Abstract: The invention provides a guide RNA [gRNA], a kit, a composition, and a method for detecting genetic variations such as Sickle Cell Anemia (SCA) and identifying carriers through an optimized point-of-care CRISPR-based assay. The gRNA detects SCA-specific nucleotide changes using distinct mixes for Haemoglobin A (HbA) and Haemoglobin S (HbS). The guide RNA with a plurality of SNP recognition sites is constructed through the mediation of hybridization chain reaction, where a plurality of Cas12b protein is combined. The guide RNA disclosed herein is capable of determining the homozygous or heterozygous or carrier state of sickle cell disease.
1. A guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2.
2. The guide RNA as claimed in claim 1, wherein the sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6.
3. The guide RNA as claimed in claim 1, wherein the guide RNA is capable of detecting single nucleotide polymorphism (SNP).
4. The guide RNA as claimed in claim 1, wherein the guide RNA is a guide for Cas12 nuclease.
5. The guide RNA as claimed in claim 4, wherein the guide RNA is a guide for Cas12b nuclease.
6. The guide RNA as claimed in claim 1, wherein the guide RNA is capable of detecting sickle cell disease, preferably sickle cell anemia.
7. The guide RNA as claimed in claim 6, wherein the guide RNA is capable of determining homozygous or heterozygous or a carrier state of sickle cell disease.
8. The guide RNA as claimed in claim 7, wherein the guide RNA recognizes target nucleic acid comprising SNP and directs the Cas12b nuclease for editing.
9. The guide RNA as claimed in claim 8, wherein the target nucleic acid comprising the SNP is encoded by rs334 gene.
10. A composition comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8 and Cas 12 nuclease.
11. The composition as claimed in claim 10, wherein components of the composition are lyophilized and stable at room temperature
12. The composition as claimed in claim 10, wherein the sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3-6.
13. The composition as claimed in claim 10, wherein the Cas12 nuclease is Cas12b nuclease.
14. The composition as claimed in claim 10, wherein the composition further comprises a fluorescent agent or components for lateral flow.
15. A kit comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8, Cas 12 nuclease, fluorescent agent or a lateral flow strip along with an instruction manual.
16. The kit as claimed in claim 15, wherein the guide RNA having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6.
17. The kit as claimed in claim 16, wherein the Cas 12 nuclease is Cas 12b nuclease and the fluorescence agent is selected from a group comprising FAM, HEX, Cy5 Cy3 and combination thereof.
18. The kit as claimed in claim 15, wherein components of the kit are lyophilized and stable at room temperature
19. A CRISPR-Cas-based nucleic acid detection system comprising the guide RNA as claimed in claim 1 and Cas12 nuclease.
20. The CRISPR-Cas-based nucleic acid detection system as claimed in claim 19, wherein the guide RNA of claim 1 having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6.
21. The CRISPR-Cas-based nucleic acid detection system as claimed in claim 19, wherein the Cas12 nuclease is Cas 12b nuclease.
22. A guide RNA selected from SEQ ID No’s. 1-6, wherein the guide RNA is capable of directing Cas12b nuclease to the site of editing.
23. A method for detecting a target nucleic acid or a genotype variant in a biological sample, said method comprising: ? preparing a CRISPR reaction mixture using the kit of claim 15 or the guide RNA of claim 1 for genotyping HBB gene in a biological sample; ? contacting the biological sample with the CRISPR reaction mixture; and ? detecting presence of the target nucleic acid or a genotype variant and/or level of the detectable signal.
24. The method as claimed in claim 23, wherein the guide RNA is a guide for Cas12 nuclease.
25. The method as claimed in claim 24, wherein the Cas12 nuclease is Cas12b nuclease.
26. The method as claimed in claim 23, wherein the method is capable of detecting sickle cell disease, preferably sickle cell anemia.
27. The method as claimed in claim 26, wherein the method determines homozygous or heterozygous or a carrier state of sickle cell disease.
28. The method as claimed in claim 23, wherein the guide RNA recognizes target nucleic acid or a genotype variant comprising single nucleotide polymorphism [SNP] and directs the Cas12b nuclease for editing.
29. The method as claimed in claim 28, wherein the guide RNA is specific for rs334 SNP.
Description:FIELD OF THE INVENTION
[0001] The present disclosure relates to the field of gene detection. Particularly, the present invention relates to guide RNA (gRNA) for specifically targeting single nucleotide variation in genes and a method for detection of such variation employing the guide RNA in a clustered short palindromic repeat (CRISPR) system. The invention further relates to a kit or a composition comprising the gRNA along with the components for CRISPR based detection.
BACKGROUND OF THE INVENTION
[0002] Sickle cell disease is a genetic disorder caused by mutations in hemoglobin genes, leading to a faulty hemoglobin protein, called hemoglobin S. Generally, sequencing is the most definitive and confirmatory technique for detecting exact nucleic acid changes and allele frequencies. Either NGS or Sanger which actually sequences the DNA is used to detect these changes. The majority of point-of-care tests are based on solubility testing etc., such as HPLC, isoelectric focusing to compare and examine alterations.
[0003] Conventional methods used for detection of Sickle Cell Anemia (SCA) are lengthy, time consuming and complex. The existing diagnostic tests include PCR followed by gel electrophoresis and qPCR-based tests. Some known methods involve HPLC, Sickle SCAN, etc. Since the conventional methods are time consuming, they lead to delays in diagnosis, thereby impacting therapy or treatment of a disease condition. Moreover, these methods also require advanced equipment and skilled personnels, which are not easily available everywhere and specifically in low-resource settings. Additionally, it is difficult to accurately interpret the findings of these tests to identify specific genetic abnormalities. On the whole, existing technologies are challenging and have difficulties in differentiating genetic variations and the associated diseases.
