described above in a mold and pouring the silk fibroin (SF) solution as prepared above on to said woven mesh;
Freezing the composite at a temperature ranging between -10°C to -80°C for 1-24 hours and further freeze drying at -55°C to -80°C for 5-24 hours followed by annealing using organic solvent and sterilization using ethylene oxide of the W2XC-R composite before use.
Thus, the invention describes the use of combinations of single or multiple layers of non-woven mesh and/or single or multiple layers of woven mesh along with use of lyophilized silk fibroin solution to effectively modulate the cell - silk fibroin matrix interactions.

DESCRIPTION OF THE DRAWINGS
Figure 1: Depicts the percentage water absorption for different composites.
Figure 2: Depicts the percentage cellular adhesion at 24h for different composites.
Figure 3: Depicts the proliferation of fibroblasts on different composites
Figure 4: Depicts the fold difference in new blood vessel formation expressed as Ang-1 (Angiopoietin-1) expression.
Figure 5: Depicts the fold difference in collagen deposition.
Figure 6: Depicts the suture retention ability of the silk fibroin composites
Figure 7: Depicts the woven mesh of varying dimensions.

DETAILED DESCRIPTION OF THE INVENTION
The invention will now be described in detail in its various preferred and optional embodiments so that various aspects of the invention will be more clearly understood, however, do not limit the scope of the invention.
Geographical origin and Source of the Biological material:
Silk Fibroin (SF) solution is extracted from the Bombyx mori pure bivoltine cocoons sourced from Pappini Amman Silks, Tamilnadu.
Bombyx mori, commonly known as the domestic silk moth, is a moth species belonging to the family Bombycidae. The domestic silk moth was domesticated from the wild silk moth Bombyx mandarina, which has a range from northern India to northern China, Korea, Japan, and the far eastern regions of Russia. The domestic silk moth derives from Chinese rather than Japanese or Korean stock.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood to one of ordinary skill in the art to which this invention pertains.
In an embodiment, the present invention discloses a three-dimensional biocompatible silk fibroin composite matrix for tissue regeneration comprising of one or more layers of
Lyophilized regenerated silk fibroin (LR); and/or
Non-woven mesh of said silk fibroin; and/or
Woven mesh of said silk fibroin.
In another embodiment, the silk fibroin composites of the present invention comprise of;
Lyophilized regenerated silk fibroin (LR) of thickness 1 to 3 mm, grammage of 5-35 mg/cm2 and porosity of > 90-98%; and/or
One or more non-woven mesh/es (NW) with thickness of 0.2 to 3.0mm each, weight of 5-25mg/cm2 and porosity of 70-90%; and/or
One or more woven mesh/es (W2XC), each with a pitch ranging between 1mm-10mm in XY direction and/or layer/s woven at angles ranging from 30 to 60 deg to X and Y direction (XY-CC), thickness of 0.2 to 3.0 mm; grammage of 1-10 mg/cm2 and porosity of 80 - 99%.

Accordingly, the silk fibroin composites of the present invention comprise;
Lyophilized regenerated silk fibroin (LR) of thickness 1 to 3 mm, grammage of 5-35 mg/cm2 and porosity of > 90-98%; and/or
Combination of Woven mesh and silk solution (W2XC-R) wherein the woven mesh has a pitch ranging between 1mm-10mm in XY direction as well as one layer each woven at various angles ranging from 30 to 60 deg to X and Y direction (XY-CC) with the thickness of 1.0 to 3.0mm; weight of 9-12mg/cm2 and porosity of 85-95%;
Combination of Non-woven mesh and silk solution (NW+R) with the thickness of 1.0 - 3.0mm; weight of 18-24mg/cm2 and porosity of 85-95%;
Combination of one woven mesh sandwiched between two non-woven mesh and silk solution (NW-W2XC-NW-R) of thickness 1.0 to 3.0mm, weight of 25-35mg/cm2 and porosity of 75-80%;
Combination of one woven mesh, one non-woven mesh and silk solution (W2XC-NW-R) with a thickness of 1.0 to 3.0mm, grammage of 15-22mg/cm2 and porosity of 85-95%.
In an embodiment, the silk fibroin composite matrix of the present invention possesses suturability and conformability thereby allowing them to be securely sutured and adapt to the surrounding tissue. The silk fibroin composite matrix can be cut to required shape and size during surgical use.
In another embodiment, the present invention discloses a method for preparing the silk fibroin composites comprising;
Extracting the pure silk fibroin by boiling the Bombyx mori pure bivoltine silk hanks in alkaline solution until removal of sericin and obtaining the pure fibroin fibers;
Vacuum drying the pure fibroin fibers of step (i);
Dissolving the dried pure silk fibroin in LiBr followed by dialysis to obtain the silk fibroin solution with 4wt% – 6wt% concentration;
Diluting the solution of step (iii) with DI water to obtain 0.1wt% to 6wt% of silk fibroin (SF);
Converting said silk fibroin (SF) solution of step (iv) to lyophilized SF and using it as is and/or with woven mesh/es and /or with non-woven mesh/es to form a composite as desired.
In another embodiment, the process for preparing the Lyophilized Regenerated Silk Fibroin (LR-S1) comprising;
Freezing the silk fibroin solution (SF) as prepared above in suitable concentration in the mold at a temperature in the range of -10°C to -80°C for 1-24 hours; and
Lyophilizing at -55°C to -80°C for 5-24 hours to obtain the desired product followed by annealing and sterilization before use.

