Sign In to Follow Application
View All Documents & Correspondence

A Novel And Improved Selective Media For The Isolation And Enumeration Of Klebsiella Species

Abstract: A NOVEL AND IMPROVED SELECTIVE MEDIA FOR THE ISOLATION AND ENUMERATION OF KLEBSIELLA SPECIES ABSTRACT OF THE DISCLOSURE The invention discloses a Klebsiella blue agar (KBA)medium(100)for selective enumeration and differential detection of Klebsiella pneumoniae species complex (KpSC complex), which selectively promotes the growth of the KpSC and also differentiates between the species belonging to KpSC group and other genetically distant species of Klebsiella.The media (100) comprises a mixture of nutrients, a selective components and a differential components. The present invention also provides a method (200) for preparation of the media (100).The proposed media shows higher selectivity and differentiating ability than HiCrome™ Klebsiella Selective Agar Base (KSA).Hence owing to its readily available components, the medium can be easily formulated and rampantly used in laboratories. FIG. 1A.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
14 November 2023
Publication Number
48/2024
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

AMRITA VISHWA VIDYAPEETHAM
Amrita School of Biotechnology Amritapuri, Clappana PO, Kollam 690 525, Kerala, India

Inventors

1. PRASAD, Megha
Amrita School of Biotechnology Amritapuri, Clappana PO, Kollam 690 525, Kerala, India
2. MADHAVAN, Ajith
Amrita School of Biotechnology Amritapuri, Clappana PO, Kollam 690 525, Kerala, India
3. PAL, Sanjay
Amrita School of Biotechnology Amritapuri, Clappana PO, Kollam 690 525, Kerala, India
4. SHETTY, Sindhu K.
Amrita School of Biotechnology Amritapuri, Clappana PO, Kollam 690 525, Kerala, India
5. NAIR, Bipin G
Amrita School of Biotechnology Amritapuri, Clappana PO, Kollam 690 525, Kerala, India

Claims

1. A Klebsiella blue agar (KBA) media (100) for selective enumeration and differential detection of Klebsiella pneumoniae speciescomplex (KpSC complex), the media comprising: a carbon source; a selective agents comprising an indicating agent, a nitrogen source and a bile salt and a differential agent.

2. The media (100) as claimed in claim 1, wherein the carbon source is glycerol present at a concentration of 0.2%v/v.

3. The media (100) as claimed in claim 1, wherein the indicating agent is methylene blue present at a concentration of 0.064 g/L, the nitrogen source is tryptophan present at a concentration of 1g/L to 3g/Land the bile salt present at a concentration of 1.5 g/L.

4. The media (100) as claimed in claim 1, wherein the differential agent is sodium chloride present at a concentration of 0.1% to 0.6%.

5. The media (100) as claimed in claim 1, wherein the optimum concentration of glycerol is 0.2%v/v , methylene blue is 0.064g/L, tryptophan is 2g/L and bile salt is 1.5g/L.

6. The media (100) as claimed in claim 1, wherein the optimum concentration of sodium chloride is 0.6%.

7. The media (100) as claimed in claim 1, comprising potassium dihydrogen phosphate, dipotassium phosphate as inorganic salts, magnesium sulphate heptahydrate as micronutrient and agar as gelling agent.

8. The media (100) as claimed in claim 1, wherein the selective agents are configured to inhibit the growth of other Klebsiella cohorts, or other gram-positive and gram-negative bacteria.

9. The media (100) as claimed in claim 1, wherein the differential agent is configured to impart green sheen to the KpSC complex to differentiate the same from other Klebsiella cohorts, gram-positive and gram-negative bacteria.

10. The media (100) as claimed in claim 1 wherein the pH of the media is controlled in the range 7.20±0.2.

11. A method (200) for preparing Klebsiella blue agar (KBA) media for selective growth and differential detection of Klebsiella pneumoniae speciescomplex (KpSC complex), the method comprising: preparing (201)a first solution by dissolving 3 grams of potassium dihydrogen phosphate, 6 grams of dipotassium phosphate, 0.1% to 0.6% of sodium chloride and 0.064 g/L of methylene blue in one litre of sterile water; Preparing (202) a second solution by dissolving 100 mg of magnesium sulphate heptahydrate and 17 g of agar in one litre of sterile water; autoclaving (203) the first solution and the second solution separately at 121 °C for 20 min; adding (204)separately sterilised 1.5 g/Lof bile salt, 1g/L to 3g/L of tryptophan, and 0.2%v/v of glycerolto the cooled first solution; mixing(205) the first solution and the second solution to a final solution of 1000ml; pouring(206 ) the final solution onto sterile petri dishes to form the KBA media. (Dr. V. SHANKAR IN/PA-1733) For and on behalf of the Applicants

Specification

DESC:FORM 2
THE PATENT ACT, 1970
(39 of 1970)
COMPLETESPECIFICATION
(See section 10, rule 13)

TITLE: A NOVEL AND IMPROVED SELECTIVE MEDIA FOR THE ISOLATION AND ENUMERATION OF KLEBSIELLA SPECIES

PRASAD, Megha - Citizen of India
MADHAVAN, Ajith - Citizen of India
PAL, Sanjay - Citizen of India
SHETTY, Sindhu K. - Citizen of India
NAIR, Bipin G - US Citizen
Amrita School of Biotechnology
Amritapuri, Clappana PO
Kollam 690 525, Kerala, India

APPLICANT
Amrita Vishwa Vidyapeetham
Amrita School of Biotechnology
Amritapuri, Clappana PO
Kollam 690 525, Kerala, India

