Sign In to Follow Application
View All Documents & Correspondence

A Method Of Expressing Soluble Recombinant Serratiopeptidase

Abstract: The present invention relates to a method of expressing soluble recombinant Serratiopeptidase in a GRAS bacterial system. Further, the present invention particularly relates to the process of expression of soluble recombinant Serratiopeptidase in the periplasm of E. coli strain using a pET22b vector. Furthermore, the present invention provides improved recovery yield of Serratiopeptidase and overcomes the problem of protein refolding thereby eliminating the extra steps in the protein extraction process in the prior art.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
17 November 2023
Publication Number
21/2025
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
Parent Application

Applicants

PRORAMA BIOSCIENCES LLP
UDAI Square, Block 3A, Phase V, IDA Cherlapally, Industrial Area, EC Nagar, Junction Main Road, Hyderabad - 500051, Telangana, India.

Inventors

1. Madhusudhana Rao Nalam
PRORAMA BIOSCIENCES LLP, UDAI Square, Block 3A, Phase V, IDA Cherlapally, Industrial Area, EC Nagar, Junction Main Road, Hyderabad - 500051, Telangana, India.
2. Bhanu Ramanand Kuchibhotla
PRORAMA BIOSCIENCES LLP, UDAI Square, Block 3A, Phase V, IDA Cherlapally, Industrial Area, EC Nagar, Junction Main Road, Hyderabad - 500051, Telangana, India
3. Anselm Julius Desouza
PRORAMA BIOSCIENCES LLP, UDAI Square, Block 3A, Phase V, IDA Cherlapally, Industrial Area, EC Nagar, Junction Main Road, Hyderabad - 500051, Telangana, India
4. Dilip Sukhlal Mehta
PRORAMA BIOSCIENCES LLP, UDAI Square, Block 3A, Phase V, IDA Cherlapally, Industrial Area, EC Nagar, Junction Main Road, Hyderabad - 500051, Telangana, India

Claims

1. A process for expressing soluble recombinant protein Serratiopeptidase in a periplasmic space of a host cell, comprising the steps of: i) cloning Serratiopeptidase gene into an expression vector; ii) expressing recombinant Serratiopeptidase in a periplasmic region of the host cell using an inducer; iii) centrifuging the cells followed by resuspension of pellet in an ice-cold buffer for washing; iv) centrifuging and re-suspending the pellet in hypertonic buffer solution with or without EDTA, followed by cold centrifugation; v) resuspending the pellet in a cold hypotonic solution, followed by centrifugation; and vi) collecting supernatant containing the periplasmic protein.

2. The process as claimed in claim 1, wherein the expression vector in step (i) is pET22b vector.

3. The process as claimed in claim 1, wherein the host cell in step (ii) is E. coli BL21 (DE3) strain.

4. The process as claimed in claim 1, wherein the inducer in step (ii) is selected from a group comprising IPTG, lactose, allolactose or other lactose analogues.

5. The process as claimed in claim 1, wherein the concentration of the inducer is 0.1 mM to 50 mM.

6. The process as claimed in claim 1, wherein the buffer in step (iii) is selected from a group comprising PBS, Tris buffer, or Phosphate buffer.

7. The process as claimed in claim 1, wherein the buffer solution in step (iv) is selected from a group comprising Tris-Sucrose solution, Tris-Sucrose-EDTA solution and Spheroplast buffer.

8. The process as claimed in claim 7, wherein the buffer solution is Tris Sucrose solution or Spheroplast Buffer.

9. The process as claimed in claim 8, wherein the concentration of Tris buffer in Tris-Sucrose solution ranges from 30 to 100 mM.

10. The process as claimed in claim 8, wherein the concentration of Sucrose in Tris-Sucrose solution ranges from 5 to 20%.

11. The process as claimed in claim 8, wherein the concentration of Sucrose in Tris-Sucrose solution ranges from 10 to 50 mM.

12. The process as claimed in claim 7, wherein the Spheroplast buffer is hypertonic buffer with or without EDTA.

13. The process as claimed in claim 1, wherein the hypotonic solution in step (v) is selected from a group comprising Magnesium Sulphate, Magnesium Chloride, Tris-HCl, Tris-Acetate, or water.

14. The process as claimed in claim 13, wherein the concentration of hypotonic solution ranges from 5 mM to 50 mM.

15. The process as claimed in claim 14, wherein the resuspension volumes of 50 mM Tris-HCl range from 0.5 ml to 1.8 ml per 2ml of culture volume.

Specification

DESC:RELATED PATENT APPLICATION:

This application claims priority to, and benefit of Indian Patent Application No. 202341078352 filed on November 17, 2023; the disclosures of which are incorporated herein by reference.

FIELD OF THE INVENTION:

The present invention relates to the field of protein expression and purification. Particularly, the present invention relates to the soluble expression of Serratiopeptidase in the periplasm of E. coli. Specifically, the present invention describes the process of expression and localization of Serratiopeptidase to E. coli periplasm to provide soluble protein with good yield using a novel process.

BACKGROUND OF THE INVENTION:

Serratiopeptidase is a zinc-containing metalloprotease of molecular weight 45-60 kDa, produced in Serratia marcescens, rod-shaped gram-negative bacteria of the family Yersiniaceae. The S. marcescens was first isolated from the digestive tract of silkworms. The enzyme Serratiopeptidase produced in this microorganism can perform protein hydrolysis, which helps in cell-to-extracellular matrix interactions. Due to the proteolytic activity of Serratiopeptidase, it has good commercial value. The anti-inflammatory and analgesic effect of Serratiopeptidase makes it a valuable therapeutic protein. Serratiopeptidase is known for its application in several medical fields including ophthalmology, orthopaedics, dentistry, pulmonology, surgery, etc. However, the large-scale production of Serratiopeptidase in Serratia spp. is unsafe due to the pathogenic nature of this bacteria as reported in the publication Faviola, et al., (2023). Therefore, the production of a recombinant Serratiopeptidase is a much safer approach.

There have been many attempts to produce recombinant Serratiopeptidase in host systems like E. coli, particularly the BL21 (DE3) strain, however, the large-scale production of Serratiopeptidase in E. coli BL21 (DE3) results in the formation of inclusion bodies in the bacterial cytoplasm as reported in the publication Abhilasha et al., (2023). The recovery of the bioactive protein Serratiopeptidase from the inclusion bodies require in vitro solubilization and refolding.

This process of refolding the protein makes the large-scale commercial production of the protein non-viable or impractical.