[0004] Therefore, there is a dire need to develop a point-of-care method/assay for the diagnosis of Sickle Cell Anemia (SCA). Currently, there is no commonly known CRISPR-based test for diagnosing SCA.
[0005] The present invention addresses the above limitations and provides products and methods for detecting genotype variants, thereby diagnosing Sickle Cell Anemia (SCA) and identifying carriers through an optimized and low resource setting lab test. The invention provides a CRISPR-based assay which is accurate, faster and is user friendly.
OBJECTIVES OF THE INVENTION
[0006] An objective of the present invention is to provide a guide RNA or a fragment thereof for identifying a target nucleic acid or a genotype variant and capable of detecting sickle cell disease, preferably sickle cell anemia.
[0007] Another objective of the present invention is to provide a guide RNA or a fragment thereof capable of determining the homozygous or heterozygous/carrier state of sickle cell disease.
[0008] Yet another objective of the present invention is to provide a guide RNA or a fragment thereof that recognizes target nucleic acid comprising SNP and directs the Cas12 nuclease for editing.
[0009] Another objective of the present invention is to provide a CRISPR-Cas-based nucleic acid detection system comprising the guide RNA and Cas12 nuclease.
[0010] Another objective of the present invention is to provide a method for detecting a target nucleic acid or a genotype variant in a biological sample with enhanced accuracy and speed in diagnosing Sickle Cell Anemia (SCA).
[0011] Yet another objective of the present invention is to provide a method for detecting SCA in low resource settings, wherein the method employs kit and reagents that are stable at room temperature.
[0012] Another objective of the present invention is to provide a simpler method for identifying carrier status for SCA.
SUMMARY OF THE INVENTION
[0013] The present disclosure relates to a guide RNA or a fragment thereof capable of detecting a target nucleic acid or a genotype variant in a sample. Specifically, the present disclosure provides a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2. The present disclosure provides a guide RNA for Cas12 nuclease.
[0014] Further, the present invention provides a guide RNA useful in detecting sickle cell disease, preferably sickle cell anemia. Particularly, the present invention provides a guide RNA that recognizes target nucleic acid comprising the SNP encoded by rs334 gene.
[0015] In some embodiment, the present disclosure provides a kit comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8, Cas 12 nuclease, fluorescent agent or a lateral flow strip along with an instruction manual.
[0016] In some embodiment, the present disclosure provides a composition comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8 and Cas 12 nuclease.
[0017] Preferably, the present disclosure provides a CRISPR-Cas-based nucleic acid detection system comprising the guide RNA and Cas12 nuclease wherein the guide RNA is selected from SEQ ID No’s. 1-6 capable of directing Cas12b nuclease to the site of edit followed by trans-cleavage.
[0018] The present disclosure also describes a method for detecting a target nucleic acid or a genotype variant in a biological sample, wherein the method comprises steps of:
? preparing a CRISPR reaction mixture comprising of room temperature stable reagents using the kit or the guide RNA for genotyping the HBB gene in a biological sample;
? contacting the biological sample with the CRISPR reaction mixture; and
? detecting the presence of the target nucleic acid or a genotype variant and/or level of the detectable signal.
BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
[0019] The accompanying drawings, which are incorporated in and constitute a part of this disclosure, illustrate exemplary embodiments and together with the description, serve to explain the disclosed invention.
[0020] Figure 1 shows the variants of SNP, Primers, and CRISPR Guides, in accordance with the present invention.
[0021] Figure 2A-2F shows the results obtained using the guide RNA of the invention on various samples. Results showing that guides effectively distinguish between (a) wild type (AA), (b) homozygous mutant (SS), and (c) heterozygous (A/S) samples with high accuracy.
[0022] Figure 3 shows the results for Cas12b trans-cleavage distinguishing between wild type (AA), homozygous mutant (SS), and heterozygous (A/S) samples with high accuracy.
[0023] Figure 4 shows evaluation of the Cas12b trans-cleavage assay for detecting sickle cell anemia (SCA) genotypes across various sample types. The analysis included two control HapMap samples with known genotypes, 28 blinded clinical samples (TS series), and 16 clinical samples (BG series) with disclosed genotypes verified by Sanger sequencing. The assay successfully distinguished between wildtype (AA), homozygous mutant (SS), and heterozygous (AS) genotypes, demonstrating its high accuracy and reliability in genotypic differentiation.
[0024] Figure 5 shows the PCR amplification and efficient detection of SCA genotypes using lateral flow assay.
[0025] Figure 6 shows the sequencing results of multiple actual SCA clinical samples for exon 1 of the HBB gene to depict the spread of genotypes, in accordance with the present invention.
[0026] Other embodiments, features, and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from the detailed description, such changes and modifications are covered within the scope of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
[0027] The details of one or more embodiments of the invention are set forth in the accompanying description below including specific details of the best mode contemplated by the inventors for carrying out the invention, by way of example. It will be apparent to one skilled in the art that the present invention may be practiced without limitation to these specific details.
[0028] The use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. Particularly, the word “comprising” is intended to be used to cover within its ambit other possible components or ingredients or steps or features of an aspect or embodiment of the invention which are apparent to a skilled person after reading the present disclosure. The word “comprising” is intended to mean “including” but not necessarily “consisting of” or “composed of.” It is to be understood that the description is exemplary and explanatory only, and is not restrictive.