In another embodiment, the process for preparing the non-woven silk mesh (NW-S2) comprising;
Degumming the silk thread to obtain pure silk fibroin fibers as described above and soaking the pure silk fibroin fibers in distilled water for about 4-24 hours and beating to obtain the pulp;
Preparing the non-woven mesh from said pulp using hand sheet former machine and drying followed by annealing and sterilization before use.
In yet another embodiment, the process for preparing the woven silk meshes (W2XC-S3) comprising;
Weaving the continuous monopoly/ multiply silk thread using a pitch (distance between the two silk threads) in the range of 1mm to 10mm to obtain mesh consisting of single layer woven in XY direction and single layer woven in criss-cross direction (at angles ranging from 30 to 60 deg to XY);
Applying the silk fibroin solution (SF) as prepared above in suitable concentration on to the woven mesh for sticking the threads together and drying to obtain the desired product followed by annealing and sterilizing before use.
In another embodiment, the process for preparing the W2XC-R (S4) composite comprising;
Placing the woven silk fibroin mesh (W2XC) in a mold and pouring the silk fibroin solution as prepared above in appropriate concentration on to said woven mesh;
Freezing the composite at a temperature ranging between -10°C to -80°C for 1-24 hours and further freeze drying at -55°C to -80°C for 5-24 hours and sterilizing the W2XC-R composite before use.

In an embodiment the process for preparing the NW+R (S5) composite comprising;
Preparing the non-woven mesh (NW) and silk fibroin (SF) solution as described above;
Placing the silk fibroin non-woven mesh in a mold and pouring the silk fibroin solution of appropriate concentration on to said non-woven mesh;
Freezing the composite at a temperature ranging between -10°C to -80°C for 1-12 hours and further freeze drying at -55°C to -80°C for 5-24 hours and steam sterilizing the NW+R composite before use.

In another embodiment, the process for preparing the NW-W2XC-NW-R (S6) composite comprising;
Preparing two silk fibroin non-woven mesh (NW), woven mesh (W2XC) , and the silk fibroin (SF) solution as described above;
Placing the single woven mesh (W2XC) sandwiched between two non-woven (NW) meshes in a mold and pouring the silk fibroin solution of appropriate concentration;
Freezing the composite at a temperature ranging between -10°C to -80°C for 1-12 hours and further freeze drying at -55°C to -80°C for 5-24 hours followed by annealing and sterilization of the NW-W2XC-NW-R composite before use.

In yet another embodiment, the process for preparing the W2XC-NW-R (S7) composite comprising;
Preparing one silk fibroin woven mesh (W2XC) , a non-woven mesh(NW) and the silk fibroin solution as described above;
Placing the non-woven mesh (NW) in a mold and placing the woven mesh (W2XC) on top of said non-woven mesh (NW) followed by pouring silk fibroin solution of appropriate concentration;
Freezing the composite at a temperature ranging between -10°C to -80°C for 1-12 hours and further freeze drying at -55°C to -80°C for 5-24 hours followed by annealing and sterilizing the W2XC-NW-R composite before use.

In an embodiment, the annealing may be carried using various methods such as water vapor annealing and / or organic solvent exposure (methanol, ethanol) etc.

In another embodiment, the sterilization of the silk composite matrix can be achieved using various methods such as autoclaving (steam sterilization), ethylene oxide (EO) or gamma sterilization.