Tao et al., (2007) disclose the cloning, expression, and purification of metalloprotease Pr596 (produced by S. marcescens HR3) in BL21 (DE3)/pLysS strain with the proteolytic activity of 132 U/ml. Doshi et al., (2020) provides the yield of Serratiopeptidase to be up to 86 mg/L. Selvarajan (2021) discloses the cloning and expression of Serratiopeptidase (SP gene) with a protein concentration of 0.646 mg/ml. However, these prior arts exhibited the formation of protein inclusion bodies, wherein the inclusion bodies have to be solubilized, and the resulting protein has to be refolded. This could cause reduced yield of the Serratiopeptidase and may prove to be an expensive process.

The existing processes in prior art pose limitations such as extracting the Serratiopeptidase protein from the solubilized inclusion bodies and refolding the protein thereof. On a commercial scale, all these steps are time-consuming, and expensive and require expert handling for consistent yields and recovery of active protein.

To overcome the problem of Serratiopeptidase expression in inclusion bodies in a bacterial system, Kaviyarasi et al. (2016) expressed Serratiopeptidase in a yeast system such as Pichia pastoris. However, the resulting yield of Serratiopeptidase was only about 0.06 mg/ml. Further, the gene transformation and expression in Pichia pastoris involves the usage of specialized media for fermentation with a cycle time of about 72-96 hours depending on the protein. Further, the activity screening in this system is more cumbersome compared to E. coli/Serratia spp. This makes commercial production of the protein costly and time-consuming.

There have been many studies and attempts to obtain a soluble Serratiopeptidase without having to refold the protein in prior arts. However, none of these prior arts has been successful in expressing recombinant soluble Serratiopeptidase without the need for solubilization of inclusion bodies and protein refolding as shown in Table 1.

Table 1: Existing prior arts and their details.
Prior art Source of Serratiopeptidase Yield and activity of Serratiopeptidase
mg/L EU/ml EU/mg
Tao et al., 2007 Recombinant E. coli - 132 -
Badhe et al., 2009 S. marcescens - 27.36 -
Pansuriya & Singhal, 2010 S. marcescens - 7034 -
Mohankumar, 2011 S. marcescens - 1450.75 -
Wagdarikar et al., 2015 S. marcescens - 22.85 -
Kaviyarasi & Suryanarayana, 2016 Recombinant
P. pastoris
-
- 50
Srivastava et al., 2019 Recombinant E. coli 40-45 - 1750±5 (azocasein)
Gopinath S. et al., 2020 Mutant S. marcescens - 3437.6 -
Doshi et al., 2020 Recombinant E. coli 80 - -
Selvarajan et al., 2021 Recombinant E. coli 0.646 200 309.59

The existing prior arts provide the limitation in the form of protein expression in the inclusion bodies posing difficulty in recovery and refolding of the resulting Serratiopeptidase. Further, the existing processes are tedious, time-consuming, expensive, and inefficient in providing a high yield of soluble Serratiopeptidase.

Therefore, there exists a need for a process that could overcome the said limitations and provide a soluble Serratiopeptidase in the folded conformation (without the need for refolding) with enhanced yield and lesser downstream purification steps without compromising on enzymatic activity.

OBJECTS OF THE INVENTION:

The primary object of the present invention is to provide a process of expressing a soluble recombinant Serratiopeptidase in the periplasm of bacterial system.

Another object of the present invention is to clone the Serratiopeptidase gene in the pET22b vector.

Another object of the present invention is to transform the recombinant Serratiopeptidase pET22b vector into an E. coli BL21 (DE3) strain.

Yet another object of the present invention is to express the recombinant Serratiopeptidase protein in the periplasm of the E. coli BL21 (DE3) strain using a novel method.

Another object of the present invention is to extract the soluble recombinant Serratiopeptidase protein from the E. coli BL21 (DE3) strain and extract it.

SUMMARY OF THE INVENTION:

Accordingly in one aspect, the present invention provides a process for expressing soluble recombinant protein Serratiopeptidase in the periplasmic space of the host cell, comprising the steps of:
i) cloning of Serratiopeptidase gene in an expression vector;
ii) expressing recombinant Serratiopeptidase in a periplasmic region of the host cell using an inducer;
iii) centrifuging cells followed by resuspension of pellet in an ice-cold PBS buffer for washing;
iv) re-suspending the pellet in a hypertonic buffer solution followed by cold centrifugation;
v) resuspending the pellet in a cold hypotonic solution followed by centrifugation; and
vi) collecting supernatant containing periplasmic protein.

The process as above, wherein the expression vector in step (i) is pET22b vector, expressed in the host cell E. coli BL21 (DE3) strain as provided in step (ii) of the process.

The inducer in step (ii) of the above process is selected from a group comprising IPTG, lactose, allolactose or other lactose analogues, wherein the final concentration of the inducer ranges from 0.1 mM to 50 mM.

The buffer in step (iii) of the above process is selected from a group comprising PBS, Tris buffer, or Phosphate buffer.

The buffer solution in step (iv) in the above process is selected from a group comprising Tris-Sucrose solution, Tris-Sucrose-EDTA, Spheroplast Buffer (essentially hypertonic buffers with or without EDTA), wherein the preferred buffer solution is Tris Sucrose solution. The concentration of Tris buffer in Tris-Sucrose solution ranges from 30 to 100 mM. Further, the concentration of Sucrose in Tris-Sucrose solution ranges from 5 to 20% or from 10 to 50 mM.

The hypotonic solution in step (v) of the above process is selected from a group comprising Magnesium Sulphate, Magnesium Chloride, Tri-HCl, Tris Acetate, or water, wherein the ionic strength or salt concentration of hypotonic solution ranges from 5mM to 50 mM. Further, the resuspension volumes of 50 mM Tris-HCl range from 0.5 ml to 1.8 ml per 2ml of culture volume.

BRIEF DESCRIPTION OF DRAWINGS:

FIG. 1: Schematic representation of recombinant Serratiopeptidase expression in periplasm of E. coli BL21 (DE3).

FIG. 2: The SDS-PAGE gel confirming the expression of recombinant Serratiopeptidase (50 kDa) in the periplasm of E. coli BL21 (DE3). Details about lanes of gel from left: Lane 1: Control “C” (Commercially available Serratiopeptidase); Lane 2: Total cell protein “TCP” extract upon 0.1 mM IPTG induction; Lane 3: Periplasmic protein “PP” extract upon 0.1 mM IPTG induction; Lane 4: Total cell protein “TCP” extract upon 0.5 mM IPTG induction; Lane 5: Periplasmic protein “PP” extract upon 0.5 mM IPTG induction and Lane 6: Protein Ladder.

FIG. 3: SDS-PAGE of the protein extracted from the alternate methods tested (30 µl samples were loaded in each well).

