Abstract: The present disclosure provides a cost-effective, highly sensitive, and specific method for the detection of Mycobacterium tuberculosis and its rifampicin-resistant strain. In particular, the present disclosure provides primer sets and probes. Further, the present disclosure provides a kit comprising the primer sets and the probes for detecting Mycobacterium tuberculosis and rifampicin-resistant M. tuberculosis in a biological sample. Furthermore, the present disclosure provides an assay for detecting Mycobacterium tuberculosis and rifampicin-resistant M. tuberculosis in the biological sample employing the primer sets and the probes.
1. A primer set, comprising: a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 or SEQ NO: 4; and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2 or SEQ NO: 5.
2. A probe, comprising: a nucleotide sequence as set forth in SEQ NO: 3 or SEQ NO: 6, wherein the probe is linked to a fluorescent label and a quencher.
3. A kit for detecting Mycobacterium tuberculosis and/or rifampicin-resistant M. tuberculosis in a biological sample, the kit comprising: a first primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2, or a second primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 4 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 5; and a probe comprising a nucleotide sequence as set forth in SEQ NO: 3 or SEQ NO: 6 and the probe is linked to a fluorescent label and a quencher.
4. The kit as claimed in claim 3, further comprises: an internal standard primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 7 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 8, and an internal control probe comprising a nucleotide sequence as set forth in SEQ NO: 9 and the internal control probe is linked to a fluorescent label and a quencher.
5. The kit as claimed in claim 3, further comprises: reagents and an instruction manual for detecting the presence and absence of M. tuberculosis and/or rifampicin-resistant M. tuberculosis in the biological sample by using a real-time reverse-transcription PCR assay.
6. The kit as claimed in claim 3, wherein the first primer pair set and the probe comprising the nucleotide sequence as set forth in SEQ NO: 3 identify M. tuberculosis, and the second primer pair set and the probe comprising the nucleotide sequence as set forth in SEQ NO: 6 identify rifampicin-resistant M. tuberculosis.
7. An assay for detecting Mycobacterium tuberculosis and/or rifampicin-resistant M. tuberculosis in a biological sample, the assay comprising: extracting RNA from the biological sample; mixing the extracted RNA, a primer mix having the primer set as claimed in claim 1, a probe mix having the probe as claimed in claim 2, an internal standard primer pair set, an internal control probe, and a real-time RT-PCR master mix to form a reaction mixture; performing a real-time reverse-transcription PCR (RT-qPCR) reaction with the reaction mixture in suitable cycling conditions; and analyzing results of the RT-qPCR reaction and detecting the presence and absence of M. tuberculosis and/or rifampicin-resistant M. tuberculosis.
8. The assay as claimed in claim 7, wherein the suitable cycling conditions comprise: an initial reverse transcription at a temperature of 50°C for 15 minutes; and 30-45 cycles of a denaturation at a temperature of 95°C for 15 seconds, and an annealing at a temperature of 60°C for 1 minute.
9. The assay as claimed in claim 7, wherein the internal standard primer pair set comprises a forward primer having a nucleotide sequence as set forth in SEQ NO: 7 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 8, and an internal control probe comprises a nucleotide sequence as set forth in SEQ NO: 9 and the internal control probe is linked to a fluorescent label and a quencher.
10. The assay as claimed in 1, wherein the biological sample is saliva or sputum.
Description:FIELD OF INVENTION
[001] The present disclosure relates to the detection of a pathogen. In particular, the present disclosure relates an assay, primers, and probes for the detection of Mycobacterium tuberculosis and its resistant strain.
BACKGROUND OF THE INVENTION
[002] Mycobacterium tuberculosis (Mtb) is the causative pathogen in tuberculosis (TB), an infection of the respiratory system that may eventually spread to peripheral organs, leading to acute disease and death if left untreated. One-third of the world’s population suffers from latent TB, with 8.8 million new cases of the disease and 2 million deaths annually. These numbers are dramatically skewed towards the developing world, with TB accounting for the majority of HIV-related deaths. It is thus extremely important to avoid wasting precious resources and medicines on misdiagnosis and re-treatment. However, sputum smear microscopy (by far the most common TB test performed in low-income countries at 83 million/year) only achieves 40-60% sensitivity in field conditions, with this value dropping to 20% in cases of co-infection with HIV. Furthermore, the confirmatory diagnostic technique of cell culture is prohibitively slow, yielding results in the time frame of months during which a treatment regimen has already been pursued regardless of drug susceptibility. Genotyping tests adapted to retron library recombineering (RLR) settings present an attractive option for the detection of TB and screening for drug resistance due to their speed and low cost.
