DESC:FORM 2
THE PATENTS ACT, 1970
(39 of 1970)
COMPLETE SPECIFICATION
(See section 10 and rule 13)

1. Title: A self-sampling kit and method for rapid human papillomavirus (HPV) detection and reporting

2. Applicant Name(s): Accurate Diagnostics Pvt Ltd. &
MACS-Agharkar Research Institute
3. Nationality: Indian Registered company & Indian Institute
4. Address: 2nd Floor, Above P N Gadgil Showroom, Happy Colony, 1st Lane, Kothrud, Pune- 411038, Maharashtra, India & Gopal Ganesh Agarkar Road, Shivajinagar, Pune 411004, Maharashtra, India

THE FOLLOWING SPECIFICATION PARTICULARLY DESCRIBES THE INVENTION AND THE MANNER IN WHICH IT IS TO BE PERFORMED.
FIELD OF THE PRESENT INVENTION
[0001] The present invention relates to a self-sampling kit and method for rapid human papillomavirus (HPV) detection and reporting. More particularly, the present invention relates to a novel self-sampling kit and method designed for rapid and user-friendly detection and screening of human papillomaviruses (HPV), notably HPV16, 18, and 45 advancing the early detection and prevention of cervical cancers associated with HPV infections.

BACKGROUND OF THE PRESENT INVENTION
[0002] Cervical cancer stands as the fourth most prevalent cancer among women, claiming a life every two minutes globally. Persistent infections by high-risk human papillomaviruses (HPV), particularly HPV16 and HPV18 serotypes, are implicated in over 99% of cervical cancer cases. The World Health Organization (WHO) identifies vaccination and widespread screening as pivotal strategies in preventing and managing cervical cancer, given that more than 340,000 women succumbed to the disease in 2020 alone, with the burden disproportionately affecting low- and middle-income countries.
[0003] Responding to WHO's call to action in 2018 and the subsequent adoption of a global strategy to eliminate cervical cancer as a public health issue by 2030, the imperative for accelerated efforts in prevention, screening, and cancer management is underscored. This strategy emphasizes achieving ambitious targets, including ensuring 90% of girls are fully vaccinated against HPV by age 15 and screening 70% of women aged 35 to 45 with high-performance tests. Equally critical is the timely treatment of pre-cancerous lesions and cervical disease in identified cases.
[0004] In current clinical practice, the diagnosis of HPV infections relies on the collection of cervical samples followed by viral DNA isolation and amplification using molecular techniques like PCR and RT-PCR. However, these methods are resource-intensive, time-consuming, and demand specialized equipment and skilled personnel. Moreover, the microscopic identification of cancers through histology presents additional challenges, requiring trained individuals for accurate interpretation.
[0005] A significant obstacle to large-scale HPV screening efforts is the challenge of sample collection from women, often due to social barriers and insufficient awareness of the importance of HPV screening. Addressing this challenge and facilitating rapid, accessible screening for HPV is crucial for achieving WHO's elimination goals.
[0006] CN101177701A relates to a probe having a nucleotide sequence complementary to human papillomavirus HPV DNA, a genotyping detection kit for detecting a specific subtype of HPV containing the probe, and a gene chip preparation method thereof.
[0007] CN1814796A relates to a suspension chip technology for detecting human papillomavirus genes and is suitable for clinical detection of human papillomavirus and genotyping to guide the prevention and treatment of cervical cancer.
[0008] US9568474B2 relates to immunoassays for in situ detection of HPV proteins using various monoclonal antibodies against recombinant HPV proteins such that infection by high-risk and/or low-risk HPV types can be detected by a single specific monoclonal antibody and/or a general pan antibody.
[0009] CN104818342A relates to a detection kit, detection system and detection method for 19 high-risk HPVs. It further discloses a plurality of general primers employed for amplification of target fragments, and specific fluorescence probes are used for real-time detection of the amplified fragments.
[0010] However, the prior arts reported heretofore suffer from limitations related to accessibility, scalability, sensitivity, and specificity, highlighting a need for an innovative self-sampling kit and method addressing these drawbacks and providing a rapid, user-friendly, and cost-effective solution for HPV detection that would empower individuals, especially women, to conduct self-tests conveniently and report results promptly. By eliminating the need for specialized equipment and skilled personnel, this solution would democratize access to screening, particularly in resource-constrained settings.
[0011] Therefore, there is a need to fill a crucial gap in current HPV screening practices by providing a solution that is accessible, efficient, and capable of reaching underserved populations. By enabling early detection and intervention, there is a need for a kit and a method that has the potential to save countless lives and contribute significantly to the global efforts to eliminate cervical cancer as a public health threat by 2030, as outlined by the World Health Organization.