FIG. 4: The Zymogram of Serra BL21 upon 0.1 & 0.5 mM IPTG induction in E. coli BL21 (DE3). Details about lanes of gel from left: Lane 1: Protein Ladder; Lane 2: aliquot from pellet resuspended in 500 µl of 5 mM MgSO4; Lane 3: aliquot from pellet resuspended in 1 ml of 5 mM MgSO4; Lane 4: aliquot from pellet resuspended in 1.5 ml of 5 mM MgSO4; Lane 5: aliquot from pellet resuspended in 2 ml of 5 mM MgSO4; Lane 6: aliquot from pellet resuspended in 500 µl of 5 mM MgSO4; Lane 7: aliquot from pellet resuspended in 1 ml of 5 mM MgSO4; Lane 8: aliquot from pellet resuspended in 1.5 ml of 5 mM MgSO4; Lane 9: aliquot from pellet resuspended in 2 ml of 5 mM MgSO4; and Lane 10: Control (Commercially available Serratiopeptidase).

FIG. 5: SDS-PAGE of Serra BL21 (50 kDa) upon 50 mm Lactose induction using various hypotonic solutions.
Protein Extraction is done by using a 5 ml cell pellet and various hypotonic solutions. Details about lanes of gel from left (80 µl samples were loaded in each well).
FIG. 5A: Lane 1: extracted in 4 ml of 5 mM MgSO4; Lane 2: extracted in 4.5 ml of 5 mM MgSO4; Lane 3: extracted in 4.5 ml 50 mM Tris HCl pH 8.0; Lane 4: extracted in 4.5 ml of 20 mM MgCl2; and Lane 5: Protein ladder.
FIG. 5B: Lane 1: extracted in 4.5 ml of milli Q water (MQ); Lane 2: extracted in 4.5 ml of 20 mM Tris Acetate; Lane 3: Protein Ladder; and Lane 4: Positive Control (1 mg/ml Serratiopeptidase Tablet).

FIG. 6: Zymogram of Serra BL21 upon 50 mM Lactose induction using various hypotonic solutions.
Protein Extraction is done by using a 5 ml cell pellet and various hypotonic solutions. Details about lanes of gel from left (80 µl samples were loaded in each well).
FIG. 6A: Lane 1: Positive Control (1 mg/ml Serratiopeptidase Tablet) Lane 2: extracted in 4 ml of 5 mM MgSO4; Lane 3: extracted in 4.5 ml of 5 mM MgSO4; Lane 4: extracted in 4.5 ml of 50 mM Tris HCl pH 8.0; and Lane 5: extracted in 4.5 ml of 20 mM MgCl2.
FIG. 6B: Lane 1: extracted in 4.5 ml of milli Q water (MQ); Lane 2: extracted in 4.5 ml of 20 mM Tris Acetate; and Lane 3: Positive Control (1 mg/ml Serratiopeptidase Tablet).

FIG. 7: SDS-PAGE of E. coli (BL21) Serra was induced with 0.5 mM IPTG Induction using various hypotonic solutions.
Protein Extraction was done by using a 5 ml cell pellet and various hypotonic solutions.
FIG. 7A: Lane 1: extracted in 4 ml of 5 mM MgSO4; Lane 2: extracted in 4.5 ml of 5 mM MgSO4; Lane 3: extracted in 4.5 ml of 50 mM Tris HCl pH 8.0; Lane 4: extracted in 4.5 ml of 20 mM MgCl2; and Lane 5: Protein ladder.
FIG. 7B: Lane 1: extracted in 4.5 ml of MQ; Lane 2: extracted in 4.5 ml of 20 mM Tris Acetate; Lane 3: Protein ladder, and Lane 4: Positive Control (1 mg/ml Serratiopeptidase Tablet).

FIG. 8: Zymogram of E. coli (BL21) Serra was induced with 0.5 mM IPTG using various hypotonic solutions.
Protein Extraction was done by using a 5 ml cell pellet and various hypotonic solutions. Details about lanes of gel from left (80µl samples were loaded in each well):
FIG. 8A: Lane 1: Positive Control (1mg/ml Serratiopeptidase Tablet); Lane 2: extracted in 4 ml of 5 mM MgSO4; Lane 3: extracted in 4.5 ml of 5 mM MgSO4; Lane 4: extracted in 4.5 ml of 50 mM Tris HCl, pH 8.0; Lane 5: extracted in 4.5 ml of 20 mM MgCl2.
FIG. 8B: Lane 1: 5 ml cell pellet extract in 4.5 ml of MQ; Lane 2: extracted in 4.5 ml of 20 mM Tris Acetate; and Lane 3: Positive Control (1 mg/ml Serratiopeptidase Tablet).

FIG. 9: SDS-PAGE of Serra BL21 with 0.5 mM IPTG Induction using different volumes of 50 mM Tris HCl, pH 8.0.
Protein Extraction was done by using a 2 ml cell pellet and different volumes of 50 mM Tris HCl pH 8.0. Details about lanes of gel from left (200 µl protein precipitate in 80 µl samples were loaded in each well). Lane 1: Resuspension in 1.8 ml of 50 mM Tris HCl, pH 8.0; Lane 2: Resuspension in 1.5 ml of 50 mM Tris HCl, pH 8.0; Lane 3: Resuspension in 1 ml of 50 mM Tris HCl, pH 8.0; Lane 4: Resuspension in 0.5 ml of 50 mM Tris HCl, pH 8.0; and Lane 5: Protein Ladder.

FIG. 10: SDS-PAGE of Serra BL21 with 50 mM Lactose Induction using different volumes of 50 mM Tris HCl, pH 8.0.
Protein Extraction was done by using a 2 ml cell pellet and different volumes of 50 mM Tris HCl, pH 8.0. Details about lanes of gel from left (80 µl samples were loaded in each well). Lane 1: Resuspension in 1.8 ml of 50 mM Tris HCl, pH 8.0; Lane 2: Protein Ladder; Lane 3: Resuspension in 1.5 ml of 50 mM Tris HCl, pH 8.0; Lane 4: Resuspension in 1 ml of 50 mM Tris HCl, pH 8.0; and Lane 5: Resuspension in 0.5 ml of 50 mM Tris HCl, pH 8.0.

FIG. 11: SDS-PAGE and Zymogram of Serra BL21 with 0.5 mM IPTG Induction.
FIG. 11A: Details about lanes of Zymogram from left (80 µl samples were loaded in each well). Lane 1: Total cell protein extract upon 0.5 mM IPTG induction; and Lane 2: Periplasmic fraction from 1 ml cell pellet re-suspended in 900 µl of 50 mM Tris-HCl, pH 8.0.
FIG. 11B: Details about lanes of SDS-PAGE from left (80 µl samples were loaded in each well). Lane 1: Total cell protein extract upon 0.5 mM IPTG induction; and Lane 2: Periplasmic fraction from 1 ml cell pellet re-suspended in 900 µl of 50 mM Tris-HCl, pH 8.0.