[003] Sputum samples are composed of mucus produced by coughing and oral emissions from the lower respiratory tract. These samples provide valuable insights into infectious agents present in the respiratory system, especially in the case of tuberculosis. However, sputum samples can be hard to produce in some patients and have a wide spectrum of fluidic properties that make sample preparation complex. Furthermore, their use is generally limited to the diagnosis of respiratory infections.
[004] Tuberculosis is generally treated sequentially with three lines of drugs. Multiple lines of drugs have become necessary as drug resistance has become increasingly problematic. This is due to both patient compliance issues, as well as excessive drug prescription in cases where disease or drug resistance status has not been confirmed beyond symptomatic diagnosis. Cases of multi-drug resistant (MDR) TB have become increasingly common, with 2013 global incidences of 3.5% and 20.5% in new cases and previously treated cases, respectively. The percentage of MDR-TB cases that were also extensively drug-resistant (XDR) was 9.0% in the same year. Patients with extensive pulmonary TB typically are infected with ~1012 bacteria. Drug resistance has been shown to result from spontaneous mutations at rates of 10-7 to 10-10 mutations per bacterium per generation, depending on the specific drug. Patients are thus frequently treated with multiple drugs at once in order to prevent conversion to MDR or XDR. It is thus critical to develop tools to rapidly identify both TB infection, as well as drug resistance profile for patients presenting with respiratory symptoms in the clinic in order to deliver targeted therapeutics.
[005] The laboratory demonstration of the presence of M. tuberculosis in the sputum samples requires isolation and microscopy. Since culture and isolation of M. tuberculosis is difficult and takes 7-10 days’ time and is normally carried out after culturing the swabs on suitable media such as Lowenstein-Jensen or Middlebrook, 7H10 or 7H11 media. The acid-fast staining of M. tuberculosis and microscopy may underreport some of the cases. Additionally, it requires expertise and can be performed only in high-end laboratories. Therefore, the currently available diagnostic tests cannot be applied for surveillance at a large scale.
[006] WO2013155189A1 discloses a method for detecting rifampicin-resistant M. tuberculosis in a biological sample. The method comprises amplification of a nucleic acid containing the rifampicin resistance determining region (RRDR) of the rpoB gene in a sample to provide an amplified nucleic acid, followed by probing the amplified nucleic acid with at least three molecular beacon probes for an RRDR mutant target.
[007] WO2011140237A2 discloses a process for the rapid and specific detection of drug-resistant forms of M. tuberculosis based on real-time PCR. Further, the process is useful for the detection of mutations within the Rifampicin Resistance Determinant Region (RRDR) of rpoB for the detection of rifampicin resistance.
[008] US2010273146A1 discloses a diagnostic test for detecting multi-drug resistant M. tuberculosis, wherein a set of nucleic acid probes is used in an assay for PCR amplification and wherein each of the probes is between about 10 to 50 nucleotides long. Further, it discloses specific single mutations associated with RIF resistance may be detected in less than 1 day using PCR amplification of M. tuberculosis nucleic acid, followed by DNA sequence analysis.
[009] Despite all prior efforts, there is a need in the art for a cost effective, highly sensitive, and method of specific detection of Mycobacterium tuberculosis and its resistant strain.
SUMMARY OF THE INVENTION
[0010] This summary is provided to introduce a selection of concepts in a simplified format that are further described in the detailed description of the invention.
[0011] In a first aspect of the present disclosure, there is provided a primer set, comprising:
a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 or SEQ NO: 4; and
a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2 or SEQ NO: 5.
[0012] In another aspect of the present disclosure, there is provided a probe, comprising:
a nucleotide sequence as set forth in SEQ NO: 3 or SEQ NO: 6,
wherein the probe is linked to a fluorescent label and a quencher.
[0013] In another aspect of the present disclosure, there is provided a kit for detecting Mycobacterium tuberculosis and/or rifampicin-resistant M. tuberculosis in a biological sample, the kit comprising:
a first primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2, or
a second primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 4 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 5; and
a probe comprising a nucleotide sequence as set forth in SEQ NO: 3 or SEQ NO: 6 and the probe is linked to a fluorescent label and a quencher.
[0014] In another aspect of the present disclosure, there is an assay for detecting Mycobacterium tuberculosis and/or rifampicin-resistant M. tuberculosis in a biological sample, the assay comprising:
extracting RNA from the biological sample;
mixing the extracted RNA, a primer mix having the primer set as claimed, a probe mix having the probe as claimed, an internal standard primer pair set, an internal control probe, and a real-time RT-PCR master mix to form a reaction mixture;
performing a real-time reverse-transcription quantitative PCR (RT-qPCR) reaction with the reaction mixture in a suitable cycling conditions; and
analyzing results of the RT-qPCR reaction and detecting the presence and absence of M. tuberculosis and/or rifampicin-resistant M. tuberculosis.