The water absorption capacity in porous material is generally found to increase with increase in porosity. In the present silk fibroin composites, however, the water absorption capacity was observed to be inversely correlated to the porosities for the composites except for LR and W2XC-NW-R (Fig 1).

In an embodiment, the cellular adhesion assay was evaluated to study the ability of different composite matrices of the present invention to support cell adhesion. Accordingly, mouse fibroblast cell line L929 was used for assay. L929 Cells were seeded on to each type of composite matrix and empty well (Plate control) at a density of 10,000 cells / scaffold. Cells were cultured in DMEM + 10% FBS for 24 hours at 37°C and 5% CO2. Post incubation, media was removed, and matrices were washed gently with 1X PBS and stained with 2% crystal violet solution for 30 min at 37°C. After staining, matrices were washed two times with PBS to remove excess crystal violet. Crystal violet from cells was extracted in 5% SDS and absorbance was measured at 590nm. % cellular adhesion was calculated by following formula.
% cellular adhesion = (Absorbance of Test at 590nm/ Absorbance of plate control at 590nm) *100
Data expressed as % cellular adhesion ± SD.
The woven mesh (W2XC) composite exhibited highest cellular adhesion while the non-woven mesh (NW) showed poor cell adhesion (Fig 2).

In yet another embodiment, the MTT assay was conducted to study the proliferation of fibroblast cells. L929 cells were trypsinized and seeded on all matrices and an empty well without any sample (plate control), at a seeding density of 10,000 cells/well. Cells were then cultured in DMEM with 10% FBS and incubated at 37°C, 5% CO2 for 1, 4 and 7 days with media change at every 48 hours. For MTT assay, media was removed from each well. Matrices were washed with 1X PBS two times. 150 µl of 0.5mg/ml MTT was added to each well. Cells were incubated with MTT for 4 hours at 37°C. After incubation, the MTT solution was discarded, and the crystals were dissolved in 150µl DMSO. Absorbance was measured at 570nm. Data expressed as average absorbance at 570nm ± SD. The woven mesh alone despite having highest cellular adhesion displayed poor proliferation. The proliferation of cells over the time period of 7 days decreases. Non-woven mesh (NW) showed poor cell adhesion and proliferation. The NW-R and NW-W2XC-NW-R though support cellular adhesion does not support cell proliferation. Use of woven mesh along with silk fibroin solution or the combination of woven mesh, non-woven mesh and silk solution resulted in cell proliferation (Fig 3). The trends in cell adhesion and proliferation as observed in the MTT assay were unexpected and not intuitive.

In yet another embodiment, the blood vessel formation and collagen deposition by reverse transcriptase polymerase chain reaction (RT-PCR) was estimated for the silk-based composites of the present invention. Accordingly, total RNA was extracted from L929 cells seeded and cultured on plate control and silk matrices by Trizol method. 500µl Trizol reagent was added to samples and left overnight at 4°C. After overnight incubation, cell lysate was collected in fresh nuclease free tubes. 200µl chloroform was added to the lysate. The suspension was centrifuged at 10,000rpm for 16min at 4°C. Upper aqueous layer was collected in fresh nuclease free tubes and 350µl iso-propanol was added and incubated at room temperature for 15min. After incubation, solution was centrifuged at 10,000rpm for 15min at 4°C. Pellet thus obtained was washed with 70% ethanol, air dried and dissolved in nuclease free water. Concentration of RNA was measured using Nano-drop (ND-1000, UV / Vis spectrophotometer, Nano-drop technologies, USA). cDNA was synthesized from 200ng of total RNA using Verso cDNA synthesis kit according to manufacturer’s instructions. The Ang-1 represents the marker for blood vessel formation and Collagen 1 was used as collagen deposition marker. ß-actin was used as housekeeping gene control. Primers specific for these markers were used for RT-PCR. The silk composite of the present invention displayed at least 1.5 fold increase in blood vessel formation and collagen deposition indicative of better tissue regeneration ability (Fig 4, Fig 5).

In an embodiment, the present invention provides silk fibroin composites as scaffolds for regeneration and/or repair of damaged tissues such as skin, vessels, tendons, cartilage, bone or organs such as for example trachea, oesophagus, liver, breast suitable to be temporarily or permanently interconnected or grafted to the organism.

In yet another embodiment, the present invention provides a method of regenerating and/or repairing the damaged tissues comprising using the silk fibroin composite matrix of the present invention as scaffolds.