[0029] It is noted that the examples given in the description below are intended to clarify the invention and are not intended to limit the invention to those examples per se. Except in the operating and comparative examples, or where otherwise explicitly indicated, all numbers in this description and claims indicating amounts of material or conditions of reaction, physical properties of materials and/or use are to be understood as modified by the word “about”. Numerical ranges expressed in the format "from x to y" or “between x to y” are understood to include x and y. When for a specific feature, multiple preferred ranges are described in the format "from x to y" or “between x to y”, it is understood that all ranges combining the different endpoints are also contemplated.
[0030] Unless otherwise defined, scientific and technical terms used herein shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures utilized in connection with, and techniques of, such as cell and tissue culture, molecular biology described herein are those well-known and commonly used in the art.
[0031] The present invention aims to overcome the defects of the prior art and provides a guide RNA (gRNA), and a CRISPR-Cas based nucleic acid detection system for the detection of target nucleic acid or a genotype variant, particularly for the identification of SCA-associated mutations. The gRNA of the present invention has higher targeting efficiency, thereby resulting in detection of homozygous or heterozygous/ carrier state of sickle cell disease with high accuracy.
[0032] The present inventors designed a guide RNA that specifically identifies rs334 SNP in HBB gene, even when rs713040 SNP is also present and distinguish between wild-type, sickle cell anemia (SCA) mutant, heterozygous genotypes or a carrier state. By integrating Polymerase Chain Reaction (PCR) with CRISPR Cas12b technology, the present assay detects SCA-specific nucleotide changes using distinct mixes for Hemoglobin A (HbA) and Hemoglobin S (HbS). The present invention ensures accurate identification of normal, diseased and carrier genotypes of Sickle Cell Anemia (SCA) via fluorescence signal amplification or lateral flow assay.
[0033] These and other aspects, features, and advantages of the invention will become apparent to those of ordinary skill in the art from a reading of the following detailed description and the appended claims.
[0034] In a specific embodiment, the present invention provides guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2.
[0035] In a preferred embodiment, the present invention provides guide RNA, wherein the sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6.
[0036] The guide-RNAs of the invention are designed to achieve accurate and reliable Sickle Cell Anemia diagnosis. The inventors aimed to design a sequence which precisely identifies the target mutation (rs334) in HBB gene and where the downstream SNP mismatch will not interfere with the genotyping despite its overlap and proximity. The other SNP rs713040 is <15bp away from the rs334. Additionally, the distinction of 0, 1 and 2 alleles of the SCA SNP detection is maintained. Downstream SNP which overlaps with the guide would not interfere in the genotyping of rs334.
[0037] In a preferred embodiment, the guide RNA is capable of detecting single nucleotide polymorphism (SNP).
[0038] In another embodiment, the guide RNA is a guide for Cas12 nuclease.
[0039] In a preferred embodiment, the guide RNA is a guide for Cas12b nuclease.
[0040] In yet another preferred embodiment, the guide RNA finds application in detecting sickle cell disease, preferably sickle cell anemia.
[0041] In a preferred embodiment, the guide RNA is capable of determining homozygous or heterozygous or a carrier state of sickle cell disease.
[0042] In yet another preferred embodiment, the guide RNA recognizes target nucleic acid comprising SNP and directs the Cas12b nuclease for editing followed by trans-cleavage activity.
[0043] In a preferred embodiment, the target nucleic acid comprising the SNP is encoded by rs334 gene.
[0044] The present invention also provides a composition comprising a guide RNA comprising SEQ ID No. 1 or SEQ ID No. 2 or a fragment thereof or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer comprising SEQ ID No. 7 and 8 or a fragment thereof or a sequence having at least 85% identity to the SEQ ID No. 7 and 8, and Cas 12 nuclease.
[0045] In another embodiment, components of the composition are lyophilized and stable at room temperature.
[0046] In a preferred embodiment, the sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 is selected from sequences comprising SEQ ID No’s 3-6.
[0047] In a preferred embodiment, the Cas12 nuclease is Cas12b nuclease.
[0048] In yet another embodiment, the composition further comprises a fluorescent agent or components for lateral flow.
[0049] The present invention also provides a kit comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8, Cas 12 nuclease, fluorescent agent or a lateral flow strip along with an instruction manual.
[0050] In a preferred embodiment, the guide RNA having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No. 3- 6.
[0051] In another embodiment of the invention, the Cas 12 nuclease is Cas 12b nuclease.
[0052] In yet another embodiment, the fluorescence agent is selected from a group comprising but not limiting to FAM, HEX, Cy5, Cy3.
[0053] In yet another embodiment, components of the kit are lyophilized and stable at room temperature
[0054] The present invention also provides a CRISPR-Cas-based nucleic acid detection system comprising the guide RNA and Cas12 nuclease.
[0055] In an embodiment, the detection system of the invention comprises guide RNA represented by SEQ ID N0. 1 or 2 or a fragment thereof or a sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2. The detection system of the invention may additionally comprise primers.
[0056] In a preferred embodiment, the CRISPR-Cas-based nucleic acid detection system comprising the guide RNA having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3 to 6.
[0057] In yet another embodiment of the invention, the Cas12 nuclease is Cas 12b nuclease.
[0058] In another embodiment, the present invention provides a guide RNA selected from SEQ ID No’s. 1-6, wherein the guide RNA is capable of directing Cas12b nuclease to the site of editing.
[0059] The present invention also provides a method for detecting a target nucleic acid or a genotype variant, in a biological sample, said method comprising:
? preparing a CRISPR reaction mixture or the guide RNA for genotyping the HBB gene in a biological sample;
? contacting the biological sample with the CRISPR reaction mixture; and
? detecting the presence of the target SNP in the nucleic acid or a genotype variant with a detectable signal above a defined threshold.