THE FOLLOWING SPECIFICATION PARTICULARLY DESCRIBES THE INVENTION AND THE MANNER IN WHICH IT IS TO BE PERFORMED

A NOVEL AND IMPROVED SELECTIVE MEDIA FOR THE ISOLATION AND ENUMERATION OF KLEBSIELLA SPECIES
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application is a complete specification of provisional patent application no. 202341077515 entitled A NOVEL AND IMPROVED SELECTIVE MEDIA FOR THE ISOLATION AND ENUMERATION OF KLEBSIELLA SPECIESfiled on 14 November, 2023.
FIELD OF THE INVENTION
[0002] The invention generally relates to microbiological media to assess bacterial pathogens' prevalence in routine wastewater surveillance. More specifically, the disclosure relates to a differential and selective media for Klebsiellaspecies.
DESCRIPTION OF THE RELATED ART
[0003] Klebsiella genus, a class of gram-negative, encapsulated, non-motile bacteria belonging to the Enterobacteriaceae family has been fast gaining attention as this genus has been linked to a high percentage of hospital-acquired infections, and most antibiotics are often ineffective against them. Klebsiella spp. is grouped into cohorts, namely Klebsiella pneumoniae species complex (herein after ‘KpSC’), which includes Klebsiella pneumoniae, Klebsiellaquasipneumoniae, and Klebsiella variicola, while Klebsiella oxytoca, Klebsiella indica, and Klebsiella terrigena into another genetically distinct group.
[0004] The KpSC group of bacteria is responsible for most nosocomial and community-acquired pneumonia, urinary tract, and bloodstream infections associated with Klebsiella species in healthcare-associated settings.These bacteria can thrive in various niches, including plants, animals, and waterbodies.They have an uncanny ability to exchange their plasmid with other species. This property and high genomic plasticity make these species a reservoir of virulence and antimicrobial resistance genes. The World Health Organisation in 2017 declared the extended-spectrum ß-lactam (ESBL) - producing and carbapenemase-producing Klebsiella species, a latent threat to public health due to its ability to accumulate multidrug resistance (MDR) and hypervirulence, especially in wastewater which is a hotbed for acquiring and disseminating MDR genes. Understandingthe emergence and spread of these antibiotic-resistant bacterial strains in the environment requires wastewater-based epidemiological monitoring and surveillance system.
[0005] Culture-based methodologies are primarily used for the monitoring process,which centres on selective and differential media use. Currently, different selective culture media suchas MacConkey agar supplemented with ceftazidime, Klebsiella ChromoSelect Selective Agar Base, Simmons citrate agar (SCA) with 1% inositol, and HiCrome™ Klebsiella Selective Agar Base are used. However, owing to their prohibitive cost, formulation complexity, and indistinguishable nature towards Klebsiella pneumoniae species complex (KpSC) and other Klebsiella strains, these media are not extensively used for routine surveillance of wastewater.
[0006] Therefore,a medium for selective isolation, enumeration and differentiation of KpSC that overcomes the drawbacks of the prior art is required.
SUMMARY OF THE INVENTION
[0007] In various embodiments,a Klebsiella blue agar (KBA) media (100) for selective enumeration and differential detection of Klebsiella pneumoniae species complex (KpSC complex) is disclosed. The media (100) comprises a carbon source, a selective agent comprising an indicating agent, a nitrogen source, bile salt and a differential agent.
[0008] In various embodiments, the media (100) comprises glycerol as the carbon source present at a concentration of 0.2% v/v.
[0009] In various embodiments, theindicating agent in the media (100) is methylene bluewhich is present at a concentration of0.064g/L, the nitrogen source is tryptophan present at a concentration of 1 g/L to 3 g/Land the bile salt in the media (100) is present at a concentration of 1.5 g/L.
[0010] In various embodiments, the differential agent in the media (100) is sodium chloride which is present at a concentration of 0.1% to 0.6%.
[0011] In various embodiments, the optimum concentration of glycerol is 0.2%v/v, methylene blue is 0.064g/L, tryptophan is 2g/L and bile salt is 1.5g/L and sodium chloride present at a concentration of 0.6%.
[0012] In various embodiments, the media (100) further comprises potassium dihydrogen phosphate, dipotassium phosphate as inorganic salts, magnesium sulphate heptahydrate as a micronutrient and agar as a gelling agent.
[0013] In various embodiments, the selective agents in the media (100) are configured to inhibit the growth of other Klebsiella cohorts, or other gram-positive and gram-negative bacteria.
[0014] In various embodiments, the differential agent in the media (100) is configured to impart green sheen to the KpSC complex to differentiate the same from other Klebsiella cohorts, gram-positive and gram-negative bacteria.
[0015] In various embodiments, the pH of the media (100) is controlled in the range 7.20±0.2.
[0016] In various embodiments, a method (200) for preparing Klebsiella blue agar (KBA) media for selective growth and differential detection of Klebsiella pneumoniae species complex (KpSC complex) is disclosed. The method(200) comprising preparing (201) a first solution by dissolving 3 g of potassium dihydrogen phosphate, 6 g of dipotassium phosphate, 6 g of sodium chloride and 64 mg methylene blue in one litre of sterile water, preparing (202) a second solution by dissolving 100 mg of magnesium sulphate heptahydrate and 17 g of agar in one litre of sterile water, autoclaving (203) the first solution and the second solution separately at 121 °C for 20 min, adding (204) separately sterilised 1.5 g/L of bile salt, 2 g/L of tryptophan, and 0.2%v/v of glycerol to the cooled first solution, mixing (205) the first solution and the second solution to a final solution of 1000ml and pouring (206 ) the final solution onto sterile petri dishes to form the KBA media.