Other features and embodiments of the invention will become apparent by the following examples which are given for illustration of the invention rather than limiting its intended scope. Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art.

Experimental:
Materials, Methods and Results:
Materials:
Silk: Bombyx mori silk hanks sourced from Pappini Amman Silks, Tamilnadu.
Collagen Matrix: A commercial collagen matrix, indicated for use in soft tissue regeneration, was used as a comparator in the study. This matrix consists of pure Type 1-collagen derived from an ovine source.
Acellular Dermal Matrix (ADM): ADM is a sterilized sheet of processed porcine dermal matrix and indicated to be used for soft tissue reinforcement.
Cell line: L929 (mouse fibroblast cells) were purchased from (NCCS) (Pune, Maharashtra, India)
Dulbecco’s Minimum Essential Medium (DMEM): HiMedia; Mumbai, India
Fetal Bovine Serum (FBS): Gibco; Grand Island, NY, USA
Phosphate –buffered saline (PBS)
Lithium Bromide (LiBr): Sigma Aldrich
NaHCO3
Trizol reagent: Invitrogen Life Technologies, Carlsbad, CA
cDNA synthesis kit: Thermo-Fischer Scientific, Waltham, MA, USA

Examples: General process for preparation of silk composite matrix
Example 1: Silk fibroin solution preparation
Bombyx mori pure bivoltine silk hanks were boiled in 0.5w/v% of NaHCO3 solution two times for 30 min each for removal of sericin. The silk fibroin fibers were then vacuum dried at 60°C. Dried silk fibroin fibers were the dissolved in 9.3M LiBr at 60°C for at least 4h followed by dialysis against water for 48h to obtained silk solution with 4wt% – 6wt% concentration. This solution was diluted to obtain 0.1wt% to 6wt% solutions by using deionized water (DI).

Example 2: Preparation of Lyophilized Regenerated Silk Fibroin (LR)
5wt% silk solution as prepared in Example 1 was poured in rectangular molds. Silk solution was frozen at temperatures at -80°C. After freezing, the molds were placed in freeze dryer. The samples were freeze dried at -80°C to obtain the product.

Example 3: Preparation of woven mesh (W2XC)
Continuous 3ply silk thread was used for preparation of woven silk mesh. The weaving was performed using pitch (distance between two threads) of 2mm. The mesh consisted of single layer woven on XY direction and single layer woven in criss-cross direction (45 degrees to XY). 5wt% silk solution prepared in Example 1 was applied on the woven mesh for sticking threads together. The mesh was then air dried at room temperature to obtain the product.

Example 4: Preparation of non-woven mesh (NW)
The silk fibroin fibers as prepared in example 1 were soaked in distilled water for overnight. The material was beaten in a valley-beater to obtain a pulp. 450ml pulp was used to make non-woven mesh using hand sheet former machine. The non-woven mesh was dried at room temperature to obtain the product.

Example 5: Preparation of silk composite matrix
The silk fibroin composite matrices were prepared using the single component as described in Examples 1 to 4 or the combination of two or more components as described in Examples 1 to 4. The silk composite matrices are as follows:

S1: Referred to as LR: This composite matrix uses the component as described in Example 2. After freeze drying, the sheet so obtained was then annealed and sterilized using steam sterilization (autoclaving).

S2: Referred to as NW: Non-woven mesh was prepared as described in Example 4. The NW was sterilized using steam sterilization (autoclaving) before use.

S3: Referred to as W2XC: Woven mesh was prepared as described in Example 3. The W2XC was steam sterilized before use.

S4: Referred to as W2XC-R: Woven mesh as described in Example 3 was placed in a mold. 5wt% silk fibroin solution prepared as described in Example 1 was poured on the woven mesh. The entire assembly is frozen at -80°C. The composite was then freeze dried overnight. The composite W2XC-R was then annealed and sterilized using steam sterilization (autoclaving) before use.

S5: Referred to as NW-R: This composite was prepared by using non-woven mesh as described in Example 4 and silk fibroin solution as described in Example 1. The NW is placed in a mold and 5wt% silk solution was poured on the top. The entire assembly was frozen at -80°C, followed by freeze drying overnight. The NW-R composite was then annealed and sterilized using steam sterilization (autoclaving) before use.