[0015] These and other features, aspects, and advantages of the present invention will become better understood with reference to the following description and appended claims. This summary is provided to introduce a selection of concepts in a simplified form. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.
DETAILED DESCRIPTION OF THE INVENTION
[0016] Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps of the process, features of the invention, referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.
[0017] Definitions: For convenience, before further description of the present disclosure, certain terms employed in the specification, and examples are collected here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person skilled in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below.
[0018] The articles “a”, “an” and “the” are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. The terms “comprise” and “comprising” are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as “consists of only”. Throughout this specification, unless the context requires otherwise the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated element or step or group of elements or steps but not the exclusion of any other element or step or group of elements or steps.
[0019] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skilled in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the disclosure, the preferred methods, and materials are now described. All publications mentioned herein are incorporated herein by reference. The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally equivalent products and methods are clearly within the scope of the disclosure, as described herein.
[0020] As used herein, the terms “method” and “process” have been used interchangeably.
[0021] As used herein, the term “sample” or “biological sample” refers to any known types of samples that are collected in ex-vivo condition from subjects. The subject is mammals. The mammal is preferably Humans (Homo sapiens). The sample is saliva or sputum.
[0022] The term “in-vitro” refers to a medical study or experiment which is done in the laboratory within the control environment at laboratory.
[0023] As used herein, the terms “nucleotide sequence”, “polynucleotide sequence”, “nucleic acid”, and “gene” mean a chain of two or more nucleotides, such as RNA (ribonucleic acid) and DNA (deoxyribonucleic acid).
[0024] As used herein, the term primer refers to a DNA strand that can prime the synthesis of DNA. A Forward primer is a DNA sequence that latches onto the antisense strand (also known as the minus strand) of DNA, which runs from 3’ to 5’. The primers anneal, or bind, to the DNA strand, facilitating its amplification. A reverse primer is a DNA sequence that binds to the sense strand (also known as the plus strand) of the DNA, which runs from 5’ to 3’.
[0025] As used herein, the probe is a fragment of DNA used to detect the presence of a specific DNA fragment within a sample. It is labeled with a reporter molecule/ fluorescent label and a quencher. The term “reporter/fluorescent label” refers to a molecule that emits fluorescence when hybridized to the target sequence. The term “quencher” refers to a molecule that absorbs light.
[0026] As used herein, “Reverse transcription PCR”, or “RT-PCR”, refers to a PCR that is preceded by a reverse transcription reaction that converts a target RNA to a complementary single-stranded DNA, which is then amplified. “Real-time PCR (PCR)” refers to a PCR for which the amount of reaction product, i.e., amplicon, is controlled as the reaction proceeds. “Reverse transcription quantitative real-time PCR (RT-qPCR)” refers to reverse transcription quantitative polymerase chain reaction, a variant of RT-PCR in which amplification of cDNA during the RT-PCR process is quantitatively detected in real time using a probe that detects amplified target DNA. It enables reliable detection and measurement of products generated during each cycle of PCR process.
[0027] As used herein, the phrase rifampicin-resistant Mycobacterium tuberculosis refers to M. tuberculosis strains that are resistant to rifampicin.
[0028] As used herein, the phrase “internal standard” refers to a nucleic acid sequence that is processed in the same reaction as one or more target polynucleotides to allow absolute or relative quantification of the target polynucleotides in a sample. In one aspect, the reaction is an amplification reaction, such as PCR. An internal standard can be endogenous or exogenous. That is, an internal standard can be naturally produced in the sample, or it can be added to the sample prior to a reaction. In one aspect, one or more exogenous internal standard sequences can be added to a reaction mixture at predetermined concentrations to provide a calibration against which an amplified sequence can be compared to determine the amount of its corresponding target polynucleotide in a sample. Selection of the number, sequences, length, and other characteristics of exogenous internal standards is a common design choice for one of ordinary skill in the art. Endogenous internal standards, also referred to herein as “reference sequences”, are natural sequences with respect to a sample that correspond to minimally regulated genes that show a constant level of transcription independent of the cell cycle. In one aspect, the internal standard is ß-actin. In one aspect, the internal standard is also referred to as a positive control sample (PTC).
[0029] As used herein, the phrase “negative control sample (NTC) refers to a nuclease free water.
[0030] “Specificity” herein indicates the ratio of the amplification of a target gene to the non-specific amplification. So, high specificity means the amplification of a target gene is dominant. “Sensitivity” herein refers to the minimum amount of template required to reliably amplify the target gene.