FIG. 12: SDS-PAGE and Zymogram of Serra BL21 with 50 mM Lactose Induction.
FIG. 12A: Details about lanes of Zymogram from left (80 µl samples were loaded in each well). Lane 1: 50 mM Lactose induction aliquot from pellet re-suspended in 900 µl of 50 mM Tris HCl pH 8.0; and Lane 2: Positive Control (1 mg/ml Serratiopeptidase Tablet).
FIG. 12B: Details about lanes of SDS-PAGE from left (80 µl samples were loaded in each well). Lane 1: Periplasmic protein extract upon 50 mM Lactose induction; 1 ml pellet re-suspended in 900 µl of 50 mM Tris HCl, pH 8.0; and Lane 2: Positive Control (1 mg/ml Serratiopeptidase Tablet).

FIG. 13: SDS-PAGE and Zymogram of Serra BL21 with 0.5 mM IPTG Induction.
FIG. 13A: Details about lanes of Zymogram from left (80 µl samples were loaded in each well). Lane 1: Total cell protein extract upon 0.5 mM IPTG induction; and Lane 2: 0.5 mM IPTG induced aliquot from pellet re-suspended in 500 µl of 50 mM Tris HCl, pH 8.0.
FIG. 13B: Details about lanes of SDS-PAGE from left (80 µl samples were loaded in each well): Lane 1: Total cell protein extract upon 0.5 mM IPTG induction; and Lane 2: Periplasmic protein extract upon 0.5 mM IPTG induction; For 1 ml pellet re-suspended in 500 µl of 50 mM Tris HCl, pH 8.0.

FIG. 14: SDS-PAGE and Zymogram of Serra BL21 with 50 mM Lactose Induction.
FIG. 14A: Details about lanes of Zymogram from left (80 µl samples were loaded in each well). Lane 1: 50 mM Lactose induction aliquot from pellet resuspended in 500 µl of 50 mM Tris HCl pH 8.0; and Lane 2: Positive Control (1 mg/ml Serratiopeptidase Tablet).
FIG. 14B: Details about lanes of SDS-PAGE from left (80 µl samples were loaded in each well). Lane 1: Periplasmic protein extract upon 50 mM Lactose induction; 1 ml pellet re-suspended in 500 µl of 50 mM Tris HCl, pH 8.0; and Lane 2: Positive Control (1 mg/ml Serratiopeptidase Tablet).

FIG. 15: The graph represents the estimation of recombinant Serratiopeptidase using Lowry’s method. The X-axis of the graph represents the volume of BSA (0.1 mg/ml) taken and the Y axis represents the absorbance at 660 nm.

FIG. 16: Summary chart for soluble expression of Serratiopeptidase in Serra BL21 (DE3).

DETAILED DESCRIPTION OF THE INVENTION:

The present invention describes the process of expression of soluble recombinant Serratiopeptidase in the periplasmic region of E. coli.

The currently available processes provide the expression of recombinant Serratiopeptidase protein in host cells such as E. coli. However, the protein is expressed in inclusion bodies in the cytoplasm of the cells. These inclusion bodies pose difficulty in isolation and extractions of the Serratiopeptidase protein. The extraction process requires solubilization of inclusion bodies, wherein the protein extracted is not obtained in the folded conformation. The protein is recovered in the misfolded form, wherein it has to be refolded to restore its proteolytic activity. These limitations make the process tedious and expensive. Further, since the proteins can easily denature, experts must put in extra effort in handling the samples carefully. This can make the industrial-scale production of Serratiopeptidase extremely tedious and costly.

The available processes in the art for the expression of Serratiopeptidase protein in E. coli include fed-batch fermentation followed by isolation, washing, and solubilization of inclusion bodies. The resulting protein from this process is further processed for refolding. The recovery of recombinant protein from the cytoplasm of the heterologous host is usually a multi-step process with a loss of protein at each stage. The low recovery yield of bioactive protein and the requirement of extensive solubilization and refolding are the drawbacks of existing art.

However, the production of Serratiopeptidase in the periplasmic space of bacterial cells can facilitate protein folding. The periplasmic expression of Serratiopeptidase reduces the downstream processing steps as extraction is easier, quicker, efficient, and reproducible upon scaling up as it involves three simple steps a) wash step, b) incubation with hypertonic solution followed by c) incubation with hypotonic solution. Soluble expression of Serratiopeptidase in E. coli periplasm as per the present invention can enhance the yield of the Serratiopeptidase protein with fewer downstream purification steps. The schematic representation of recombinant Serratiopeptidase expression in the periplasm of E. coli BL21 (DE3) is shown in the FIG. 1.

Accordingly, in one aspect, the present invention provides a process of expression of Serratiopeptidase in the periplasmic space of the heterologous host cell E. coli, which is generally recognized as a safe cell (GRAS). Expression of Serratiopeptidase protein in the periplasm of the host cells keeps the resulting protein folded and soluble. This removes the additional steps of refolding the protein or solubilizing the inclusion bodies.

The oxidative nature of E. coli periplasm facilitates the native folding of the protein. Coupling of Serratiopeptidase protein with n-terminal signal sequence (pelB) drives protein into periplasmic space after synthesis. The combinatorial effect of signal sequence and E. coli periplasm results in soluble expression of Serratiopeptidase protein in the bacterial periplasm. In addition, this strategy effectively reduces the time and cost of recovery of proteins.

In one aspect the present invention provides a process for expressing soluble recombinant protein Serratiopeptidase in periplasmic space of the host cell, comprising the steps of:
i. cloning of Serratiopeptidase gene in an expression vector;
ii. expressing recombinant Serratiopeptidase in a periplasmic region of the host cell using an inducer; an ice-cold;
iii. centrifuging cells followed by resuspension of pellet in an ice-cold buffer (preferably PBS) for washing;
iv. resuspending the pellet in Hypertonic buffer solution followed by cold centrifugation;
v. resuspending the pellet in a cold hypotonic solution, incubation, followed by centrifugation; and
vi. collecting supernatant containing periplasmic protein.

In one embodiment, the present invention provides the cloning of the Serratiopeptidase gene in a pET22b expression vector. Suitable forward and reverse primers for the Serratiopeptidase gene sequences are designed and PCR is performed. The resulting gene product is analysed and cloned in the pET22b vector.

In another embodiment, the present invention is to express the recombinant Serratiopeptidase in the periplasm of the E. coli BL21 (DE3) strain. Accordingly, in the present invention, the culture is incubated at 37 °C at 180 RPM for 3 hours.