S6: Referred to as NW-W2XC-NW-R: This composite was prepared by using the two non-woven meshes as described in Example 4, woven mesh as described in Example 3 and silk fibroin solution as described in Example 1. For preparation of this composite one W2XC is sandwiched between two NW meshes. This is placed in a mold and 5wt% solution was poured on top. The entire assembly is frozen at -80°C followed by overnight freeze drying. The composite NW-W2XC-NW-R was then annealed and sterilized using steam sterilization (autoclaving) before use.

S7: Referred to as W2XC-NW-R: This composite was prepared by using one woven-mesh as described in Example 3, one non-woven mesh as described in Example 4 and silk fibroin solution as described in Example 1. One NW mesh was placed in a mold, W2XC was placed on top of it and 5wt% silk fibroin solution was poured. Entire assembly was frozen at -80°C followed by overnight freeze drying. The composite was then annealed and sterilized using steam sterilization (autoclaving) before use.
S8: Referred to as W2XC-R*: Woven mesh as described in Example 3 was placed in a mold. 5wt% silk fibroin solution prepared as described in Example 1 was poured on the woven mesh. The entire assembly is frozen at -80°C and the composite overnight. The composite W2XC-R was then annealed with organic solvent and sterilized using ethylene oxide sterilization before use.
Example 6: Evaluation of properties of the tissue scaffolding composite matrices
6a: Thickness, grammage and % porosity:
The samples were cut into pieces with dimension of 1cm x 1cm. The thickness of each sample was measured using a Vernier Calliper. The samples were weighed and grammage was calculated.
The grammage was expressed as mg/cm2. Theoretical porosity of was calculated using following formula.
Porosity = (V1-V2) /V1 x 100
where,
V1=length*breadth*height (cm3)
V2=weight in grams/ density of silk (g/cm3)
The density of silk used for calculating porosity was 1.35 g/cm3.
Table 1:
Sample No. Mesh type Thickness (mm) Grammage (mg/cm2) Porosity
(%)
S1 LR 1.03 ± 0.02 12.68 ± 1 94 %
S2 NW 0.33 ± 0.01 10.9 ± 1 77 %
S3 W2XC 0.31 ± 0.03 7.14 ± 1 83 %
S4 W2XC-R 0.91 ± 0.01 10.77 ± 0.54 91 %
S5 NW+R 1.44 ± 0.01 25.98 ± 1 87 %
S6 NW-W2XC-NW-R 1.06 ± 0.01 31.90 ± 1 78 %
S7 W2XC-NW-R 1.64± 0.01 21.30 ± 1 91 %
S8 W2XC-R* 1.34 ± 0.16 12.54 ± 0.97 90 %
* Silk fibroin composite matrix annealed using organic solvent and sterilized using ethylene oxide sterilization.
Observations: Lowest porosity was observed in NW while highest was observed in LR. By changing the combination of NW, Woven and silk fibroin solution varied range of thickness, porosities and mechanical properties can be achieved which can further be applied for hard as well as soft tissue regeneration.
6b: % Water absorption:
Pieces of the samples with dimension of 1cm x 1cm were cut. Initial weight (W1) of the samples was measured. Samples were soaked in excess water for different time points such as 1h, 2h, 4h, 8h and 24h and weight (W2) was measured after each time point was measured. % Water absorption was calculated using following formula.
% Water absorption=(W2-W1)/(W2) X 100
Observations: The water absorption capacity does not correlate with the thickness and porosities except for samples LR and W2XC-NW-R (Fig 1).
6c: Cellular adhesion assay:
Cellular adhesion assay was performed to evaluate the ability of different composite matrices to support cell adhesion. Mouse fibroblast cell line L929 was used for assay. L929 Cells were seeded on to each type of composite matrix and empty well (Plate control) at a density of 10,000 cells / scaffold. Cells were cultured in DMEM + 10% FBS 24h at 37°C and 5% CO2. Post incubation, media was removed and matrices were washed gently with 1X PBS and stained with 2% crystal violet solution for 30 min at 37°C. After staining, matrices were washed two times with PBS to remove excess crystal violet. Crystal violet from cells was extracted in 5% SDS and absorbance was measured at 590nm. % cellular adhesion was calculated by following formula.
% cellular adhesion = (Absorbance of Test at 590nm/ Absorbance of plate control at 590nm) *100
Data expressed as % cellular adhesion ± SD.
Observations: W2XC alone shows highest cellular adhesion while NW alone shows poor cell adhesion (Fig 2). Cell adhesion does not correlate with the thickness, grammage and porosities of the composite matrices.
6d: Estimation of proliferation of fibroblast cells
L929 cells were trypsinized and seeded on all matrices and an empty well without any sample (plate control), at a seeding density of 10,000 cells/well. Cells were then cultured in DMEM with 10% FBS and incubated at 37°C, 5% CO2 for 1, 4 and 7 days with media change at every 48h. Proliferation of cells cultured on different matrices was assessed by MTT assay.
For MTT assay, media was removed from each well. Matrices were washed with 1X PBS two times. 150 µl of 0.5mg/ml MTT was added to each well. Cells were incubated with MTT for 4h at 37°C. After incubation, the MTT solution was discarded and the crystals were dissolved in 150µl DMSO. Absorbance was measured at 570nm. Data expressed as average absorbance at 570nm ± SD.
Observations: Woven mesh alone despite having highest cellular adhesion displays poor proliferation. The proliferation of cells over the time period of 7 days decreases. Non-woven mesh (NW) shows poor cell adhesion and proliferation. The NW-R and NW-W2XC-NW-R though support cellular adhesion does not support cell proliferation. Use of woven mesh along with silk fibroin solution or the combination of woven mesh, non-woven mesh and silk fibroin solution results in cell proliferation (Fig 3).
6e: Estimation of blood vessel formation and collagen deposition by reverse transcriptase polymerase chain reaction (RT-PCR).
Total RNA was extracted from L929 cells seeded and cultured on plate control and silk fibroin composite matrices by Trizol method. 500µl TRIzol reagent was added to samples and left overnight at 4°C. After overnight incubation, cell lysate was collected in fresh nuclease free tubes. 200µl chloroform was added to the lysate. The suspension was centrifuged at 10,000rpm for 16min at 4°C. Upper aqueous layer was collected in fresh nuclease free tubes and 350µl iso-propanol was added and incubated at room temperature for 15 min. After incubation, solution was centrifuged at 10,000rpm for 15min at 4°C. Pellet thus obtained was washed with 70% ethanol, air dried and dissolved in nuclease free water. Concentration of RNA was measured using Nano-drop (ND-1000, UV / Vis spectrophotometer, Nano-drop technologies, USA). cDNA was synthesized from 200ng of total RNA using Verso cDNA synthesis kit according to manufacturer’s instructions. The Ang-1 represents the marker for blood vessel formation and Collagen 1 was used as collagen deposition marker. ß-actin was used as housekeeping gene control. Primers specific for these markers were used for RT-PCR.
Gene name Primer sequence Annealing Temperature Amplicon size
Ang-1 F: 5’AGGAGGCTGGTGGTTTGAC3’
R: 5’CATTGGTGTCTCTCAGTGCC3’ 60°C 328 bp
Collagen F: 5’CACCCCAGCGAAGAACTCATA3’
R:5’GCCACCATTGATAGTCTCTCCTAAC3 60°C 189 bp
ß-actin F: 5’TGGAATCCTGTGGCATCC A 3’
R: 5’ TAACAGTCCGCCTAGAAGCA 3’ 60°C 315 bp