SUMMARY OF THE PRESENT INVENTION
[0012] The present invention relates to a rapid, user-friendly, and cost-effective solution for human papillomavirus (HPV) detection. The present invention introduces a self-sampling kit and method designed for the swift detection and reporting of Human Papillomavirus (HPV) infections. The method allows for rapid, easy-to-follow testing, and empowers individuals to self-report HPV infections promptly. The present invention has the potential to revolutionize cervical cancer screening efforts and contribute significantly to global public health initiatives aimed at reducing the burden of cervical cancer.
[0013] In an embodiment of the present invention, a self-sampling kit for detecting human papillomavirus (HPV) in a biological sample is provided. The self-sampling kit for detecting human papillomavirus (HPV) in a biological sample comprises a sterile swab for collection of a sample, a collection tube consisting of a lysis buffer comprising 0.8% Triton X-100 and 0.3% Tween 20, a recombinase polymerase amplification (RPA) reagent mix, and a lateral flow assay (LFA) test strip. The lysis buffer is optimized for releasing viral DNA at room temperature. The recombinase polymerase amplification (RPA) reagent mix comprises a set of primers for RPA amplification targeting E6-E7 regions of HPV types 16, 18, and 45 comprising a forward primer and a reverse primer specific to the E6-E7 regions of HPV 16, 18, and 45.
[0014] In another embodiment of the present invention, a composition for detecting HPV types 16, 18, and 45 in a biological sample is provided. The composition for detecting HPV types 16, 18, and 45 in a biological sample comprises a lysis buffer comprising 0.8% Triton X-100 and 0.3% Tween 20 for viral DNA release at room temperature; and a set of primers for RPA amplification targeting the E6-E7 regions of HPV types 16, 18, and 45.
[0015] In another embodiment of the present invention, a method for detecting human papillomaviruses (HPV) is provided. The method comprises the steps of self-sampling a vaginal region using a self-sampling kit of the present invention. The collected sample is introduced into the reagent solution to suspend epithelial cells and extract nucleic acids. The sample-reagent mixture is incubated for 15 minutes at room temperature to lyse cells and release nucleic acids. The viral DNA sequences are amplified at ambient temperature (25±3?) using the amplification mix containing the gene-specific primers targeting HPV16, 18, and 45. The isothermal amplification of viral DNA is carried out for 30 minutes at room temperature. The amplified products are visualized using PCRD lateral flow technology, which provides rapid and user-friendly detection through the formation of distinct test and control lines.
[0016] The present invention provides a self-sampling kit facilitating convenient and rapid screening for HPV infections. By enabling individuals to conduct tests at home, accessibility to screening is greatly improved, particularly for remote or underserved populations. With results available within an hour, timely intervention and treatment for positive cases are ensured, contributing to improved healthcare outcomes. The present invention offers a cost-effective and user-friendly self-sampling kit and method that addresses critical challenges in traditional screening methods, making significant strides towards cervical cancer prevention on a global scale.
[0017] To further clarify the advantages and features of the present invention, a more particular description of the invention will follow by reference to specific embodiments thereof, which are illustrated in the appended figures. It is to be appreciated that these figures depict only typical embodiments of the invention and are therefore not to be considered limiting in scope. The invention will be described and explained with additional specificity and detail with the appended figures.

BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Objects, features, and advantages of the present invention will best be understood from the following description of various embodiments thereof, selected for the purposes of illustration, and shown in the accompanying drawings, in which:
[0019] FIG. 1 depicts a flow diagram representing the steps of a method for detecting human papillomaviruses (HPV), specifically HPV16, 18, and 45, in accordance with an embodiment of the present invention;
[0020] FIG. 2 depicts a flowchart of development of a kit for cervical cancer screening involving self-sampling, viral DNA extraction, viral DNA amplification and result interpretation, in accordance with an embodiment of the present invention;
[0021] FIG. 3 depicts a line diagram of a self-sampling kit for detecting human papillomavirus (HPV) in a biological sample, in accordance with an embodiment of the present invention;
[0022] FIG. 4 depicts a gel image for optimization of HPV 16 primer concentration, in accordance with an embodiment of the present invention;
[0023] FIG. 5 depicts optimization of template volume with selected HPV 16 primer, in accordance with an embodiment of the present invention;
[0024] FIG. 6 depicts optimization of temperature and time with selected HPV 16 primer, in accordance with an embodiment of the present invention;
[0025] FIG. 7 depicts a gel image for optimization of HPV 18-45 primer concentration, in accordance with an embodiment of the present invention;
[0026] FIG. 8 depicts optimization of template volume with selected HPV 18-45 primer, in accordance with an embodiment of the present invention;
[0027] FIG. 9 depicts a gel image for optimization of multiplexed HPV 16 and HPV 18-45 primer concentration, in accordance with an embodiment of the present invention;
[0028] FIG. 10 depicts optimization of buffer dilution for lateral flow assay (LFA), in accordance with an embodiment of the present invention;
[0029] FIG. 11 depicts visualization of the HPV16 detection with lateral flow assay (LFA), in accordance with an embodiment of the present invention;
[0030] FIG. 12 depicts visualization of the HPV18-45 detection with lateral flow assay (LFA), in accordance with an embodiment of the present invention;
[0031] FIG. 13 depicts visualization of the multiplexed HPV 16 and HPV18-45 detection with lateral flow assay (LFA), in accordance with an embodiment of the present invention;
[0032] FIG. 14 depicts limit of detection (LOD) determination with LFA, in accordance with an embodiment of the present invention; and
[0033] FIG. 15 depicts a cross-reactivity assay, in accordance with an embodiment of the present invention.