BRIEF DESCRIPTION OF THE DRAWINGS
[0017] The invention has other advantages and features which will be more readily apparent from the following detailed description of the invention and the appended claims, when taken in conjunction with the accompanying drawings, in which:
[0018] FIG. 1A: a micrographical schematic representation of comparative selectivity and differentiality of KBA media (left plot) and KSA media (right plot)on KpSC complex(A to L) and other gram-negative and positive bacteria(M to W).
[0019] FIG. 1B: a photograph of the selective growth profile of Klebsiella pneumoniae complex on (a) KBA media and (b) KSA media.
[0020] FIG. 1C: a photograph of the differential growth profile of Pseudomonas fluorescens and Klebsiellaaerogenes on KBA media.
[0021] FIG. 2: a flow diagram of a method for preparing Klebsiella blue agar (KBA) media
[0022] FIG. 3A: a photograph shows the bacterial growth profile on LB, KBA, and KSA corresponding to the KpSC complex.
[0023] FIG. 3B: a photograph shows bacterial growth profile on LB, KBA, and KSA corresponding to gram-negative bacterial strains.
[0024] FIG. 3C: a photograph shows bacterial growth profile on LB, KBA, and KSA corresponding to gram-negative bacterial strains.
[0025] FIG. 3D: a photograph shows bacterial growth profile on LB, KBA, and KSA corresponding to gram-positive bacterial strains.
[0026] FIG. 4A: shows selective isolation of Klebsiella spp. on LB, KBA and KSA from a heterogenous population in synthetic sewage.
[0027] FIG.4B: shows replica plating for analyzing the selective nature of KBA
[0028] FIG.5: image showing Multiplex PCR amplification.
[0029] FIG.6A: image showing optimized concentration for sodium chloride.
[0030] FIG.6B: image showing optimized concentration for tryptophan.

DETAILED DESCRIPTION OF THE EMBODIMENTS
[0031] While the invention has been disclosed with reference to certain embodiments, it will be understood by those skilled in the art that various changes may be made, and equivalents may be substituted without departing from the scope of the invention. In addition, many modifications may be made to adapt to a particular situation or material to the teachings of the invention without departing from its scope.
[0032] Throughout the specification and claims, the following terms take the meanings explicitly associated herein unless the context clearly dictates otherwise. The meaning of "a", "an", and "the" include plural references. The meaning of "in" includes "in" and "on." Referring to the drawings, like numbers indicate like parts throughout the views. Additionally, a reference to the singular includes a reference to the plural unless otherwise stated or inconsistent with the disclosure herein.
[0033] Definitions: Throughout this specification “KpSC” means Klebsiella pneumoniae species complex includes Klebsiella pneumoniae, Klebsiella quasipneumoniae, and Klebsiella variicola, “KBA” means Klebsiella blue agar ,“KSA”means HiCrome™ Klebsiella Selective Agar Base and “LB” means Luria Bertani broth.
[0034] The present subject matter discloses a novel Klebsiella blue agar (KBA) medium which selectively promotes the growth ofKlebsiella pneumoniae species complex and also differentiates between the species belonging to KpSC group and other genetically distant species of Klebsiellaas further disclosed with reference to the drawings.The proposed composition iscost-effective and also well-defined, without any complex mixture, containing only methylene blue, tryptophan, NaCl and bile salt as the selective and differential components. The present invention also provides a method for the preparation of the media.
[0035] A micrographical representation of selectivity and diferentiativity of media is illustrated in FIG. 1A,1B and 1C, according to one embodiment of the present subject matter.In various embodiments, aKlebsiella blue agar (KBA) media 100for selective enumeration and differential detection of Klebsiella pneumoniae species complex (KpSC) is disclosed. The media 100comprises a carbon source such as glycerol at a concentration 0.2 %. The carbon source is solely fermented by the KpSC to obtain energy.
[0036] In various embodiment, the media 100 further comprises selective agents are configured to inhibit growth of other Klebsiella cohorts, or other gram-positive and gram-negative bacteria and promote the growth of the KpSC. The selective agent comprises an indicating agent, a nitrogen source and a bile salt.
[0037] In various embodiment, the media 100 comprises an indicating agent such as methylene blue at a concentration of 0.064 g/L, a nitrogen source such as tryptophan at a concentration of 2 g/L and a bile salt at a concentration of 1.5 g/L.
[0038] In various embodiment, the media 100further comprises a differential agent configured to impart green sheen to KpSC complex by precipitating the dye onto the growing surface of bacteria. Thereby differentiating the KpSc from other Klebsiella cohorts, gram-positive and gram-negative bacteria. The differentiated colour tonalities of bacteria colonies are easily distinguished by the naked eye.
[0039] In various embodiments, the differential agent includes sodium chloride present at a concentration of 6 g/L are used.
[0040] In one embodiment, the media 100comprises potassium dihydrogen phosphate at a concentration of3 g/L and dipotassium phosphate at a concentration of6 g/L, both serving as an inorganic salt.
[0041] In one embodiment, the media 100magnesium sulphate heptahydrate at a concentration of 0.100 g/L, serving as micronutrient and 17 grams by weight of agar serving as gelling agent.
[0042] In various embodiments, the optimum concentration of glycerol is 0.2%v/v, methylene blue is 0.064g/L, tryptophan is 2g/L and bile salt is 1.5g/L and sodium chloride present at a concentration of 0.6 g/L.
[0043] In another embodiment, the media 100is highly selective for the KpSC and hence, used for selective enumeration, differential detection, isolation and identification of KpSC obtained from pure culture and even when the KpSC are present in mixed sample in defined combinations. The below TABLE.1 depicts the media100 components and the role of each component:
TABLE. 1: Media Components and Their Role
Media component Role
Glycerol Fermentable carbon and energy source
Tryptophan Promotes growth of KpSC and nitrogen source
NaCl Differentiating and osmolarity agent
Bile salt Stimulates gram-negative bacteria, inhibits gram-positive bacteria
Methylene blue Inhibits growth of gram-positive bacteria
Potassium dihydrogen phosphateand dipotassium phosphate Buffering agents
Magnesium sulphate Micronutrient