[0060] In an embodiment, the method of the present invention is the first instantiation of a CRISPR diagnostic test proposing to detect SNP with Cas12b and clearly identifying heterozygous, homozygous and carrier state for SCA.
[0061] In yet another embodiment of the invention, the guide RNA is a guide for Cas12 nuclease.
[0062] In a preferred embodiment of the invention, the Cas 12 nuclease is Cas12b nuclease.
[0063] In a preferred embodiment of the invention, the method is capable of detecting sickle cell disease, preferably sickle cell anemia.
[0064] In yet another embodiment of the invention, the method determines the homozygous or heterozygous or carrier state of sickle cell disease.
[0065] In another preferred embodiment, the guide RNA recognizes target nucleic acid or a genotype variant comprising single nucleotide polymorphism [SNP] and directs the Cas12b nuclease for editing followed by trans-cleavage activity.
[0066] In a more preferred embodiment, the guide RNA is specific for the rs334 gene.
[0067] In a preferred embodiment, the present invention provides a method for detecting a target nucleic acid or a genotype variant in a biological sample, said method comprising:
? amplifying the target nucleic acid containing the rs334 SNP using polymerase chain reaction (PCR) to generate adequate quantities for the CRISPR assay;
? preparing CRISPR Reaction Mixture by incorporating guide RNA (gRNA) specific to the HbA and HbS variants, which allows for precise target recognition by the Cas12b enzyme; and
? detecting the target SNP through a fluorescent signal or lateral flow strips.
[0068] In an embodiment of the present invention, the genomic DNA extracted from the biological sample is mixed with PCR reagents to produce the amplicon, which is subsequently combined with the CRISPR reaction mixture for effective target engagement.
[0069] In another embodiment of the present invention, the method effectively combines PCR with CRISPR technology, offering a rapid and accurate approach for genotyping the HBB gene variant, thereby improving the feasibility of point-of-care diagnostics.
[0070] In yet another embodiment of the present invention, the method utilizes a kit containing amplification and CRISPR reagents that are stable at room temperature, simplifying storage and enabling point-of-care applications.
[0071] The following examples are given by way of illustration and for better understanding of the present invention and should not be construed to limit the scope of the present invention.
[0072] The essence of the invention therefore resides in the design of the guide RNA, which can specifically detect SCA mutant. The guide RNA of the present invention is capable of determining the homozygous or heterozygous or carrier state of sickle cell disease. Further, the preferred use of Cas12b in the method of the invention allows for the use of an inherent PAM site already present in the gene sequence [Figure 1]. The distance from the PAM, the choice of the Cas enzyme and the design of the guides altogether contribute to the invention.
The invention thus provides products/methods that has enhanced accuracy and speed in diagnosing diseases associated with genetic variations such as Sickle Cell Anemia (SCA), improving diagnosis outcomes through quicker and more precise genetic testing in resource limited settings.
EXAMPLES
Methods and Materials:
Methods:
i) CRISPR-Enhanced PCR Assay for Genotyping Sickle Cell Anemia
This assay combines polymerase chain reaction (PCR) with CRISPR-based trans-cleavage to identify genotypes associated with sickle cell anemia (SCA), specifically wildtype (AA), homozygous mutant (SS), and heterozygous (AS) forms. Initially, the target DNA sequence containing the rs334 mutation is amplified using the OneTaq HotStart 2X Master Mix, which provides the necessary DNA polymerase, primers targeting the SCA locus, buffer, deoxynucleotide triphosphates (dNTPs), and magnesium ions to ensure efficient PCR amplification of the targeted sequences.
After PCR, two CRISPR detection mixtures are prepared:
? HbA Detection Mix: This includes a guide RNA targeting the HbA allele, the AapCas12b enzyme, and a FAM-labeled reporter probe.
? HbS Detection Mix: This contains a guide RNA specific to the HbS allele, the AapCas12b enzyme, and a separate FAM-labeled reporter probe.
Both detection mixes are incubated at room temperature for 10 minutes, after which the PCR amplicons are introduced to allow CRISPR-based target recognition and cleavage.
For fluorescence-based detection, a fluorescent reporter is used in the reaction. When the Cas12b enzyme cleaves the target DNA, the reporter releases a fluorescence signal, which varies in intensity depending on the genotype:
? High fluorescence for HbA indicates a wildtype (AA) genotype.
? High fluorescence for HbS indicates a homozygous mutant (SS) genotype.
? Elevated fluorescence for both HbA and HbS indicates a heterozygous (AS) carrier status.
This method improves diagnostic precision by clearly differentiating between AA, AS, and SS genotypes, enabling prompt and accurate diagnosis crucial for managing sickle cell disease in clinical settings.
ii) PCR-CRISPR Lateral Flow Assay for Precise Genotyping of Sickle Cell Anemia
This assay combines PCR amplification, CRISPR-Cas12b trans-cleavage, and lateral flow detection to accurately differentiate among genotypes associated with sickle cell anemia (SCA): wildtype (AA), homozygous mutant (SS), and heterozygous (AS). The process starts with PCR amplification using OneTaq HotStart 2X Master Mix, which contains thermostable DNA polymerase, primers targeting the SCA locus, dNTPs, and magnesium ions to ensure efficient DNA amplification.
Following PCR, two unique CRISPR detection mixes are prepared:
? HbA Detection Mix: Includes a guide RNA targeting the HbA allele, AapCas12b enzyme, and a biotin-labeled reporter probe.
? HbS Detection Mix: Contains a guide RNA specific to the HbS allele, AapCas12b enzyme, and a distinct biotin-labeled reporter probe.