The PCR ((Eppendorf Master cycler, realplex 2, ep gradient S) conditions used for 30 cycles of amplification were as follows:
Temperature Time Number of cycles
95°C 3 min 1
95°C 30sec 30 cycles
60°C 45sec
72°C 1min
72°C 3min
4°C 8
PCR products were resolved on 1.2% agarose gel and visualized using SYBR gold nucleic acid gel stain (Invitrogen) on Bio-Rad, Molecular Imager, ChemiDox™ XRS+ imaging system. ß-actin was used as housekeeping gene control. Bands were observed and documented using Gel documentation system. Band intensity was then analysed using Image J software. Values were normalized using ß-actin (housekeeping gene control).
Observations: Silk fibroin composite displayed at least 1.5-fold increase in blood vessel formation and collagen deposition indicative of better tissue regeneration ability (Fig 4 and Fig 5).
6f: Estimation of suture retention ability of the silk fibroin composite matrices:
Silk composite matrices were cut to with dimensions 2cm (length) X 1cm (width). Suture thread was passed through centre and knot was tied to the silk fibroin composite. The samples were clamped at the edge located opposite to the suture. Suture loop was pulled at a rate 0.05mm/s. Maximum load taken was calculated and expressed in newton (N) (ISO7198).
Observations: Silk fibroin composite displayed comparable suturability to that of collagen matrix. Suturability of the silk fibroin composite matrix annealed using organic solvent and sterilized using ethylene oxide was comparable with ADM and displayed 1.5-fold increase in suture retention ability (Fig 6).
Although the invention has been described in detail in the foregoing for the purpose of illustration, it is to be understood that such detail is solely for that purpose and that variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention except as it may be limited by the claims.
,CLAIMS:1. A biocompatible silk fibroin composite matrix for tissue regeneration comprising;
i. Lyophilized Regenerated Silk Fibroin; and/or
ii. One or more non-woven mesh of said silk fibroin; and/or
iii. One or more woven mesh of said silk fibroin.