[0044] In various embodiments, the pH of the media100 is controlled in the range 7.20±0.2 and the pronounced growth of KpSC was observed after 16 ± 2 h of incubation at 37 °C.
[0045] In various embodiments, the KpSC shows a well-defined growth in KBA media and the media (100) is completely selective against selected gram-positive bacteria (Bacillus spp., Staphylococcus aureus) and a few gram-negative bacteria (Acinetobacter baumanii, Serratiamarcescens).
[0046] In various embodiments, the media100 shows higher selectivity and differentiating ability than the conventional HiCrome™ Klebsiella Selective Agar Base (KSA) by promoting only 157 CFUs against 209 CFUs in KSA when stamped with 253 CFUs grown on LB. The colonies so isolated arepredominantly Klebsiella spp., on identification through colony polymerase chain reaction.
[0047] In various embodiments, a method 200 for preparing Klebsiella blue agar (KBA) media for selective growth and differential detection of Klebsiella pneumoniae species complex (KpSC complex) is disclosed.A flow diagram of a method of preparing Klebsiella blue agar 100for selective growth and differential detection of Klebsiella pneumoniae species complex (KpSC complex)is illustrated in FIG. 2, according to one embodiment of the present subject matter. The method in step 201 includes preparing a first solution by dissolving 3 g of potassium dihydrogen phosphate, 6 g of dipotassium phosphate, 6 g of sodium chloride and 64 mg methylene blue in 200ml of distilled water. Step 202 includes dissolving 100 mg of magnesium sulphate heptahydrate and 17 g of agar in 720 ml of distilled water. In various embodiments, step 203 includes autoclaving the first solution and the second solution separately at 121 °C for 20 min. Step 204 includes adding separately sterilised solution of 37.5ml containing bile salt in theconcentration of 1.5 grams per litre, 40ml of solution containing tryptophan in the concentration of 2 grams per litre and 2.5ml of 0.2%v/v glycerol to the cooled first solution. Step 205 includes mixing the first solution and the second solution to make a final solution of1000ml. Finally, step 206 includes pouring the final solution onto sterile petri dishes to form the KBA media.
[0048] The KBA media 100 composition is cost-effective and also well-defined without any complex mixture, containing only methylene blue, tryptophan, NaCl and bile salt as the selective and differential components. Hence owing to its readily available components, the medium can be easily formulated and rampantly used in laboratories.Moreover, due to its ease of formulation, high selectivity, differential nature, and cost-effective composition, KBA is a viable option for the routine culture of Klebsiella spp. in environmental and clinical settings.
EXAMPLES
[0049] EXAMPLE 1: PREPARATION OF KBA CULTURE MEDIA
[0050] Klebsiella blue agar (KBA) medium which selectively promotes the growth of KpSC and also differentiates between the species belonging to KpSC group and other genetically distant species of Klebsiella and other gram-negative and gram-positive strains. is shown in FIG. 1A, 1B and 1C.
[0051] Chemicals required: potassium dihydrogen phosphate (Sisco Research Laboratories Pvt. Ltd.), dipotassium phosphate (EMPLURA, Merck Life Science Pvt. Ltd.), sodium chloride (Sigma Aldrich), methylene blue (SpectroChemPvt. Ltd), magnesium sulphate heptahydrate (MERCK Specialties Pvt. Ltd.), magnesium sulphate heptahydrate (MERCK Specialties Pvt. Ltd.) and agaragar (Hi Media Laboratories Pvt. Ltd.).
[0052] Procedure:The step-wise procedure for KBA media synthesis is shown in FIG. 2.Dissolve3 g/L potassium dihydrogen phosphate, 6 g/L dipotassium phosphate, 6 g/L sodium chloride, 0.064g/L methylene blue in 200ml of distilled water to get first solution. Dissolve 0.100g/L magnesium sulphate heptahydrate and 17 g/L agar in 720 ml of distilled water to get second solution. Autoclave first solution and second solutionat 121 °C for 20 min. Cool down the solutions to 60°C. On cooling, add 37.5 ml of solution containing 40 mg/mLof filter-sterilised bile salt, then add 40 ml of solution containing 50mg/mLof tryptophan and then add 2.5ml of 0.2 %v/v of glycerol to solution A.Mix the solution A into the flask containing solution B to make final solution containing 1 L of media. Mix all the final solutions properly and then pour them onto sterile petri plates to constitute Klebsiella blue agar (KBA) medium.TABLE.2 shows the composition of the media of the present invention.
TABLE2: COMPOSITION OF KBA MEDIA
Sl.No Ingredient Quantity(g/L)
1. Glycerol 2.5ml
2. Potassium dihydrogen phosphate 3 g/L
3. Dipotassium phosphate 6 g/L
4. Sodium chloride 6 g/L
5. Magnesium sulphate heptahydrate 0.100g/L
6. Methylene blue 0.064g/L
7. Bile salt 1.5 g/L
8. Tryptophan 2 g/L
9. Agar 17 g/L
[0053] Bacterial cultures: Multidrug-resistant (MDR) clinical strains of Klebsiella pneumoniae K2, Klebsiella pneumoniae K3, Klebsiella pneumoniae K4, Klebsiella pneumoniae K5, Klebsiella pneumoniae U4677, Klebsiella pneumoniae U4698, Klebsiella pneumoniae U4865, and Klebsiella pneumoniae OF9168 were gifted by Dr Anil Kumar, Head of the department, Department of Microbiology, School of Medicine, Amrita Vishwa Vidyapeetham, Kerala, India. The clinical strains of Shigelladysenteriae, Salmonella enterica, Klebsiella quasipneumoniae, and Vibrio cholerae were gifted by Dr Bhabatosh Das, Associate Professor, Translational Health Science and Technology Institute, Delhi, India. Acinetobacter baumannii (MTCC 1425), Klebsiella pneumoniae (MTCC 3384), Pseudomonas fluorescens (MTCC 1749), and Serratiamarcescens (MTCC 97) were procured from the Microbial Type Culture Collection and Gene Bank, Chandigarh, India. The laboratory strains of Proteus vulgaris, Staphylococcus aureus, and Klebsiella aerogenes were obtained from the Academic Laboratory of the School of Biotechnology, Amrita Vishwa Vidyapeetham, Kerala, India. The isolates of Bacillus spp. and Pseudomonas putida were isolated from soil, while Escherichia coli sequence type 155 (Salim et al. 2019) and Klebsiella variicola (Subhash et al. 2022) were isolated from sewage at the Sanitation Biotechnology Lab, School of Biotechnology, Amrita Vishwa Vidyapeetham, Kerala, India. All the bacterial strains were maintained in Luria–Bertani (LB) at 37 °C. In broth cultures, bacterial strains were grown in LB broth at 37 °C with 200 rpm.
[0054] Assessment of Growth characteristics of bacterial strains:To assess the growthcharacteristics, respective cultures of Klebsiella spp., gram-negative and gram-positive were streaked on the KBA media, KSA media and LB broth.
[0055] The below TABLE.3 shows various microbial stains and their corresponding notations used in FIG. 1A.
Table 3: Microbial Strains Used in the Examples
Notation Microbial strain Type
A Klebsiella pneumoniae (MTCC 3384); Klebsiella pneumoniae species complex
B Klebsiella pneumonia K2 Klebsiella pneumoniae species complex
C Klebsiella pneumoniae K3 Klebsiella pneumoniae species complex
D Klebsiella pneumoniae K4 Klebsiella pneumoniae species complex
E Klebsiella pneumoniae K5 Klebsiella pneumoniae species complex
F Klebsiella pneumoniae U4677 Klebsiella pneumoniae species complex
G Klebsiella pneumoniae U4698 Klebsiella pneumoniae species complex
H Klebsiella pneumoniae U4865 Klebsiella pneumoniae species complex
I Klebsiella pneumoniae OF9168 Klebsiella pneumoniae species complex
J Klebsiella aerogenes Klebsiella pneumoniae species complex
K Klebsiella quasipneumoniae Klebsiella pneumoniae species complex
L Klebsiella variicola Klebsiella pneumoniae species complex
M Vibrio cholerae Gram-negative
N Acinetobacter baumannii(MTCC 1425) Gram-negative
O Pseudomonas fluorescens (MTCC1749) Gram-negative
P Serratiamarcescens (MTCC 97) Gram-negative
Q Proteus vulgaris Gram-negative
R Staphylococcus aureus Gram-positive
S Salmonella enterica Gram-negative
T Bacillus clausii Gram-positive
U Pseudomonas putida Gram-negative
V Escherichia coli sequence type 155 Gram-negative
W Shigelladysenteriae Gram-negative