[0031] As used herein, “Kit” refers to any delivery system for supplying materials or reagents to carry out the method of the present disclosure. In the context of the present disclosure, such delivery systems include systems that allow the storage, transport or delivery of reaction reagents (e.g., primers, enzymes, internal standards, etc. in suitable containers) and/or support materials (e.g. buffers, written instructions for conducting the test, etc.) from one site to another. For example, kits include one or more envelopes (e.g., boxes/vials) containing the relevant reaction reagents and/or support materials. Such content can be supplied to the intended container jointly or separately. For example, the first container may contain an enzyme for use in an assay, the second container contains primers, and the third container contains probes and under no circumstances can be sold separately or mixed in combination with other kits.
[0032] As used herein, the term “instruction manual” refers to the instruction manual for the reagent for detecting the presence and absence of M. tuberculosis and/or rifampicin-resistant M. tuberculosis in the biological sample by using a real-time reverse-transcription PCR assay and interpreting the results of the present invention, in which the features, principles, operating procedures, etc. of the method for the present invention are substantially described in text, diagrams, etc. It means a sentence, a pamphlet (leaflet), or the like.
[0033] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the disclosure, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference.
[0034] The present disclosure provides a real-time RT-qPCR assay by using TaqMan probe chemistry has been developed for the detection of rifampicin-resistant Mycobacterium tuberculosis. The TaqMan probe principle depends on the 5´–3´ exonuclease activity of Taq polymerase to cleave a dual-labeled probe binding the complementary target sequence during polymerization and fluorophore-based detection. The invention involves designing set of primers and probe for real-time RT-qPCR targeting insertion sequence (IS) 6110 specific to M. tuberculosis. Another set of primers and probe are designed in house by the inventors of the present disclosure targeting mutated region of the beta (ß) subunit of RNA polymerase gene (Rpoß) responsible to the resistance conferred to rifampicin resistant M. tuberculosis. The third set of primers and probe are designed to target ß-actin which serves as an internal control (internal standard primer pair set) of the assay. Each probe has been attached with a fluorescent dye with a non-overlapping distinct excitation wavelength at 5’ end and a universal quencher dye at 3’end for ease of multiplexing. The primers and probes were synthesized and dissolved in specific proportions as mentioned in the sections below. The genomic RNA was extracted from the known positive sputum samples by the method mentioned in the following sections. The real-time RT-qPCR reaction was setup using the extracted RNA, the specific primers, probes and the commercially available one step real-time RT-qPCR master mix. The reaction was carried out at cycling temperature conditions mentioned in the sections below in a suitable real-time PCR system and results were interpreted with the ABI7500 Software v2.3.
[0035] In a first aspect of the present disclosure, there is provided a primer set, comprising:
a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 or SEQ NO: 4; and
a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2 or SEQ NO: 5.
[0036] In an embodiment of the present disclosure, there is provided primer pair sets, the primer pair sets comprising:
a first primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2;
a second primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 4 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 5; and
an internal standard primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 7 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 8.
[0037] In another aspect of the present disclosure, there is provided a probe, comprising:
a nucleotide sequence as set forth in SEQ NO: 3 or SEQ NO: 6,
wherein the probe is linked to a fluorescent label and a quencher.
[0038] In an embodiment of the present disclosure, there are provided probes having a nucleotide sequence as set forth in SEQ NO: 3, SEQ NO: 6, and SEQ NO: 9, wherein each probe is linked to a fluorescent label and a quencher.
[0039] In an embodiment of the present disclosure, wherein the fluorophore is selected from the group consisting of JUN, VIC, and ALEXA 647, and wherein the quencher is MGB.
[0040] In another aspect of the present disclosure, there is provided a kit for detecting Mycobacterium tuberculosis and/or rifampicin-resistant M. tuberculosis in a biological sample, the kit comprising:
a first primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2, or
a second primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 4 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 5; and
a probe comprising a nucleotide sequence as set forth in SEQ NO: 3 or SEQ NO: 6 and the probe is linked to a fluorescent label and a quencher.
[0041] In an embodiment of the present disclosure, there is provided a kit for detecting Mycobacterium tuberculosis in a biological sample, the kit comprising:
a first primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2; and
a probe comprising a nucleotide sequence as set forth in SEQ NO: 3 and the probe is linked to a fluorescent label and a quencher.
[0042] In an embodiment of the present disclosure, there is provided a kit for detecting rifampicin-resistant M. tuberculosis in a biological sample, the kit comprising:
a second primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 4 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 5; and
a probe comprising a nucleotide sequence as set forth in SEQ NO: 6 and the probe is linked to a fluorescent label and a quencher.