2. The silk fibroin composite as claimed in claim 1, wherein the composites comprises of;
i. Lyophilized regenerated silk fibroin (LR) of thickness 1 to 3 mm, grammage of 5-35 mg/cm2 and porosity of > 90-98%; and/or
ii. One or more non-woven mesh/es (NW) with thickness of 0.2 to 3.0mm each, weight of 5-25mg/cm2 and porosity of 70-90%; and/or
iii. One or more woven mesh/es (W2XC), each with a pitch ranging between 1mm-10mm in XY direction and/or layer/s woven at angles ranging from 30 to 60 deg to X and Y direction (XY-CC), thickness of 0.2 to 3.0 mm; grammage of 1-10 mg/cm2 and porosity of 80 - 99%.

3. The silk fibroin composite as claimed in claim 1, wherein said silk fibroin composite is three dimensional.

4. The silk fibroin composite as claimed in claim 1, wherein said silk fibroin composite is prepared by the process comprising;
i. Preparing the silk fibroin solution by boiling the Bombyx mori pure bivoltine silk hanks in alkaline solution until removal of sericin and obtaining the pure fibroin fibres;
ii. Vacuum drying the pure fibroin fibres of step (i);
iii. Dissolving the dried silk fibroin in LiBr followed by dialysis to obtain the silk fibroin solution with 4wt% – 6wt% concentration;
iv. Diluting the solution of step (iii) with DI water to obtain 0.1wt% to 6wt% of silk fibroin (SF);
v. Converting said regenerated silk fibroin solution of step (iv) to lyophilized and/or woven mesh and /or non-woven mesh composites as desired.
5. The process for preparing the Lyophilized Regenerated Silk Fibroin (LR-S1) composite comprising;
i. Freezing the regenerated silk fibroin solution (SF) obtained in claim 4 in appropriate concentration in the mold at a temperature in the range of -10°C to -80°C for 1-24 hours; and
ii. Lyophilizing at -55°C to -80°C for 5-24 hours to obtain LR-S1 followed by annealing and sterilization using steam sterilization before use.

6. The process for preparing the non-woven silk fibroin mesh (NW-S2) composite comprising;
i. Using the pure silk fibroin fibres obtained in claim 4 and soaking the silk fibroin fibres in distilled water for 4-24 hours and beating to obtain the pulp; and
ii. Preparing the non-woven mesh from said pulp using hand sheet former machine and drying to obtain NW-S2 followed by steam sterilization before use.

7. The process for preparing the woven silk fibroin meshes (W2XC-S3) composite comprising;
i. Weaving the continuous monopoly/ multiply silk fibroin thread using a pitch in the range of 1mm to 10mm to obtain mesh consisting of single layer woven in XY direction and single layer woven in criss-cross direction (at angles ranging from 30 to 60 deg to XY); and
ii. Applying silk fibroin solution (SF) obtained in claim 4 in appropriate concentration on to the woven mesh for sticking the threads together and drying to obtain W2XC-S3 followed by annealing and sterilization using steam (autoclaving) before use.

8. The process for preparing the W2XC-R (S4) composite comprising;
i. Placing the woven silk fibroin mesh (W2XC) in a mold and pouring silk fibroin solution obtained in claim 4 on to said woven mesh; and
ii. Freezing the composite at a temperature ranging between -10°C to -80°C for 1-24 hours and further freeze drying at -55°C to -80°C for 5-24 hours to obtain the W2XC-R composite followed by annealing and sterilization using steam (autoclaving) before use.

9. The process for preparing the NW+R (S5) composite comprising;
i. Preparing the silk fibroin non-woven mesh (NW);
ii. Placing the silk fibroin non-woven mesh of step (i) in a mold and pouring the silk fibroin solution obtained in claim 4 in appropriate concentration on to said non-woven mesh; and
iii. Freezing the composite at a temperature ranging between -10°C to -80°C for 1-12 hours and further freeze drying at -55°C to -80°C for 5-24 hours and sterilizing the NW+R composite before use.