Each detection mix is incubated at room temperature for 10 minutes, after which the PCR amplicons are added to enable allele-specific target recognition and cleavage by Cas12b. Upon successful cleavage, the biotin-labeled reporter is cleaved if the target allele (HbA or HbS) is detected.
For result interpretation, lateral flow strips are immersed in each reaction. These strips have gold-labeled anti-biotin antibodies that bind to the cleaved biotinylated reporters, producing a visual result:
? Two test lines (one for each of HbA and HbS) indicate an AS genotype.
? A single test line in either the HbA or HbS detection mix confirms an AA or SS genotype, respectively.
This method provides a fast, visual, and reliable genotyping tool, ideal for clinical and point-of-care settings due to its minimal instrumentation requirements and straightforward result interpretation.
iii) Lyophilized PCR-CRISPR Assay for Sickle Cell Disease Genotyping
We have developed a lyophilized PCR mix and detection reagents for Sickle Cell Disease (SCD) genotyping, including CRISPR-Cas12 guides targeting the HbA and HbS alleles. This lyophilized format enhances stability and reduces the need for cold storage, making it well-suited for deployment in resource-limited settings where refrigeration may be inconsistent.
Lyophilized PCR Mix
The lyophilized PCR mix contains all necessary reagents for DNA amplification, including Reaction buffer, OneTaq HotStart DNA Polymerase, dNTPs, Magnesium ions and primers targeting the SCA locus
These components are freeze-dried to increase shelf life and improve stability against temperature fluctuations. When ready for use, the mix is reconstituted with a buffer solution and is immediately suitable for amplification in a thermal cycler. This streamlines preparation and reduces setup time in field and clinical applications.
Lyophilized Detection Reagents
After PCR amplification, the reaction proceeds to the CRISPR-Cas12b trans-cleavage detection phase. For this step, two distinct lyophilized detection mixes are prepared:
? HbA Detection Mix: Contains a CRISPR-Cas12b enzyme, guide RNA specific to the HbA (wildtype) allele, buffer and a biotin-labeled reporter probe.
? HbS Detection Mix: Contains a CRISPR-Cas12b enzyme, guide RNA specific to the HbS (mutant) allele, buffer and a biotin-labeled reporter probe.
Once reconstituted, these detection mixes bind specifically to target sequences within the PCR-amplified product. The HbA and HbS mixes enable allele-specific cleavage and are capable of differentiating between wildtype, homozygous SCD (SS), and heterozygous AS carrier genotypes.
Fluorescence Readout
The final step involves a fluorescence-based detection system. When Cas12b cleaves the target DNA, the biotin-labeled reporter releases a detectable fluorescent signal, with distinct fluorescence intensities corresponding to each genotype:
? High fluorescence for HbA confirms a wildtype (AA) genotype.
? High fluorescence for HbS indicates a homozygous SCD (SS) genotype.
? Elevated fluorescence for both HbA and HbS suggests a heterozygous (AS) carrier status.
Key Benefits
This lyophilized assay format provides a rapid and accessible diagnostic solution for SCD genotyping, optimized for point-of-care use in underserved areas. It reduces cold chain dependence, enables easy transport and storage, and ensures a robust and reliable method for detecting SCD and carrier states, thus supporting timely diagnosis and disease management in resource-limited environments.
Materials:
Example 1- Guide RNA and primers
SEQ ID No. 1 - 5’ TCCTCAGGAGTCAGCTGCAC 3’ (Cas12b_A3)
SEQ ID No. 2 - 5’ TCCACAGGAGTCAGCTGCAC 3’ (Cas12b_S3)
SEQ ID No. 3 - 5’ TCCTCAGGAGTCAGATGCAC 3’ (Cas12b_A1)
SEQ ID No. 4 - 5’ TCCACAGGAGTCAGATGCAC 3’ (Cas12b_S1)
SEQ ID No. 5 - 5’ TCCTCAGGAGACAGATGCAC 3’ (Cas12b_A2)
SEQ ID No. 6 - 5’ TCCACAGGAGACAGATGCAC 3’ (Cas12b_S2)
SEQ ID No Primer name Sequence (5’--> 3’)
7 Fwd_HBB_sanger GGCAGAGCCATCTATTG
8 Rvs_HBB_sanger GTCTCCACATGCCCAGTTTCTA
Example 2 - Detection of sickle cell anemia (SCA) mutation (rs334) through Cas12b Trans-Cleavage Assay (fluorescence read out)
Materials and Equipment
? Two control HapMap samples with known genotypes, 28 blinded clinical samples (TS series), and 16 clinical samples (BG series) with disclosed genotypes verified by Sanger sequencing.
? Reagents:
? OneTaq HS 2X Master Mix with Standard Buffer (NEB, M0484S)
? Forward Primer (10 µM)
? Reverse Primer (10 µM)
? Template DNA (100 ng/µL)
? Nuclease-Free Water (NFW)
? Modified NEBuffer 2 (10X)
? Guide RNA (HbA/HbS, 1 µM)
? FAM Reporter (1 µM)
? AapCas12b Enzyme (1 µM)
? Consumables:
? 1.5 mL microcentrifuge tubes
? PCR tubes
? Equipment:
? PCR machine
? Vortex machine
? Fluorescence reader
(I) Preparation of PCR master mix
1. Preparing the PCR master mix for Trans-Cleavage assay, by mixing the components as given in Table 1:
Table 1: Components of the PCR master mix
PCR reagents Volume (µL)
OneTaq HotStart 2X Master Mix 12.5
Forward Primer (10 µM) 0.5
Reverse Primer (10 µM) 0.5
Nuclease-Free Water (NFW) 8.5
Total Volume 24
? Aliquoting 24 µL of the mastermix into individual PCR tubes.