In the process for expression of Serratiopeptidase, the inducer is selected from the group comprising isopropylthio-ß-galactoside (IPTG), lactose, arabinose, heavy metals, toluene, xylene, ecdysone, cumate, methanol, doxycycline, tetracycline or its analogs or combination thereof. The present invention provides the Serratiopeptidase gene transformed cells, which are tested for expression of the desired protein by primary and secondary cell culturing followed by protein induction using isopropylthio-ß-galactoside (IPTG) and lactose. The process for expression of Serratiopeptidase, wherein the concentration of the inducer is 0.1 mM to 80 mM; the preferred concentration of inducer is 0.5 mM to 50 mM.

The cultured cells are centrifuged at high speed and the pellet obtained is washed and re-suspended multiple times in suitable buffer and solution. The final pellet is re-suspended in a suitable solution to obtain the protein in the supernatant. In another embodiment, supernatant obtained from pellet resuspension is used for testing the expression of the recombinant Serratiopeptidase protein in the soluble region (periplasmic region) of the cell. The protein analysis is performed using a process such as electrophoresis to analyze the expression of Serratiopeptidase at a molecular weight of approximately 50 kDa.

The buffer in step (iii) of the above process is selected from a group comprising PBS, Tris buffer or Phosphate buffer.

The buffer solution in step (iv) in the above process is selected from a group comprising Tris-Sucrose solution, Spheroplast buffer or Tris Sucrose EDTA (essentially hypertonic buffers with or without EDTA), wherein the preferred buffer solution is Tris Sucrose solution. The concentration of Tris buffer in Tris-Sucrose solution ranges from 30 to 100 mM. Further, the concentration of Sucrose in Tris-Sucrose solution ranges from 5 to 20% or from 10 to 50 mM.

The hypotonic solution in step (v) of the above process is selected from a group comprising Magnesium Sulphate, Magnesium Chloride, Tri-HCl, Tris Acetate or water, wherein the ionic strength or salt concentration of the hypotonic solution ranges from 5 mM to 50 mM. Further, the resuspension volumes of 50 mM Tris-HCl range from 0.5 ml to 1.8 ml per 2ml of culture volume.

The present invention provides Serratiopeptidase with effective proteolytic activity against suitable protein substrates such as casein.

The present invention provides a process of expression of Serratiopeptidase with a higher yield.

The present invention provides several advantages over the existing problems in the prior art which include:

Technical Advantages of the Present Invention:

• Produced in the host system which is generally recognized as safe (GRAS).
• Soluble Expression of Serratiopeptidase providing the desired folding.
• Easy recovery from periplasm with fewer cellular protein contaminants.
• Cost-effective process with no need for re-folding or solubilization steps.
• Efficient and less time-consuming for large-scale production process.

The below Examples are provided only for the purposes of illustration and should not be construed as limiting the scope of the invention in any manner.

EXAMPLES:

EXAMPLE 1: CLONING OF SERRATIOPEPTIDASE IN pET22b VECTOR:

The complete coding sequence of the Serratiopeptidase gene was obtained from NCBI GenBank. The forward primer (NcoIF: 5’ ATGGCCATGGGGCAATCTACTAAAAAGGCAATTGAAATTACTG 3’) and the reverse primer (5’ CTCCGAAGCTTCGTTACACGATAAA 3’) were designed and used for Serratiopeptidase gene amplification using PCR. The amplified gene was subsequently cloned in the pET22b vector by sticky end cloning using the manufacturer's protocol. The transformation of cloned Serratiopeptidase gene in pET22b vector (obtained from CCMB, Hyderabad) was carried in E. coli BL21 (DE3) strain (obtained from CCMB, Hyderabad). Clones having the Serratiopeptidase gene were confirmed using PCR.

EXAMPLE 2: EXPRESSION OF RECOMBINANT SERRATIOPEPTIDASE IN E. coli BL21 (DE3) STRAIN:

Bacterial inoculation and induction:

1. A single colony of E. coli BL21 (DE3) Serra was primarily cultured overnight in Luria Bertani medium with Ampicillin (LB +Amp).
2. 1% of the primary culture was further inoculated into the LB +Amp medium to form the secondary culture.
3. The above secondary culture was incubated at 37 °C for 2-3 hours till the cell density of the culture reached 0.5 at OD600 nm.
4. The cells were induced with the final concentration of 0.1 mM and 0.5 mM IPTG obtained from the 1M IPTG stock.
5. After cell induction, the culture medium was incubated at 37 °C for 3 hours.

Protein extraction protocol:
1. After 3 hours of incubation of culture at 37 °C it was transferred into a centrifuge tube.
2. The culture was centrifuged at 10,000 RPM for 10 minutes and the supernatant was discarded without disturbing the pellet.
3. The pellet was resuspended in 30 mM Tris buffer at pH 8.0 & 20% Sucrose solution. For 1 ml of culture pellet 800 µl of Tris Sucrose solution was used for washing.
4. Centrifuge tubes were placed on Roto spin for 30 minutes and the pellet was allowed to resuspend slowly.
5. After Tris-Sucrose wash, cells were pelleted at 10,000 RPM for 10 minutes and the supernatant was discarded.
6. Then the pellet was slowly re-suspended with 5 mM ice-cold Magnesium Sulphate (MgSO4) at the same volume as the Tris-Sucrose solution. The resuspension was carried out at 4 °C for 30-45 minutes. During this step, the periplasmic protein is released into the ice-cold buffer.
7. Then the re-suspended solution was centrifuged at 10,000 RPM for 10 minutes at 4 °C.
8. The supernatant was transferred to a new centrifuge tube and refrigerated.

Assay to confirm protein expression:
25 µl of supernatant from above step was boiled along with 5 µl of 5x SDS loading dye at 95 °C for 10 minutes. SDS-PAGE was performed to confirm the expression of Serratiopeptidase in the periplasm of the host cell E. coli BL21 (DE3) using a protein ladder to confirm the desired protein molecular weight at ~50 kDa as shown in FIG. 2.

Results:
The expression of recombinant Serratiopeptidase protein upon IPTG induction was seen at ~50 kDa in SDS-PAGE gel thereby confirming the expression of Serratiopeptidase in the soluble periplasmic region of E. coli.

EXAMPLE 3: EXPRESSION OF RECOMBINANT SERRATIOPEPTIDASE IN E. coli BL21 (DE3) STRAIN:

Bacterial inoculation and induction:
1. Serra BL21 was cultured in LB-Amp medium and incubated at 37 °C at 180 RPM overnight (primary).
2. 1% of the primary culture was inoculated into LB-Amp medium (secondary) and incubated at 37 °C for 2-2.30 hours till the cell density of the culture reached (0.4 - 0.6) at OD600 nm.
3. Once the cells reached ideal cell density, they were induced under two different conditions i.e.,
Condition 1: Induction with IPTG (0.5 mM as final concentration) and
Condition 2: Induction with Lactose (50 mM as final concentration).
4. After induction the culture was incubated at 37 °C at 180 RPM for 3 hours. Then cells were harvested at 10,000 RPM for 10 minutes and the cell pellet was collected.