10. The process for preparing the NW-W2XC-NW-R (S6) composite comprising;
i. Preparing two silk fibroin non-woven mesh (NW), woven mesh (W2XC), and the silk fibroin (SF) solution;
ii. Placing the single woven mesh (W2XC) sandwiched between two non-woven (NW) meshes in a mold and pouring the silk fibroin solution obtained in claim 4 in appropriate concentration;
iii. Freezing the composite at a temperature ranging between -10°C to -80°C for 1-12 hours and further freeze drying at -55°C to -80°C for 5-24 hours and steam sterilizing the NW-W2XC-NW-R composite before use.

11. The process for preparing the W2XC-NW-R (S7) composite comprising;
i. Preparing one silk fibroin woven mesh (W2XC), a non-woven mesh(NW) and the silk fibroin solution;
ii. Placing the non-woven mesh (NW) in a mold and placing the woven mesh (W2XC) on top of said non-woven mesh (NW) followed by pouring silk fibroin solution obtained in claim 4 in appropriate concentration; and
iii. Freezing the composite at a temperature ranging between -10°C to -80°C for 1-12 hours and further freeze drying at -55°C to -80°C for 5-24 hours and annealing and sterilizing the W2XC-NW-R composite by steam sterilization before use.

12. Use of the silk fibroin composites as claimed in any one of the preceding claims 1-11 as scaffolds for regeneration and / or repair of damaged tissues such as skin, vessels, tendons, cartilage, bone or organs temporarily or permanently interconnected or grafted to the organism.

13. A method of regenerating and/or repairing the damaged tissues comprising using the silk fibroin composite matrix as claimed in any one of the preceding claims 1-11 as scaffolds

Documents

Application Documents

# Name Date
1 202321089314-STATEMENT OF UNDERTAKING (FORM 3) [28-12-2023(online)].pdf 2023-12-28
2 202321089314-PROVISIONAL SPECIFICATION [28-12-2023(online)].pdf 2023-12-28
3 202321089314-POWER OF AUTHORITY [28-12-2023(online)].pdf 2023-12-28
4 202321089314-FORM FOR STARTUP [28-12-2023(online)].pdf 2023-12-28
5 202321089314-FORM FOR SMALL ENTITY(FORM-28) [28-12-2023(online)].pdf 2023-12-28
6 202321089314-FORM 1 [28-12-2023(online)].pdf 2023-12-28
7 202321089314-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [28-12-2023(online)].pdf 2023-12-28
8 202321089314-EVIDENCE FOR REGISTRATION UNDER SSI [28-12-2023(online)].pdf 2023-12-28
9 202321089314-DRAWINGS [28-12-2023(online)].pdf 2023-12-28
10 202321089314-Proof of Right [16-01-2024(online)].pdf 2024-01-16
11 202321089314-FORM-5 [26-12-2024(online)].pdf 2024-12-26
12 202321089314-DRAWING [26-12-2024(online)].pdf 2024-12-26
13 202321089314-COMPLETE SPECIFICATION [26-12-2024(online)].pdf 2024-12-26
14 202321089314-FORM 3 [08-01-2025(online)].pdf 2025-01-08
15 202321089314-Request Letter-Correspondence [15-01-2025(online)].pdf 2025-01-15
16 202321089314-Power of Attorney [15-01-2025(online)].pdf 2025-01-15
17 202321089314-FORM28 [15-01-2025(online)].pdf 2025-01-15
18 202321089314-Form 1 (Submitted on date of filing) [15-01-2025(online)].pdf 2025-01-15
19 202321089314-Covering Letter [15-01-2025(online)].pdf 2025-01-15
20 202321089314-CERTIFIED COPIES TRANSMISSION TO IB [15-01-2025(online)].pdf 2025-01-15
21 202321089314-FORM-8 [08-05-2025(online)].pdf 2025-05-08
22 202321089314-FORM-9 [21-06-2025(online)].pdf 2025-06-21
23 202321089314-STARTUP [23-06-2025(online)].pdf 2025-06-23
24 202321089314-FORM28 [23-06-2025(online)].pdf 2025-06-23
25 202321089314-FORM 18A [23-06-2025(online)].pdf 2025-06-23