? Adding 1 µL of template DNA (100 ng/µL) to each tube.
? Gently vortexing the tubes and briefly centrifuging to collect the contents at the bottom.
? Loading the tubes into the PCR machine and initiating the following thermal profile as provided in Table 2.
Table 2
Temperature (°C) Time Number of cycles
95 5minutes 1
95 30 seconds 30
60 1 minute
68 1minute
68 5minutes 1
4 8
(II) Preparation of two detection mixes with HbA and HbS guide RNA
1. Preparing two detection mixes:
? One with HbA guide RNA
? One with HbS guide RNA
The components listed in Table 3 below were used for the preparation of the detection mixes containing HbA and HbS guide RNA.
Table 3: Details of the components to prepare detection mixes:
Detection mix reagents 1 reaction
Water 36.4
Modified_NEBuffer 2 (10 X) 5
Guide RNA (1 uM) - HbA / HbS 1.3
FAM Reporter (1 uM) 5
Cas12b (1 uM) 1.3
Total volume 49
2. Allowing the detection mixes to incubate at room temperature for 10 minutes to facilitate the formation of the ribonucleoprotein (RNP) complex.
3. Transfering 49 µL of each detection mix into new PCR tubes.
4. Adding 1 µL of the PCR amplicon to each of the two detection mixes.
5. Briefly vortexing the tubes and spin down.
6. Incubating the tubes for 1 hour at 60°C to allow for the reaction to take place effectively.
(III) Fluorescence Data Acquisition
1. After incubation, the tubes were placed in the fluorescence reader.
2. Measured the end-point fluorescence using the following parameters:
? Excitation wavelength: 485 nm
? Emission wavelength: 520 nm
(VI) Results
Figure 3 highlights that Cas12b-based gRNA trans-cleavage works with high precision in distinguishing between the three genotypes i.e. homozygous wild type, homozygous mutant and heterozygous carrier. Trans-cleavage sensitivity in detecting a specific genomic DNA sample among a series of DNA mixtures/genotypes was evaluated by combining samples in varying ratios. Results in Table 4 confirm that Cas12b-based gRNA improves the quantitative assessment of allelic fraction with better precision as shown in Figure 2A- 2F. Thorough examination of 30 blinded samples was conducted and the results indicate that the present assay was able to accurately identify all genotypes using a machine with fluorescent readout capability such as a qPCR machine. Additionally, the Cas12b trans-cleavage assay demonstrated a high degree of reliability in distinguishing between wild-type (AA), homozygous mutant (SS), and heterozygous (A/S) samples with exceptional precision and high accuracy as shown in Figure 4.
Table 4: Results of the Cas12b - Trans-cleavage assay
Sample HbA Fluorescence HbS Fluorescence Interpretation (Genotype)
Sample A High
Low Wildtype (AA)
Sample B Low High Homozygous mutant (SS)
Sample C High High Heterozygous / Carrier (AS)
NTC Low Low No Template Control (NTC)
Example 3- Detection of sickle cell anemia (SCA) through Cas12b Lateral Flow Assay
Materials and Equipment
Reagents:
? OneTaq HS 2X Master Mix (NEB, M0484S)
? Forward Primer (10 µM)
? Reverse Primer (10 µM)
? Template DNA (100 ng/µL)
? Nuclease-Free Water (NFW)
? Modified NEBuffer 2 (10X)
? Guide RNA (HbA / HbS, 1 µM)
? AapCas12b Enzyme (1 µM)
? Reporter conjugated to gold nanoparticles (FAM-biotin)
Consumables:
? 1.5 mL microcentrifuge tubes
? PCR tubes
? Lateral flow strips (compatible with biotin-FAM detection)
Equipment:
? PCR machine
? Vortex mixer
? Centrifuge
? Lateral flow strips
(I) Preparation of PCR master mix
1. Preparing the PCR mastermix for each reaction using the following components as given in Table 5.
Table 5: Components of the PCR master mix
PCR reagents Volume (µL)
OneTaq HotStart 2X Master Mix 12.5
Forward Primer (10 µM) 0.5
Reverse Primer (10 µM) 0.5
Nuclease-Free Water (NFW) 8.5
Total Volume 24
2. Aliquoting 24 µL of the mastermix into PCR tubes.
3. Adding 1 µL of template DNA (100 ng/µL) to each tube.
4. Gently vortexing and briefly spin down the tubes.
5. Placing the tubes in the PCR machine and using the following thermal cycling profile as provided in below Table 6:
Table 6:
Temperature (°C) Time Number of cycles
95 5minutes 1
95 30 seconds 30
60 1 minute
68 1minute
68 5minutes 1
4 8
(II) Lateral Flow Assay Setup
1. Preparing two detection mixes:
a. One with HbA guide RNA
b. One with HbS guide RNA
Components defined in Table 7 are used to prepare the detection mixes.
Table 7: Details of the components to prepare detection mixes:
Detection mix reagents 1 reaction
Water 32.4
Modified_NEBuffer 2 (10 X) 5
Guide RNA (1 uM) - HbA / HbS 1.3
Biotin Reporter (1 uM) 5
Cas12b (1 uM) 1.3
Total volume 45
2. Incubating the detection mixes at room temperature for 10 minutes to allow ribonucleoprotein (RNP) complex formation.
3. Aliquoting 45 µL of each detection mix into new PCR tubes.
4. Adding 5 µL of the PCR product (amplicon) to each detection mix.
5. Briefly vortexing and spin down the tubes.
6. Incubating the tubes at 60°C for 1 hour.
(III) Detection method by Lateral Flow Assay
1. After the incubation, dipping the lateral flow strips directly into each reaction tube containing the trans-cleavage product.