Protein extraction protocol:
1. The cell pellet was re-suspended in an ice-cold 1X PBS buffer and vortexed vigorously (For 1 ml of culture pellet; 400 µl of 1X PBS buffer is used for washing).
2. After 1X PBS buffer wash, cells were pelleted at 10,000 RPM for 10 minutes at 4 °C, and the supernatant was decanted.
3. Then pellet was resuspended in a spheroplast buffer and kept in the ice bath for 10 minutes (For 1 ml of culture pellet 900 µl of spheroplast buffer is used for washing).
4. Later, cells were harvested at 10,000 RPM for 10 minutes at 4 °C and the supernatant was decanted.
5. Then the pellet was slowly re-suspended with a resuspension buffer (volume same as the spheroplast buffer). The resuspension was carried out at 4 °C for 30 minutes. During this step, the periplasmic protein is released into the ice-cold buffer.
6. Then the re-suspended solution was centrifuged at 10,000 RPM for 10 minutes at 4 °C.
7. The protein was collected into a new pre-cold centrifuge tube and used for further analysis.

Results:
The expression of Serra BL21 under two different induction conditions, 1&2 (0.5 mM IPTG and 50 mM lactose respectively) was seen at ~50 kDa in SDS-PAGE gel thereby confirming the expression of Serratiopeptidase in the soluble periplasmic region.

Optimization of Protein extraction with various hypotonic solutions:
The present inventors have optimized two other methods for protein extraction along with the previous method. All of them can be considered for protein purification steps. The methodology has been tabulated below.

Table 2: Protocol for protein extraction with various hypotonic solutions.
Sr. No. Protocol-1 Protocol-2 Protocol-3 Protocol-4 Protocol- 5 Protocol-6
1. After 3 hours of incubation at 37 °C, the culture was transferred into a centrifuge tube.
2. The culture was centrifuged at 10,000 RPM for 10 minutes and the supernatant was discarded without disturbing the pellet.
3. The pellet was re-suspended in 1X PBS buffer. For 1 ml of culture pellet 400 µl of 1X PBS buffer.
4. Centrifuge tubes were vortexed vigorously and cells were pelleted at 10,000 RPM for 10 minutes @ 4 °C and the supernatant was discarded.
5. The pellet was resuspended in 30 mM Tris, pH 8.0 &
20% Sucrose solution. For 1 ml of culture pellet 800 µl of Tris Sucrose solution is used for washing. The pellet was re-suspended in an ice-cold Spheroplast buffer which consists of 100 mM Tris, pH 8.0 and 50 mM Sucrose solution. For 1 ml of culture pellet 900 µl of Spheroplast buffer is used for washing.

6. Centrifuge tubes were placed on roto spin for 30 minutes and the pellet was allowed to resuspend slowly. Centrifuge tubes were vortexed vigorously and kept in ice for 10 min.

7. After the Tris-
Sucrose wash, cells were pelleted at 10,000 RPM for 10 minutes and the supernatant was discarded. After the incubation of 10 mins, cells were pelleted at 10,000 RPM for 10 minutes @ 4 °C and the supernatant was discarded.

8. Then the pellet was slowly resuspended with 5 mM ice-cold MgSO4 at the same volume as Tris Sucrose. The resuspension was carried out at 4 °C for
30-45 minutes.
During this step, the periplasmic protein is released into the ice-cold buffer. Then the pellet was slowly re-suspended with 5 mM ice-cold
MgSO4/MgCl2 as the same volume as Tris-Sucrose. The resuspension was carried out at
4 °C for 30 minutes. During this step, the
periplasmic protein is released into the ice-cold buffer. Then the pellet was slowly re-suspended with 50 mM ice-cold Tris-HCL pH-8 at the same volume as Tris-Sucrose. The resuspension was carried out at 4 °C for 30 minutes. During this step, the periplasmic protein is released into the ice-cold buffer. Then the pellet was slowly re-suspended with 20 mM ice-cold MgCl2 at the same volume as Tris Sucrose. The resuspension was carried out at 4 °C for 30 minutes. During this step, the periplasmic protein is released into the ice-cold buffer. Then the pellet was slowly re-suspended with ice-cold MQ at the same volume as Tris-Sucrose. The resuspension was carried out at 4 °C for 30 minutes. During this step, the periplasmic protein is released into the ice-cold buffer. Then the pellet was slowly re-suspended with ice-cold 20 mM Tris Acetate at the same volume as Tris Sucrose. The resuspension was carried out at 4 °C for 30 minutes. During this step, the periplasmic protein is released into the ice-cold buffer.
9. Then the re-suspended solution was centrifuged at 10,000 RPM for 10 minutes at 4 °C.
10. The supernatant was transferred to a new pre-cooled centrifuge tube.
11. 80 µl of supernatant from the previous step was boiled along with 20 µl of 5X loading dye at 95 °C for 10 minutes. SDS-PAGE was performed for the confirmation of Serratiopeptidase at ~50 kDa ladder.

Results:
In protein extraction by using various hypotonic solutions, the Serra protein is extracted in soluble form. As a band was seen at ~50 kDa in SDS-PAGE, the size confirmation was done by using 1 mg/ml Serratiopeptidase Tablet (as a positive control) in the run-along with the samples.

In the previous study, FIG. 3 shows the SDS-PAGE of the protein extraction by using various hypotonic solutions (30 µl of positive control and samples were loaded in each well respectively).

The present inventors have optimized two other methods with equal or improved yields, FIG. 5 (A&B) and FIG. 7 (A&B) show the SDS-PAGE of protein extraction Serra BL21 induced with 50 mM Lactose and 0.5 mM IPTG respectively, by using various hypotonic solutions (80 µl of positive control and samples were loaded in each well respectively).

The zymogram shows a zone clearance that confirms the proteolytic activity of the Serra BL21 protein at the respective (~50 kDa) position along with the positive control (1 mg/ml Serratiopeptidase Tablet). FIG. 6 (A&B) and FIG. 8 (A&B) show the Zymogram of protein extraction Serra BL21 induced with 50 mM Lactose and 0.5 mM IPTG respectively, by using various hypotonic solutions (80 µl of positive control and samples were loaded in each well respectively). From the above-mentioned figures, we can interpret that among the various hypotonic solutions, 50 mM ice-cold Tris HCl, pH 8.0 has shown an improved yield in protein extraction.

Optimization of Protein Extraction with 50 mM Tris HCl in different volumes:

From the previous section, we know that 50 mM ice-cold Tris HCl, pH 8.0 has shown improved yield in protein extraction. To acquire the best yield of Serratiopeptidase the final resuspension was done with 50 mM ice-cold Tris HCl, pH 8.0 in different volumes (i.e., 0.5, 1, 1.5, and 1.8 ml).