[0056] All plates were incubated at 37 °C for 24 h. Since all the selected bacterial cultures grow efficiently in LB, it was used as general media control. The growth and morphology of the bacterial cultures in KBA and in KSA after 48 h were studied.The tests were performed independently and in duplicate. The graphical representation of bacterial growth profile on selectivity and diffentiativity of KBA and KSA medium was shown in FIG. 1A. The results were illustrated in TABLE. 4.
Table 4: Comparative Selectivity and Differentiativity of KBA and KSA Media
Bacterial species Growth status on KBA plate Growth status on KSA plate
Selectivity Differentiativity selectivity Differentiativity
KpSC strains Colony observed green Colony observed Light purple
Klebsiella aerogenes(KpSC strain) Colony observed Translucent mucoid colony Colony observed Light purple
Vibrio cholerae Colony not observed - Colony not observed -
Acinetobacter baumannii Scanty growth Blue colour Colony observed Light purple(no difference)
Pseudomonas fluorescens Scanty growth Blue colour Colony not observed -
Serratiamarcescens Colony not observed - Colony observed Bright purple
Proteus vulgaris Scanty growth Blue colour Colony observed Light purple(no difference)
Staphylococcus aureus Colony not observed - Colony not observed -
Salmonella enterica Colony not observed - Colony observed Milky white colony
Bacillus clausii Colony not observed - Colony not observed -
Pseudomonas putida Colony not observed - Scanty growth Pale green
Escherichia coli
sequence type 155 Colony not observed - Scanty growth Light purple(no difference)
Shigelladysenteriae Colony not observed - Colony observed Blue