2. Allowing the strips to develop for 5-10 minutes at room temperature.
(VI) Results
The results are provided in Figure 5 and below Table 8.
Table 8: Results of the Cas12b - Lateral flow assay
Sample Control Line HbA Test Line HbS Test Line Interpretation
Sample A Present Visible None Wildtype (AA)
Sample B Present None Visible Homozygous mutant (SS)
Sample C Present Visible Visible Heterozygous (AS) / Carrier
NTC Present None None No Template Control (NTC)
The data points in the above table and figure 5 shows that the compatibility of the assay with lateral flow detection is a significant advancement, as it enables rapid visual interpretation without the need for specialized equipment. Additionally, the assay's ability to accurately differentiate between AA, SS, and AS genotypes further enhances its practicality for field use. This descriptive feature highlights the effectiveness and versatility of the assay, making it a valuable tool in various settings.
Example 4 - Comparison of Genotype Concordance between Sanger Sequencing and Assay of the present invention for Sickle Cell Anemia Detection
Table 9 provided below presents the genotype [Figure 6] results obtained for clinical samples using both Sanger sequencing and the assay of the present invention. The genotypes include wildtype (AA), homozygous mutant (SS), and heterozygous (A/S) for the HBB gene mutation (rs334), associated with sickle cell anemia. Concordance indicates that both methods yielded the same genotype result, confirming the assay's reliability in accurate genotype determination.
Samples
Sanger data
Genotype assigned by assay of the present invention
Concordance
TS 1
SS
SS
Concordant
TS 2
AA
AA
Concordant
TS 3
A/S
A/S
Concordant
TS 4
SS
SS
Concordant
TS 5
A/S
A/S
Concordant
TS 6
AA
AA
Concordant
TS 7
SS
SS
Concordant
TS 8
A/S
A/S
Concordant
TS 9
AA
AA
Concordant
TS 10
AA
AA
Concordant
TS 11
SS
SS
Concordant
TS 12
AA
AA
Concordant
TS 13
AA
AA
Concordant
TS 14
A/S
A/S
Concordant
TS 15
AA
AA
Concordant
TS 16
A/S
A/S
Concordant
TS 17
SS
SS
Concordant
TS 18
SS
SS
Concordant
TS 19
SS
SS
Concordant
TS 20
AA
AA
Concordant
TS 21
A/S
A/S
Concordant
TS 22
SS
SS
Concordant
TS 23
A/S
A/S
Concordant
TS 24
AA
AA
Concordant
TS 25
SS
SS
Concordant
TS 26
AA
AA
Concordant
TS 27
A/S
A/S
Concordant
TS 28
A/S
A/S
Concordant
BG1
A/S
A/S
Concordant
BG2
A/S
A/S
Concordant
BG3
A/S
A/S
Concordant
BG4
A/S
A/S
Concordant
BG5
AA
AA
Concordant
BG6
AA
AA
Concordant
BG7
AA
AA
Concordant
BG8
SS
SS
Concordant
BG9
SS
SS
Concordant
BG10
SS
SS
Concordant
BG11
A/S
A/S
Concordant
BG12
A/S
A/S
Concordant
BG13
A/S
A/S
Concordant
BG14
A/S
A/S
Concordant
BG15
A/S
A/S
Concordant
BG16
A/S
A/S
Concordant
The present invention has been particularly shown and described with reference to exemplary embodiments thereof. It is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art in light of the above teachings. Accordingly, the spirit of the present invention should be understood in accordance with the claims set forth below, and all of its equivalents fall within the scope of the present invention.
Advantages of the invention:
1. Precision and Specificity: The CRISPR-based assay of the present invention targets specific nucleotide changes with high precision, addressing effectively the variability and specificity issues faced by conventional methods. By integrating Polymerase Chain Reaction (PCR) with CRISPR Cas12b technology, the present invention provides an assay that detects SCA-specific nucleotide changes using distinct mixes for Hemoglobin A (HbA) and Hemoglobin S (HbS). The assay of the present invention ensures accurate identification of normal, diseased, and carrier genotypes.
2. Turnaround Time: By combining PCR with CRISPR Cas12b and stable reagents stored at room temperature due to lyophilization, the assay of the present invention streamlines the diagnostic process, substantially leading to a possibility of testing in Primary Health Care units and closer to the point of need. This offers faster results compared to the traditional, multi-step methods in central labs which are difficult to scale up.
3. Simplified Interpretation: The fluorescence-based readout of the present assay provides clear and easily interpretable results, simplifying result interpretation, reducing potential errors, and streamlining the diagnostic process compared to the more complex traditional methods.
4. Point of care Application: The Present invention addresses the critical need of diagnosing Sickle Cell Anemia (SCA) and identifying carriers through an optimized point-of-care assay which is accurate, faster and easier to understand. The present assay is optimized for point-of-care use in low-resource environments, making it more practical and accessible where resources are limited.
5. Simple and Cost-effective: The synthesized guide RNA is simple, sensitive, and provides cost-effective detection of SCA.
6. Precise detection of carrier genotypes: The method using specific guide RNA identifying the specific SNP is capable of precisely detecting carrier genotypes.
, Claims:
1. A guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2.
2. The guide RNA as claimed in claim 1, wherein the sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6.
3. The guide RNA as claimed in claim 1, wherein the guide RNA is capable of detecting single nucleotide polymorphism (SNP).