In the present study, the soluble expression of Serratiopeptidase protein in BL21 (DE3) was done under two different induction conditions. From each condition, five aliquots of 2 ml culture were used for protein extraction. The final protein resuspension of each condition set was re-suspended in the different volumes of 50 mM ice-cold Tris HCl, pH 8.0 in different volumes (i.e., 0.5, 1, 1.5, and 1.8 ml respectively). An SDS-PAGE was run to check the presence of protein expression in soluble form.

Results:
An 80 µl of protein was boiled along with 20 µl of 5x SDS loading dye at 95 °C for 10 minutes. Along with the protein sample, a positive control (1 mg/ml Serratiopeptidase Tablet) was run on SDS-PAGE to confirm the molecular weight at ~50 kDa.

Under Condition 1: BL21 Serra was induced with 0.5 mM IPTG. A band was seen at ~50 kDa confirming the size and soluble expression as shown in FIG. 9. Among the five samples, the sample re-suspended in 1.5 ml ice-cold Tris HCl, pH 8.0 showed the best yield.

Under Condition 2: BL21 Serra was induced with 50 mM Lactose. A band was seen at ~50 kDa confirming the size and soluble expression as shown in FIG. 10. Among the five samples, the sample re-suspended in 1.5 ml ice-cold Tris HCl, pH 8.0 showed the best yield.

EXAMPLE 4: PROTEOLYTIC ACTIVITY ASSAY OF RECOMBINANT SERRATIOPEPTIDASE USING MILK POWDER AS SUBSTRATE

Milk powder 1 mg/ml stock- Nestle Everyday Lot: 308204515A was embedded in the resolving gel during the preparation of acrylamide gel. The samples from both 0.1 mM IPTG-induced and 0.5 mM IPTG-induced cells were studied.

Table 3: 12 % Resolving gel for Zymogram
Sr. No. Components Volume
1. 30% Acrylamide mix 2 ml
2. 1.5 M Tris, pH 8.8 1.3 ml
3. 10% SDS 50 µl
4. 10% Ammonium persulfate 50 µl
5. 1 mg/ml Milk powder 1 ml
6. MilliQ water 650 µl
7. TEMED 5 µl

Table 4: Stacking gel composition
Sr. No. Components Volume
1. 30% Acrylamide mix 330 µl
2. 0.5 M Tris, pH 6.8 250 µl
3. 10% SDS 20 µl
4. 10% Ammonium persulfate 20 µl
5. Milli Q water 1.4 ml
6. TEMED 5 µl

The 2.5 ml pellet was resuspended in different volumes of Magnesium Sulphate as seen in step 6 of the protein extraction protocol (refer Example 2). The different volumes of Magnesium Sulphate range from 500 µl, 1 ml, 1.5 ml and 2 ml. 30 µl of aliquot from each sample is loaded on the 5 gel lanes adjacent to the protein ladder as shown in FIG. 4. The electrophoresis was performed and the zymogram was studied as shown in FIG. 4.

Results:
The zone clearance region in the Zymogram gel confirms the proteolytic activity of the protein Serratiopeptidase at the respective (50 kDa) position upon induction with 0.1 mM and 0.5 mM IPTG induction.

EXAMPLE 5: PROTEOLYTIC ACTIVITY ASSAY OF RECOMBINANT SERRATIOPEPTIDASE USING CASEIN AS SUBSTRATE

Casein powder (CAS No. 9000-71-9) was embedded in the resolving gel during the preparation of acrylamide gel. The samples from both the induction studies were processed as mentioned below.

1. The 80 µl of direct protein supernatant was used for the Zymogram where the casein powder (CAS No. 9000-71-9) acts as the substrate and in the presence of Serratiopeptidase protein it cleaves and produces a zone of clearance.

2. The composition of the Zymogram is similar to SDS-PAGE i.e., 12% Resolving gel and 5% Stacking gel with a modification i.e., the addition of casein 10 mg/ml into the resolving gel. After gel running the renaturation of the protein was done as the following:

3. The first and two washes were done by immersing the gel in 2.5% Triton-X-100 in Distilled Water for 10 mins each wash.

4. The third and fourth washes were done by using 2.5% Triton-X-100 in 50 mM Tris-HCl (pH -8.0) for 10 mins each wash.

5. After these washes, the Zymogram in 50 mM Tris HCl (pH- 8.0) was incubated at 37 °C for 1 hour 30 mins and then stained the gel by Coomassie blue.

Note: The zymogram should be run at 4 °C.

Resolving Gel:
COMPOSITION VOLUME
Casein 10 mg/ml 1 ml
Milli Q water (MQ) 650 µl
1.5 M Tris-HCl pH 8.8 1.3 ml
30 %Acrylamide 2 ml
10 %SDS 50 µl
10 %APS 50 µl
TEMED 8 µl

Stacking Gel:
COMPOSITION VOLUME
Milli Q water 1.4 ml
0.5M Tris-HCl pH 6.8 330 µl
30% Acrylamide 250 µl
10% SDS 20 µl
10% APS 20 µl
TEMED 5 µl

Results: The Zymogram shows the zone clearance confirms the proteolytic activity of the Serra BL21 protein at the respective (~50 kDa) position along with the positive control (1 mg/ml Serratiopeptidase Tablet) upon induction with 0.5 mM IPTG and 50 mM Lactose induction.

Condition 1: BL21 Serra was induced with 0.5 mM IPTG. A zone of clearance was seen at ~50 kDa in both FIG. 11A and FIG. 13A indicating proteolytic activity.

Condition 2: BL21 Serra was induced with 50 mM Lactose. A zone of clearance was seen at ~50 kDa in both FIG. 12A and FIG. 14A indicating proteolytic activity.

EXAMPLE 6: ESTIMATION OF RECOMBINANT SERRATIOPEPTIDASE PROTEIN USING LOWRY’S METHOD

The concentration of the protein in the extracted supernatant was analyzed using Lowry’s method. The samples from both 0.1 mM IPTG-induced and 0.5 mM IPTG-induced cells were studied. The 2.5 ml pellet was resuspended in different volumes of Magnesium Sulphate as seen in step 6 of the protein extraction protocol (Example 2), wherein the different volumes of Magnesium Sulphate ranges from 500 µl, 1 ml, 1.5 ml and 2 ml. From these volumes, 100 µl of the sample was taken each and the protein was estimated. The absorbance of the samples was measured against the blank and working standards. FIG. 15 provides the absorbance at 660 nm, and Table 5 provides the concentration of proteins measured.