[0057] Freshly prepared KBA medium appeared deep blue due to methylene blue. The medium allowed for the selective growth of the KpSC cohorts including multidrug resistant (MDR)K. pneumoniae, K. quasipneumoniae, K. variicola, and K. aerogenes over other bacterial cultures as shown in FIG. 1B(a). Pronounced growth of Klebsiella spp. was observed after 16±2 h of incubation at 37 °C. As shown in FIG. 1B(a), the media colour surrounding the Klebsiella spp. colony changed from blue to dark green and the colony appeared mucoid with a dark green sheen which increased upon incubation at 37 °C for 24 h .
[0058] In KSA, the colonies of all the KpSC cohorts including multidrug resistant (MDR) K. pneumoniae, K. quasipneumoniae, K. variicola, and K. aerogenes species had the same purple magenta colour as shown in FIG. 1B(b).but in KBA, K. aerogenes showed a dark green sheen, had a translucent mucoid colony at 24 h but developed a faded green colouration after incubation of 48 h FIG.1C.
[0059] The difference in the bacterial growth profile in the LB, KBA, and KSA media plates for KpSC cohorts were shown in FIG.3A. The difference in the bacterial growth profile in the LB, KBA, and KSA media plates for gram-negative strainswere shown in FIG.3B and FIG. 3C. The difference in the bacterial growth profile in the LB, KBA, and KSA media plates for gram positive strains were shown in FIG.3D.
[0060] KBA medium was able to repress the growth of Shigella spp., S. marcescens, Bacillus spp., S. aureus, P. putida, S. enterica, and V. cholerae while there was a scanty growth for A. baumannii, P. vulgaris, E. coli ST155 and P. fluorescens. P. fuorescens, when incubated for an extended period of 48 h, showed a prominent and distinguishable blue-coloured colony formation. E. coli ST155, upon incubation up to 48 h, did not show any significant increase or change in colony morphology or growth.
[0061] However, we observed that P. vulgaris and A. baumannii showed the same purple pigmentation when cultured in KSA. E. coli ST155 showed a scanty growth after incubation for 24 h. The colonies of S. enterica and Shigella spp.grew in the KSA plate as milky white colonies. S. marcescens colonies appeared light pink at 24 h, changing to a brighter shade after 48 h. LB being a nutritionally rich media supported the growth of all cultures and showed their respective colony morphologies as expected.
[0062] EXAMPLE 2: COMPARATIVE ANALYSIS OF COMPONENTS OF KBA vs KSA
[0063] The comparative analysis of components of KBA vs KSA is shown in TABLE. 5. The components in KBA were judiciously included to render it selective and differential. Methylene blue, an inhibitor of the gram-positive organisms, was used to dissuade their growth in the medium. Bile salt and tryptophan were included as they are conducive to the growth of Klebsiella spp., leveraging on their ability to tolerate bile salt and metabolise tryptophan. Glycerol provided in the media acted as a sole carbon source suitable for Klebsiella spp. A total of 0.6% of NaCl rendered the media differential by imparting a dark green colouration to the Klebsiella spp. colonies.
[0064] The components of the KBA media contribute to the growth of the organism, selectivity and differentiativity. The concentration of the components was chosen to achieve these functions. For example, variation in the concentration of NaCl compromises the differentiativity with the lack of characteristicdark green sheen coloration of thecolonies. Similarly, the concentration of tryptophan has been optimised to promote the growth of Klebsiella spp. of KpSC cluster. Glycerol, Potassium dihydrogen phosphate, Dipotassium phosphate, magnesium sulphate heptahydrate, tryptophan serves as nutrients for the growth of bacteria. Sodium chloride apart from serving as a component contributing to the differentiativity of the media, it also maintains the osmoticum of the media.
TABLE5: Comparison of Klebsiella Blue Agar (KBA) with the Hicrome™ Klebsiella Selective (KSA) Agar Base
Components Klebsiella blue agar HiCrome™ Klebsiella Selective Agar Base
Carbon source Glycerol Yeast extract
Nitrogen source Tryptophan Peptone special
Buffering agent Potassium dihydrogen phospate; dipotassium phosphate -
Osmolarity Sodium chloride Sodium chloride
Micronutrient Magnesium sulphate heptahydrate -
Selective component Methylene blue; bile salt; tryptophan Klebsiella Selective Supplement (FD225)—carbenicillin (25 mg); chromogenic mixture; bile salt mixture; sodium lauryl sulphate
Gelling agents Agar Agar