4. The guide RNA as claimed in claim 1, wherein the guide RNA is a guide for Cas12 nuclease.
5. The guide RNA as claimed in claim 4, wherein the guide RNA is a guide for Cas12b nuclease.
6. The guide RNA as claimed in claim 1, wherein the guide RNA is capable of detecting sickle cell disease, preferably sickle cell anemia.
7. The guide RNA as claimed in claim 6, wherein the guide RNA is capable of determining homozygous or heterozygous or a carrier state of sickle cell disease.
8. The guide RNA as claimed in claim 7, wherein the guide RNA recognizes target nucleic acid comprising SNP and directs the Cas12b nuclease for editing.
9. The guide RNA as claimed in claim 8, wherein the target nucleic acid comprising the SNP is encoded by rs334 gene.
10. A composition comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8 and Cas 12 nuclease.
11. The composition as claimed in claim 10, wherein components of the composition are lyophilized and stable at room temperature
12. The composition as claimed in claim 10, wherein the sequence having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3-6.
13. The composition as claimed in claim 10, wherein the Cas12 nuclease is Cas12b nuclease.
14. The composition as claimed in claim 10, wherein the composition further comprises a fluorescent agent or components for lateral flow.
15. A kit comprising a guide RNA or a fragment thereof comprising SEQ ID No. 1 or SEQ ID No. 2 or a sequence having at least 85% identity with SEQ ID No. 1 or SEQ ID No. 2, primer or a fragment thereof comprising SEQ ID No. 7 and 8 or a sequence having at least 85% identity to the SEQ ID No. 7 and 8, Cas 12 nuclease, fluorescent agent or a lateral flow strip along with an instruction manual.
16. The kit as claimed in claim 15, wherein the guide RNA having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6.
17. The kit as claimed in claim 16, wherein the Cas 12 nuclease is Cas 12b nuclease and the fluorescence agent is selected from a group comprising FAM, HEX, Cy5 Cy3 and combination thereof.
18. The kit as claimed in claim 15, wherein components of the kit are lyophilized and stable at room temperature
19. A CRISPR-Cas-based nucleic acid detection system comprising the guide RNA as claimed in claim 1 and Cas12 nuclease.
20. The CRISPR-Cas-based nucleic acid detection system as claimed in claim 19, wherein the guide RNA of claim 1 having at least 85% sequence identity to SEQ ID No. 1 and SEQ ID No. 2 are selected from sequences comprising SEQ ID No’s 3- 6.
21. The CRISPR-Cas-based nucleic acid detection system as claimed in claim 19, wherein the Cas12 nuclease is Cas 12b nuclease.
22. A guide RNA selected from SEQ ID No’s. 1-6, wherein the guide RNA is capable of directing Cas12b nuclease to the site of editing.
23. A method for detecting a target nucleic acid or a genotype variant in a biological sample, said method comprising:
? preparing a CRISPR reaction mixture using the kit of claim 15 or the guide RNA of claim 1 for genotyping HBB gene in a biological sample;
? contacting the biological sample with the CRISPR reaction mixture; and
? detecting presence of the target nucleic acid or a genotype variant and/or level of the detectable signal.
24. The method as claimed in claim 23, wherein the guide RNA is a guide for Cas12 nuclease.
25. The method as claimed in claim 24, wherein the Cas12 nuclease is Cas12b nuclease.
26. The method as claimed in claim 23, wherein the method is capable of detecting sickle cell disease, preferably sickle cell anemia.
27. The method as claimed in claim 26, wherein the method determines homozygous or heterozygous or a carrier state of sickle cell disease.
28. The method as claimed in claim 23, wherein the guide RNA recognizes target nucleic acid or a genotype variant comprising single nucleotide polymorphism [SNP] and directs the Cas12b nuclease for editing.
29. The method as claimed in claim 28, wherein the guide RNA is specific for rs334 SNP.
| # | Name | Date |
|---|---|---|
| 1 | 202411084372-STATEMENT OF UNDERTAKING (FORM 3) [05-11-2024(online)].pdf | 2024-11-05 |
| 2 | 202411084372-FORM FOR STARTUP [05-11-2024(online)].pdf | 2024-11-05 |
| 3 | 202411084372-FORM FOR SMALL ENTITY(FORM-28) [05-11-2024(online)].pdf | 2024-11-05 |
| 4 | 202411084372-FORM 1 [05-11-2024(online)].pdf | 2024-11-05 |
| 5 | 202411084372-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [05-11-2024(online)].pdf | 2024-11-05 |
| 6 | 202411084372-DRAWINGS [05-11-2024(online)].pdf | 2024-11-05 |
| 7 | 202411084372-DECLARATION OF INVENTORSHIP (FORM 5) [05-11-2024(online)].pdf | 2024-11-05 |
| 8 | 202411084372-COMPLETE SPECIFICATION [05-11-2024(online)].pdf | 2024-11-05 |
| 9 | 202411084372-Proof of Right [23-01-2025(online)].pdf | 2025-01-23 |
| 10 | 202411084372-FORM-26 [23-01-2025(online)].pdf | 2025-01-23 |
| 11 | 202411084372-STARTUP [18-03-2025(online)].pdf | 2025-03-18 |
| 12 | 202411084372-FORM28 [18-03-2025(online)].pdf | 2025-03-18 |
| 13 | 202411084372-FORM-9 [18-03-2025(online)].pdf | 2025-03-18 |
| 14 | 202411084372-FORM 18A [18-03-2025(online)].pdf | 2025-03-18 |
| 15 | 202411084372-Covering Letter [14-11-2025(online)].pdf | 2025-11-14 |