[0043] In another aspect of the present disclosure, there is provided a kit for detecting Mycobacterium tuberculosis and rifampicin-resistant M. tuberculosis in a biological sample, the kit comprising:
a first primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2;
a second primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 4 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 5; and
probes comprising a nucleotide sequence as set forth in SEQ NO: 3 and SEQ NO: 6 and each probe is linked to a fluorescent label and a quencher.
[0044] In an embodiment of the present disclosure, the kit further comprises:
an internal standard primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 7 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 8, and an internal control probe comprising a nucleotide sequence as set forth in SEQ NO: 9 and the internal control probe is linked to a fluorescent label and a quencher.
[0045] In an embodiment of the present disclosure, the kit further comprises:
reagents and an instruction manual for detecting the presence and absence of M. tuberculosis and/or rifampicin-resistant M. tuberculosis in the biological sample by using a real-time reverse-transcription PCR assay.
[0046] In another aspect of the present disclosure, there is provided a kit for detecting Mycobacterium tuberculosis and rifampicin-resistant M. tuberculosis in a biological sample, the kit comprising:
a first primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2;
a second primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 4 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 5;
an internal standard primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 7 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 8; and
probes comprising a nucleotide sequence as set forth in SEQ NO: 3, SEQ NO: 6, and SEQ NO: 9, and each probe is linked to a fluorescent label and a quencher.
[0047] In an embodiment of the present disclosure, wherein the first primer pair set and the probe comprising the nucleotide sequence as set forth in SEQ NO: 3 identify M. tuberculosis, and the second primer pair set and the probe comprising the nucleotide sequence as set forth in SEQ NO: 6 identify rifampicin-resistant M. tuberculosis.
[0048] In an embodiment of the present disclosure, wherein the fluorophore is selected from the group consisting of JUN, VIC, and ALEXA 647, and wherein the quencher is MGB.
[0049] In an embodiment of the present disclosure, wherein the reagents comprise one step real-time RT-qPCR master mix.
[0050] In another aspect of the present disclosure, there is an assay for detecting Mycobacterium tuberculosis and/or rifampicin-resistant M. tuberculosis in a biological sample, the assay comprising:
extracting RNA from the biological sample;
mixing the extracted RNA, a primer mix having the primer set as claimed, a probe mix having the probe as claimed, an internal standard primer pair set, an internal control probe, and a real-time RT-PCR master mix to form a reaction mixture;
performing a real-time reverse-transcription PCR (RT-qPCR) reaction with the reaction mixture in a suitable cycling conditions; and
analyzing results of the RT-qPCR reaction and detecting the presence and absence of M. tuberculosis and/or rifampicin-resistant M. tuberculosis.
[0051] In an embodiment of the present disclosure, wherein the suitable cycling conditions comprise:
an initial reverse transcription at a temperature of 50°C for 15 minutes; and 30-45 cycles of a denaturation at a temperature of 95°C for 15 seconds, an annealing/ extension at a temperature of 60°C for 1 minute.
[0052] In an embodiment of the present disclosure, wherein the number of cycles is between 30 and 35.
[0053] In an embodiment of the present disclosure, wherein the number of cycles is between 35 and 40.
[0054] In an embodiment of the present disclosure, wherein the number of cycles is between 40 and 45.
[0055] In an embodiment of the present disclosure, wherein the internal standard primer pair set comprises a forward primer having a nucleotide sequence as set forth in SEQ NO: 7 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 8, and an internal control probe comprises a nucleotide sequence as set forth in SEQ NO: 9 and the internal control probe is linked to a fluorescent label and a quencher.
[0056] In an embodiment of the present disclosure, wherein the fluorophore is selected from the group consisting of JUN, VIC, and ALEXA 647, and wherein the quencher is MGB.
[0057] In an embodiment of the present disclosure, wherein the RNA is extracted from the biological sample by methods well known to those skilled in the art. For example, RNA extraction can be performed using guanidinium thiocyanate-phenol-chloroform extraction method or RNA extraction kits.
[0058] In an embodiment of the present disclosure, wherein the real-time RT-PCR master mix is a one-step real-time RT-PCR master mix, which uses a single buffer that enables reverse transcription and PCR amplification to occur without interruption. The real-time RT-PCR master mix comprises 2X master mix buffer, dNTPs, reverse transcriptase enzyme and Taq polymerase enzyme.
[0059] In an embodiment of the present disclosure, wherein the biological sample is saliva or sputum.
[0060] In an embodiment of the present disclosure, wherein the assay for detecting Mycobacterium tuberculosis and/or rifampicin-resistant M. tuberculosis in a biological sample is performed in 2 hours.