Table 5: Concentration of protein at different molarity of IPTG induction.
Resuspension of 2.5 ml pellet in the volume of MgSO4 The volume of unknown samples taken Absorbance at 660 nm (0.1 mM
induction) Concentration Absorbance at 660 nm (0.5 mM
induction) Concentration
500 µl 100 µl 0.1523 212.5 0.12185 178.5
1.0 ml 100 µl 0.12845 178.5 0.1115 154.2
1.5 ml 100 µl 0.1122 155.2 0.1376 191.5
2.0 ml 100 µl 0.11165 154.5 0.1082 149.5

Results:
The average yield of the recombinant soluble Serratiopeptidase protein was found to be 100 mg/L in E. coli BL21 (DE3) cells.

Upon comparing the Serratiopeptidase protein concentration with the prior art, the concentration of the protein in the present invention was found to be higher than all prior art disclosures as seen in Table 6.

Table 6: Comparison of the present invention with the prior arts.
Prior art Source of Serratiopeptidase Yield and activity of Serratiopeptidase
mg/L EU/ml EU/mg
Tao et al., 2007 Recombinant E. coli - 132 -
Badhe et al., 2009 S. marcescens - 27.36 -
Pansuriya & Singhal, 2010 S. marcescens - 7034 -
Mohankumar, 2011 S. marcescens - 1450.75 -
Wagdarikar et al.,
2015 S. marcescens - 22.85 -
Kaviyarasi & Suryanarayan, 2016 Recombinant P. pastoris
-
- 50
Srivastava et al., 2019 Recombinant E. coli 40-45 - 1750±5
(azocasein)
Gopinath S. et al.,
2020 Mutant S. marcescens - 3437.6 -
Doshi et al., 2020 Recombinant E. coli 80 - -
Selvarajan et. al,
2021 Recombinant E. coli 0.646 200 309.59
Present invention Recombinant E. coli 60-80 - 165.7

The present invention solves the problem of solubilization of inclusion bodies and refolding of the Serratiopeptidase protein over the existing prior arts. The present invention further reduces the downstream processing steps and makes the process industrially viable, cost-effective, and efficient.
,CLAIMS:

1. A process for expressing soluble recombinant protein Serratiopeptidase in a periplasmic space of a host cell, comprising the steps of:
i) cloning Serratiopeptidase gene into an expression vector;
ii) expressing recombinant Serratiopeptidase in a periplasmic region of the host cell using an inducer;
iii) centrifuging the cells followed by resuspension of pellet in an ice-cold buffer for washing;
iv) centrifuging and re-suspending the pellet in hypertonic buffer solution with or without EDTA, followed by cold centrifugation;
v) resuspending the pellet in a cold hypotonic solution, followed by centrifugation; and
vi) collecting supernatant containing the periplasmic protein.

2. The process as claimed in claim 1, wherein the expression vector in step (i) is pET22b vector.

3. The process as claimed in claim 1, wherein the host cell in step (ii) is E. coli BL21 (DE3) strain.

4. The process as claimed in claim 1, wherein the inducer in step (ii) is selected from a group comprising IPTG, lactose, allolactose or other lactose analogues.

5. The process as claimed in claim 1, wherein the concentration of the inducer is 0.1 mM to 50 mM.

6. The process as claimed in claim 1, wherein the buffer in step (iii) is selected from a group comprising PBS, Tris buffer, or Phosphate buffer.

7. The process as claimed in claim 1, wherein the buffer solution in step (iv) is selected from a group comprising Tris-Sucrose solution, Tris-Sucrose-EDTA solution and Spheroplast buffer.

8. The process as claimed in claim 7, wherein the buffer solution is Tris Sucrose solution or Spheroplast Buffer.

9. The process as claimed in claim 8, wherein the concentration of Tris buffer in Tris-Sucrose solution ranges from 30 to 100 mM.

10. The process as claimed in claim 8, wherein the concentration of Sucrose in Tris-Sucrose solution ranges from 5 to 20%.

11. The process as claimed in claim 8, wherein the concentration of Sucrose in Tris-Sucrose solution ranges from 10 to 50 mM.

12. The process as claimed in claim 7, wherein the Spheroplast buffer is hypertonic buffer with or without EDTA.

13. The process as claimed in claim 1, wherein the hypotonic solution in step (v) is selected from a group comprising Magnesium Sulphate, Magnesium Chloride, Tris-HCl, Tris-Acetate, or water.

14. The process as claimed in claim 13, wherein the concentration of hypotonic solution ranges from 5 mM to 50 mM.

15. The process as claimed in claim 14, wherein the resuspension volumes of 50 mM Tris-HCl range from 0.5 ml to 1.8 ml per 2ml of culture volume.

Documents

Application Documents

# Name Date
1 202341078352-STATEMENT OF UNDERTAKING (FORM 3) [17-11-2023(online)].pdf 2023-11-17
2 202341078352-PROVISIONAL SPECIFICATION [17-11-2023(online)].pdf 2023-11-17
3 202341078352-PROOF OF RIGHT [17-11-2023(online)].pdf 2023-11-17
4 202341078352-POWER OF AUTHORITY [17-11-2023(online)].pdf 2023-11-17
5 202341078352-FORM FOR SMALL ENTITY(FORM-28) [17-11-2023(online)].pdf 2023-11-17
6 202341078352-FORM FOR SMALL ENTITY [17-11-2023(online)].pdf 2023-11-17
7 202341078352-FORM 1 [17-11-2023(online)].pdf 2023-11-17
8 202341078352-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [17-11-2023(online)].pdf 2023-11-17
9 202341078352-EVIDENCE FOR REGISTRATION UNDER SSI [17-11-2023(online)].pdf 2023-11-17
10 202341078352-DRAWINGS [17-11-2023(online)].pdf 2023-11-17
11 202341078352-DECLARATION OF INVENTORSHIP (FORM 5) [17-11-2023(online)].pdf 2023-11-17
12 202341078352-RELEVANT DOCUMENTS [04-04-2024(online)].pdf 2024-04-04
13 202341078352-FORM 13 [04-04-2024(online)].pdf 2024-04-04
14 202341078352-AMENDED DOCUMENTS [04-04-2024(online)].pdf 2024-04-04
15 202341078352-FORM-5 [17-09-2024(online)].pdf 2024-09-17
16 202341078352-FORM FOR SMALL ENTITY [17-09-2024(online)].pdf 2024-09-17
17 202341078352-FORM 3 [17-09-2024(online)].pdf 2024-09-17
18 202341078352-EVIDENCE FOR REGISTRATION UNDER SSI [17-09-2024(online)].pdf 2024-09-17
19 202341078352-DRAWING [17-09-2024(online)].pdf 2024-09-17
20 202341078352-CORRESPONDENCE-OTHERS [17-09-2024(online)].pdf 2024-09-17
21 202341078352-COMPLETE SPECIFICATION [17-09-2024(online)].pdf 2024-09-17