[0065] EXAMPLE 3: EFFICIENCY EVALUATION OF KBA OVER KSA ON BACTERIAL COUNTS IN SURVEILLANCE OF KLEBSIELLA SPP. IN SYNTHETIC SEWAGE
[0066] The efficiency of the KBA media in the surveillance of sewage for the presence of Klebsiella spp. was checked in synthetic sewage augmented with bacteria.
[0067] Synthetic sewage preparation:Peptone, 160 mg; meat extract, 110 mg; anhydrous dipotassium hydrogen phosphate (K2HPO4), 28 mg; sodium chloride (NaCl), 7 mg; calcium chloride heptahydrate (CaCl2.2H2O), 4 mg; urea 30 mg; and magnesium sulphate heptahydrate (MgSO4.7H20), 2 mg were added to 1 L water and autoclaved. Chemical characteristics of the synthetic sewage were estimated as per the Indian Standard 3025 (IS 3025) (IS 3025 of Indian Standards Part 11, IS 3025 Part 44, IS 3025 Part 38, IS 3025 Part 16), as reported in the literature. Synthetic sewage was augmented with the following cultures at an OD of 0.1 each, K. pneumoniae, K. quasipneumoniae, K. aerogenes, E. coli ST155, B. clausii, A. baumanii, S. enterica, P. vulgaris, V. cholerae, Shigella spp., MDR strains K. pneumoniae OF9168, K. pneumoniae K2, K. Pneumonia K3, K. pneumoniae K4, K. pneumoniae K5, and K. pneumoniae U498. The augmented synthetic sewage was incubated for 1 h in a shaking incubator at 37 °C, following which the sample was plated at different dilutions onto the KBA, KSA, and LB media plates in triplicates and incubated at 37 °C for 24 h.
[0068] A) Analysis of bacterial profile:To assess the differences in the bacterial growth on all three media,the sample was drawn from the experimental set-up, serially diluted from 10-1 to 10-8, and plated onto LB agar plates. The plates were incubated overnight at 37 °C and replica plated onto KSA and KBA agar plates. A Sterile What man filter paper no. 1 of diameter 8.2 cm was used to replica transfer the colonies in the LB to the KBA and KSA agar plates. The plates were incubated overnight at 37 °C. The differences in CFU in different media were recorded.
[0069] The difference in the bacterial count of simulated synthetic sewage when plated onto the LB, KSA, and KBA media was determined and plotted with Graph pad Prism 9.0. As shown in FIG. 4A, KSA had a lesser bacterial count of 3.87 × 107 CFU/mL than LB, with a colony count of 4.17 × 107 CFU/mL, while KBA being a more selective medium of the three had only 2.14 × 107 CFU/mL.
[0070] The replica plating technique was used to demonstrate the selective nature of the KBA medium over the KSA medium. As shown in FIG.4B(a), LB medium had 253 CFU, of which only 209 CFU grew in the KSA medium when transferred. While in the KBA, out of 253 CFU, only 157 CFU grew when transferred. FIG. 4B(b) shows the Venn diagram of the relative growth comparison of the colonies in LB, KSA, and KBA. All the colonies in the KBA medium were growing in KSA, but not all colonies found in KSA were growing in KBA but were present in the primary LB plate.
[0071] Selectivity of the medium could be seen from FIG. 4B(c,d,e) the plates of LB, KSA, and KBA, where in apart from the decrease in the colonies in KBA, the colonies of the Klebsiella spp. are growing with their characteristic green colouration.
[0072] B)Colony-Based Multiplex PCR:The selective and differential nature of the KBA was further confirmed by colony-based multiplex PCR using primers specific for K. pneumoniae and K. quasipneumoniae. The primers SHV-f and OKP-f are specific and target the chromosomal class A ß-lactamase gene blaSHV and blaOKP of K. pneumoniae and K. quasipneumoniae respectively refer TABLE.6. The reverse primer DeoR-r is derived from a gene coding for an ATPase that is part of the stable bacterial genome and flanks the respective blaSHV and blaOKP genes.
TABLE6: Primers for identification of different Klebsiella species
Primer name Primer sequence (5'-3') Size (bp) Bacterial culture
SHV-F GCTGGCGGTACACGCCAGCCCG 995 Klebsiella pneumoniae
OKP-F GGCCGGYGAGCGGGGCTCA 348 Klebsiella quasipneumoniae
DeoR-R* AGAAGCATCCTGCTGTGCG

[0073] Bacterial colonies with different morphologies were selected for the molecular analysis. Colonies were resuspended in 100 µL of sterile water and pre-treated at 90 °C for 30 min before adding primers and reagents. PCR amplification conditions were optimised and performed as described by researchers. Briefly, thermocycling conditions were as follows: 95 °C for 5 min, followed by 40 cycles at 94 °C for 30 s, 62.5 °C for 30 s, 72 °C for 1 min, and a final extension step at 72 °C for 10 min. The amplified PCR products were analysed by electrophoresis on 2.5% agarose gel at 50 V for 2 ½ h and visualised using a gel doc system (Bio-Rad, USA). The amplicon size was determined using a 100 bp molecular weight marker (Origin Diagnostics and Research).
[0074] One-step multiplex colony PCR showed that KBA is relatively more selective than KSA as shown in FIG. 5. The amplicon of 995 bp size corresponds to the blaSHV gene – specific for Klebsiella pneumoniae while the amplicon of 348 bp size corresponds to the blaOKP gene – specific for Klebsiella quasipneumoniae
[0075] The PCR result confirms that the colonies in the KBA media are of Klebsiella spp. [Fig. 5 e, f, and g]. Even though the colonies growing in LB and KSA have Klebsiella spp., it also supports the growth of other bacteria present in the simulated sewage [Fig. 5 a, b, c, and d].
[0076] C)Statistical Analysis - One-Way Anova Test: Statistical analysis was performed using the platform Graph Pad Prism 9.0. The data obtained were analysed using the one-way ANOVA test with Dunnett’s multiple comparison tests to indicate any statistical significance between LB, KBA, and KSA. The significance level for the data sets was defined at p=0.05. All the data sets in the graphs are presented as mean values with respective standard deviations.
[0077] The foregoing descriptions of specific embodiments of the present invention have been presented for purposes of illustration and description. They are not intended to be exhaustive or to limit the present invention to the precise forms disclosed, and obviously many modifications and variations are possible in light of the above teaching. The embodiments were chosen and described in order to best explain the principles of the present invention and its practical application, to thereby enable others skilled in the art to best utilize the present invention and various embodiments with various modifications as are suited to the particular use contemplated. It is understood that various omissions and substitutions of equivalents are contemplated as circumstance may suggest or render expedient, but such are intended to cover the application or implementation without departing from the scope of the present invention, which should be according to the appended claims.
[0078] EXAMPLE.4: Optimisation studies for KBA Media
[0079] The optimum concentration of glycerol is 0.2% v/v , methylene blue is 0.064 g/L, tryptophan is 2 g/L , bile salt is 1.5g/L and sodium chloride is 0.6%. NaCl and tryptophan are vital in maintaining the differential, and selective nature of the medium, respectively. A concentration of 0.1% to 0.6% with an optimum (maximum colour intensity) at 0.6 %, imparted a green sheen to K. pneumoniae, K. quasipneumoniae, and K. variicola, belonging to the KpSC complex as shown in FIG.6A. Tryptophan on the other hand, selectively promoted the growth of Klebsiella spp., belonging to KpSC complex, against other gram-negatives, at a concentration ranging from 1 g/L to 3 g/L, with an optimum at 2 g/L as shown in FIG.6B.
[0080] The optimisation experiment involved the preparation of the KBA plates, with different concentrations of NaCl, and the bacterial cultures were streaked in designated sectors, the plates were incubated at 37°C overnight. The concentration promoting growth with maximum intensity of green sheen was considered optimum. A similar experiment was performed for optimizing the concentration of tryptophan. The end point was the presence and absence of growth, with optimum.