[0061] In the present disclosure, a real-time RT-qPCR assay has been developed for the detection of rifampicin-resistant M. tuberculosis. The TaqMan probe-based chemistry has been used for this invention. The TaqMan probe principle depends on the 5´–3´ exonuclease activity of Taq polymerase. For this chemistry, a dual-labelled probe is used in which the 5’ end is attached with a fluorophore and 3’ end attached with a quencher dye. This dual-labelled probe binds specifically to the complementary target sequence. In addition to this, a forward and a reverse primer are designed flanking the region of the probe. During polymerization, the probe is cleaved with its 5’ – 3’ exonuclease activity of Taq polymerase. This leads to fluorescence emission, which is detected by the CCD camera.
[0062] In an exemplary and non-limiting embodiment, the present disclosure provides the following advantages:
• This assay is cost-effective as compared to the other methods for the detection of M. tuberculosis and rifampicin resistant M. tuberculosis.
• The detection is possible in one tube using the multiplex RT-qPCR system.
• This method is time-efficient as compared to the other methods for detection of M. tuberculosis and rifampicin resistant M. tuberculosis.
• It only takes 2 hours to show results.
• The specificity of the assay is 100%, and sensitivity is 99%.
• There is no need to perform the culturing and isolation of bacteria.
EXAMPLES:
[0063] The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods, the exemplary methods, devices and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary. Person skilled in the art will be aware of the fact that the present examples will further subject to variations and modifications specifically described herein based on the technical requirement of the experiment and shall not be limiting what specifically mentioned.
Example 1: Real-Time RT-qPCR assay
[0064] The invention involves designing a set of real-time RT-qPCR primers and probe, targeting insertion sequence (IS) 6110 specific to M. tuberculosis and another set responsible for detection of rifampicin resistance, targeting beta (ß) subunit of RNA polymerase gene (Rpoß). Rifampin is thought to inhibit bacterial DNA-dependent RNA polymerase, which appears to occur as a result of drug binding in the polymerase subunit (beta subunit) deep within the DNA/RNA channel, facilitating direct blocking of the elongating RNA. The beta subunit of RNA polymerase gene has mutations that make it not susceptible to rifampicin binding, which is responsible for the resistance conferred to rifampicin-resistant M. tuberculosis. Another set of primers and probe is designed to target ß-actin, which serves as an internal control of the assay. Each probe has been attached with a fluorescent dye with a non-overlapping distinct excitation wavelength at 5’ end and a universal quencher dye at 3’end for ease of multiplexing. The primers and probes were synthesized by ThermoFisher scientific (Table 1).
[0065] Table 1: List of primers and probes for the detection of M. tuberculosis and rifampicin resistant M. tuberculosis.
SEQ ID Primer/Probe Sequence
SET 1 (IS6110 genomic segment)
SEQ NO: 1 IS-F 5’ -CGATCGAGCAAGCCATCT-3’
SEQ NO: 2 IS-R 5’-AACCGGATCGATGTGTACTG-3’
SEQ NO: 3 IS-Probe 5’-AACGTCTTTCAGGTCGAGTACGCC-3’
IS-Probe 5’-VIC-AACGTCTTTCAGGTCGAGTACGCC-3’-MGB
SET 2 (Beta subunit of RNA polymerase gene)
SEQ NO-4 RB-F 5’-CACACCGCAGACGTTGAT-3’
SEQ NO-5 RB-R 5’-GGTTGTTCTGGTCCATGAATTG-3’
SEQ NO-6 RB-Probe 5’-CGATCAAGGAGTTCTTCGGCACCA-3’
RB-Probe 5’-JUN- CGATCAAGGAGTTCTTCGGCACCA -MGB-3’
SET 3 (ß-actin)
SEQ NO-7 ßA-F 5’-GGACCTGACTGACTACCTCAT-3’
SEQ NO-8 ßA-R 5’-CGTAGCACAGCTTCTCCTTAAT-3’
SEQ NO-9 ßA-Probe 5’-AGCGGGAAATCGTGCGTGAC-3’
ßA-Probe 5’-ALEXA 647-AGCGGGAAATCGTGCGTGAC-NFQ-MGB -3’
Example 2: RNA extraction
[0066] The extraction of RNA from suspected tuberculosis sputum samples was performed by the TRIzol reagent (guanidinium thiocyanate) method. Total RNA isolation was done as per the manufacturer’s instructions. The sputum samples were handled strictly in the biosafety cabinet for safety. A volume of 200 µl sputum sample was added to 500 µl of TRIzol reagent and vortexed vigorously until the pink cloudy solution was formed. The samples were allowed to lyse for 30 min at room temperature (25°C) with intermittent vortexing. To this mixture, 200 µl of chloroform was added and vortexed vigorously until the pink cloudy solution was formed and allow it to stand for 15 min at room temperature. The resultant mixture was centrifuged at 12,000 rpm for 15 min at 4°C. After this the sample was separated into three distinct layers, using a pipette the clear top layer (aqueous phase) (approximately 400-500 µl) was transferred to a labelled Eppendorf tube. The remaining supernatant containing TRIzol was discarded in accordance with health and safety guidelines. Using a pipette tip, an equal volume of chilled isopropanol (approximately 500 µl) was added to the separated aqueous phase. The tubes were inverted 5-6 times and were allowed to stand for 2 hours at temperature of 4°C or at -20°C for overnight. Then the tubes were centrifuged at 12000 rpm for 15 minutes at 4°C. The supernatant was discarded into disinfectant leaving behind the visible pellet. Washing of the RNA pellet was done using chilled a 70% solution of ethanol. The viral RNA was re-pelleted by centrifugation at 12000 rpm for 15 minutes at 4°C. Again, the supernatant was discarded and a pipette was used to remove any excess ethanol. The resultant pellet was air dried in the concentrator and then dissolved in 40µl RNase free water. The extracted RNA was stored at –70 °C until further use.
Example 3: Reaction mix preparation
[0067] The real-time experiments were performed in the ABI 7500 real-time PCR system. The real-time RT-qPCR reaction was setup using the extracted RNA, the specific primers, probes and the commercially available one step real-time RT-qPCR master mix, the reaction mixture is mentioned in Table 2. The reaction was carried out at cycling temperature conditions mentioned in the Table 3. The results were interpreted with the ABI7500 Software v2.3.
[0068] Table 2: Composition of reaction mix for the real-time RT-qPCR assay for detection of M. tuberculosis and rifampicin resistant M. tuberculosis.
[0069] The concentration of primers used is 20 pico molar for each forward and reverse.
[0070] Table 3: Temperature cycling conditions for the real-time RT-qPCR assay for detection of M. tuberculosis and rifampicin resistant M. tuberculosis.
Condition Temperature in °C
Reverse transcription 50°C
Denaturation 95°C X 35 cycles
Annealing/extension 60°C
Example 3: Interpretation of results
[0071] Interpretation of the results was performed by the Applied Biosystems™ Software (ABI7500 Software v2.3). For each run for the RT-qPCR assay, a minimum of one negative control (NTC) and one positive control (PTC) was used. The negative control sample comprises nuclease free water and positive control sample comprises internal standard primer pair set, internal control probe specific for ß-actin, and RNA template from the positive sample. The ‘Ct (threshold cycle) cut off values for assay targets’ was adjusted above the baseline of NTC. The Ct value of each sample was noted. The NTC should show all the three genes negative otherwise the test was considered invalid. The PTC should show all the three genes positive otherwise the test was considered invalid. The ß-Actin gene should give positive result irrespective of the samples except NTC (Table 4). The cut off value of this assay was considered at 35 Ct. so, all the samples showing a Ct value above 35 was considered negative.
[0072] Table 4: Interpretation of results for the real-time RT-qPCR assay for detection of rifampicin resistant M. tuberculosis.
[0073] It was observed that the biological sample of the subject infected with Mycobacterium tuberculosis and resistant to rifampicin showed all positive results (Sample 1). The biological sample of the subject infected with Mycobacterium tuberculosis and not resistant to tuberculosis showed negative results for the M. tuberculosis RNA polymerase gene-specific primers set, while it showed positive results for M. tuberculosis IS6110 genomic segment-specific primers (Sample 2). However, the biological sample not infected with Mycobacterium tuberculosis showed negative results, like the negative control sample.
[0074] The assay with the specific sets of primers and probes of the present disclosure showed 100% sensitivity and 99% specificity for Mycobacterium tuberculosis and rifampicin-resistant M. tuberculosis by using the real-time reverse-transcription PCR assay.
[0075] It will thus be seen that the objects set forth above, among those made apparent from the preceding description, are efficiently attained, and since certain changes may be made in the constructions set forth without departing from the spirit and scope of the invention, it is intended that all matter contained in the above description shall be interpreted as illustrative and not in a limiting sense. The invention has been described with reference to preferred and alternate embodiments. Modifications and alterations will become apparent to those skilled in the art upon reading and understanding the detailed discussion of the invention provided herein. This invention is intended to include all such modifications and alterations insofar as they come within the scope of the present invention. These and other modifications of the preferred embodiments as well as other embodiments of the invention will be obvious from the disclosure herein, whereby the foregoing descriptive matter is to be interpreted merely as illustrative of the invention and not as a limitation.