,CLAIMS:WE CLAIM:
1. A Klebsiella blue agar (KBA) media (100) for selective enumeration and differential detection of Klebsiella pneumoniae speciescomplex (KpSC complex), the media comprising:
a carbon source;
a selective agents comprising an indicating agent, a nitrogen source and a bile salt and
a differential agent.

2. The media (100) as claimed in claim 1, wherein the carbon source is glycerol present at a concentration of 0.2%v/v.

3. The media (100) as claimed in claim 1, wherein the indicating agent is methylene blue present at a concentration of 0.064 g/L, the nitrogen source is tryptophan present at a concentration of 1g/L to 3g/Land the bile salt present at a concentration of 1.5 g/L.

4. The media (100) as claimed in claim 1, wherein the differential agent is sodium chloride present at a concentration of 0.1% to 0.6%.

5. The media (100) as claimed in claim 1, wherein the optimum concentration of glycerol is 0.2%v/v , methylene blue is 0.064g/L, tryptophan is 2g/L and bile salt is 1.5g/L.

6. The media (100) as claimed in claim 1, wherein the optimum concentration of sodium chloride is 0.6%.

7. The media (100) as claimed in claim 1, comprising potassium dihydrogen phosphate, dipotassium phosphate as inorganic salts, magnesium sulphate heptahydrate as micronutrient and agar as gelling agent.

8. The media (100) as claimed in claim 1, wherein the selective agents are configured to inhibit the growth of other Klebsiella cohorts, or other gram-positive and gram-negative bacteria.

9. The media (100) as claimed in claim 1, wherein the differential agent is configured to impart green sheen to the KpSC complex to differentiate the same from other Klebsiella cohorts, gram-positive and gram-negative bacteria.

10. The media (100) as claimed in claim 1 wherein the pH of the media is controlled in the range 7.20±0.2.

11. A method (200) for preparing Klebsiella blue agar (KBA) media for selective growth and differential detection of Klebsiella pneumoniae speciescomplex (KpSC complex), the method comprising:
preparing (201)a first solution by dissolving 3 grams of potassium dihydrogen phosphate, 6 grams of dipotassium phosphate, 0.1% to 0.6% of sodium chloride and 0.064 g/L of methylene blue in one litre of sterile water;
Preparing (202) a second solution by dissolving 100 mg of magnesium sulphate heptahydrate and 17 g of agar in one litre of sterile water;
autoclaving (203) the first solution and the second solution separately at 121 °C for 20 min;
adding (204)separately sterilised 1.5 g/Lof bile salt, 1g/L to 3g/L of tryptophan, and 0.2%v/v of glycerolto the cooled first solution;
mixing(205) the first solution and the second solution to a final solution of 1000ml;
pouring(206 ) the final solution onto sterile petri dishes to form the KBA media.


(Dr. V. SHANKAR
IN/PA-1733)
For and on behalf of the Applicants

Documents

Application Documents

# Name Date
1 202341077515-STATEMENT OF UNDERTAKING (FORM 3) [14-11-2023(online)].pdf 2023-11-14
2 202341077515-PROVISIONAL SPECIFICATION [14-11-2023(online)].pdf 2023-11-14
3 202341077515-OTHERS [14-11-2023(online)].pdf 2023-11-14
4 202341077515-FORM FOR SMALL ENTITY(FORM-28) [14-11-2023(online)].pdf 2023-11-14
5 202341077515-FORM 1 [14-11-2023(online)].pdf 2023-11-14
6 202341077515-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [14-11-2023(online)].pdf 2023-11-14
7 202341077515-EDUCATIONAL INSTITUTION(S) [14-11-2023(online)].pdf 2023-11-14
8 202341077515-Proof of Right [06-04-2024(online)].pdf 2024-04-06
9 202341077515-FORM-26 [06-04-2024(online)].pdf 2024-04-06
10 202341077515-DRAWING [14-11-2024(online)].pdf 2024-11-14
11 202341077515-CORRESPONDENCE-OTHERS [14-11-2024(online)].pdf 2024-11-14
12 202341077515-COMPLETE SPECIFICATION [14-11-2024(online)].pdf 2024-11-14
13 202341077515-FORM-9 [15-11-2024(online)].pdf 2024-11-15
14 202341077515-FORM-8 [15-11-2024(online)].pdf 2024-11-15
15 202341077515-FORM 18 [15-11-2024(online)].pdf 2024-11-15
16 202341077515-RELEVANT DOCUMENTS [22-03-2025(online)].pdf 2025-03-22
17 202341077515-POA [22-03-2025(online)].pdf 2025-03-22
18 202341077515-FORM 13 [22-03-2025(online)].pdf 2025-03-22
19 202341077515-OTHERS [08-05-2025(online)].pdf 2025-05-08
20 202341077515-EDUCATIONAL INSTITUTION(S) [08-05-2025(online)].pdf 2025-05-08