[0076] Finally, to the extent necessary to understand or complete the disclosure of the present invention, all publications, patents, and patent applications mentioned herein are expressly incorporated by reference therein to the same extent as though each were individually so incorporated.
, Claims:1. A primer set, comprising:
a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 or SEQ NO: 4; and
a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2 or SEQ NO: 5.
2. A probe, comprising:
a nucleotide sequence as set forth in SEQ NO: 3 or SEQ NO: 6,
wherein the probe is linked to a fluorescent label and a quencher.
3. A kit for detecting Mycobacterium tuberculosis and/or rifampicin-resistant M. tuberculosis in a biological sample, the kit comprising:
a first primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 1 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 2, or
a second primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 4 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 5; and
a probe comprising a nucleotide sequence as set forth in SEQ NO: 3 or SEQ NO: 6 and the probe is linked to a fluorescent label and a quencher.
4. The kit as claimed in claim 3, further comprises:
an internal standard primer pair set comprising a forward primer having a nucleotide sequence as set forth in SEQ NO: 7 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 8, and an internal control probe comprising a nucleotide sequence as set forth in SEQ NO: 9 and the internal control probe is linked to a fluorescent label and a quencher.
5. The kit as claimed in claim 3, further comprises:
reagents and an instruction manual for detecting the presence and absence of M. tuberculosis and/or rifampicin-resistant M. tuberculosis in the biological sample by using a real-time reverse-transcription PCR assay.
6. The kit as claimed in claim 3, wherein the first primer pair set and the probe comprising the nucleotide sequence as set forth in SEQ NO: 3 identify M. tuberculosis, and the second primer pair set and the probe comprising the nucleotide sequence as set forth in SEQ NO: 6 identify rifampicin-resistant M. tuberculosis.
7. An assay for detecting Mycobacterium tuberculosis and/or rifampicin-resistant M. tuberculosis in a biological sample, the assay comprising:
extracting RNA from the biological sample;
mixing the extracted RNA, a primer mix having the primer set as claimed in claim 1, a probe mix having the probe as claimed in claim 2, an internal standard primer pair set, an internal control probe, and a real-time RT-PCR master mix to form a reaction mixture;
performing a real-time reverse-transcription PCR (RT-qPCR) reaction with the reaction mixture in suitable cycling conditions; and
analyzing results of the RT-qPCR reaction and detecting the presence and absence of M. tuberculosis and/or rifampicin-resistant M. tuberculosis.
8. The assay as claimed in claim 7, wherein the suitable cycling conditions comprise:
an initial reverse transcription at a temperature of 50°C for 15 minutes; and 30-45 cycles of a denaturation at a temperature of 95°C for 15 seconds, and an annealing at a temperature of 60°C for 1 minute.
9. The assay as claimed in claim 7, wherein the internal standard primer pair set comprises a forward primer having a nucleotide sequence as set forth in SEQ NO: 7 and a reverse primer having a nucleotide sequence as set forth in SEQ NO: 8, and an internal control probe comprises a nucleotide sequence as set forth in SEQ NO: 9 and the internal control probe is linked to a fluorescent label and a quencher.
10. The assay as claimed in 1, wherein the biological sample is saliva or sputum.
| # | Name | Date |
|---|---|---|
| 1 | 202421004713-STATEMENT OF UNDERTAKING (FORM 3) [23-01-2024(online)].pdf | 2024-01-23 |
| 3 | 202421004713-Sequence Listing in PDF [23-01-2024(online)].pdf | 2024-01-23 |
| 4 | 202421004713-FORM FOR STARTUP [23-01-2024(online)].pdf | 2024-01-23 |
| 5 | 202421004713-FORM FOR SMALL ENTITY(FORM-28) [23-01-2024(online)].pdf | 2024-01-23 |
| 6 | 202421004713-FORM 1 [23-01-2024(online)].pdf | 2024-01-23 |
| 7 | 202421004713-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [23-01-2024(online)].pdf | 2024-01-23 |
| 8 | 202421004713-EVIDENCE FOR REGISTRATION UNDER SSI [23-01-2024(online)].pdf | 2024-01-23 |
| 9 | 202421004713-DECLARATION OF INVENTORSHIP (FORM 5) [23-01-2024(online)].pdf | 2024-01-23 |
| 10 | 202421004713-COMPLETE SPECIFICATION [23-01-2024(online)].pdf | 2024-01-23 |
| 11 | 202421004713-FORM-26 [19-04-2024(online)].pdf | 2024-04-19 |