[0034] Further, those skilled in the art will appreciate that elements in the figures are illustrated for simplicity and may not have necessarily been drawn to scale. Furthermore, in terms of the method steps, chemical compounds, and parameters used herein may have been represented in the figures by conventional symbols, and the figures may show only those specific details that are pertinent to understanding the embodiments of the present disclosure so as not to obscure the figures with details that will be readily apparent to those skilled in the art having the benefit of the description herein.

DETAILED DESCRIPTION OF THE PRESENT INVENTION
[0035] The invention will now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more fully understood and appreciated.
[0036] The terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process or method that comprises a list of steps does not include only those steps but may include other steps not expressly listed or inherent to such a process or method. Similarly, one or more components, compounds, and ingredients preceded by "comprises... a" does not, without more constraints, preclude the existence of other components or compounds or ingredients or additional components. Appearances of the phrase "in an embodiment", "in another embodiment" and similar language throughout this specification may, but not necessarily do, all refer to the same embodiment.
[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. The system, methods, and examples provided herein are only illustrative and not intended to be limiting.
[0038] In the following specification and the claims, reference will be made to a number of terms, which shall be defined to have the following meanings. The singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise.
[0039] FIG. 1 depicts a flow diagram representing the steps of a method for detecting human papillomaviruses (HPV), specifically HPV16, 18, and 45, in accordance with an embodiment of the present invention.
[0040] FIG. 2 depicts a flowchart of development of a kit for cervical cancer screening involving self-sampling, viral DNA extraction, viral DNA amplification and result interpretation, in accordance with an embodiment of the present invention.
[0041] FIG. 3 depicts a line diagram of a self-sampling kit for detecting human papillomavirus (HPV) in a biological sample, in accordance with an embodiment of the present invention.
[0042] Embodiments of the present invention relate to providing a rapid, user-friendly, and cost-effective solution for human papillomavirus (HPV) detection. The present invention provides a method enabling individuals, particularly women, to conduct self-tests and report results promptly. The present innovative approach involves self-sampling of the vaginal region, followed by processing the sample with a specialized reagent mix to lyse cells and release nucleic acids at room temperature. Subsequent isothermal amplification of viral DNA and visualization of results using PCRD lateral flow strip. Therefore, the present invention aims to overcome barriers to large-scale HPV screening, thereby contributing to the prevention and management of cervical cancer on a global scale. The present invention has the potential to revolutionize cervical cancer screening efforts and contribute significantly to global public health initiatives aimed at reducing the burden of cervical cancer.
[0043] In an embodiment of the present invention, a self-sampling kit for detecting human papillomavirus (HPV) in a biological sample is provided. The self-sampling kit for detecting human papillomavirus (HPV) in a biological sample comprises a sterile swab for collection of a sample, a collection tube consisting of a lysis buffer comprising 0.8% Triton X-100 and 0.3% Tween 20, a recombinase polymerase amplification (RPA) reagent mix, and a lateral flow assay (LFA) test strip. The lysis buffer is optimized for releasing viral DNA at room temperature. The recombinase polymerase amplification (RPA) reagent mix comprises a set of primers for RPA amplification targeting E6-E7 regions of HPV types 16, 18, and 45 comprising a forward primer and a reverse primer specific to the E6-E7 regions of HPV 16. The forward primer comprises a sequence 5’- FAM-CACAGTTATGC[+A]CA[+G]AGCTGC -3’ (SEQ ID NO: 51), and the reverse primer comprises a sequence 5’- Biotin-CATATATTCA[+T]G[+C]AATGTAGGTGTA -3’ (SEQ ID NO: 52). A degenerate forward primer and a reverse primer specific to the E6-E7 region of HPV 18 and HPV 45. The degenerate forward primer comprises a sequence 5’- DIG-ACAAT[+G]GC[+K]GATCCAGAAGGTAC -3’ (SEQ ID NO: 53), and the reverse primer comprises a sequence 5’- Biotin -TCAATAAAATCTACCATATC[+C]GACC[+C]TGT -3’ (SEQ ID NO: 54). The set of primers consist of modified bases to minimize primer-dimer formation and secondary structures configured to optimize amplification efficiency. The lateral flow assay (LFA) test strip is configured for detection of amplification products obtained using the recombinase polymerase amplification (RPA) reagent mix. The amplification products comprise atleast one of amplicon size of 457 bp for HPV 16 and the amplicon size of 158 bp for HPV 18-45. The amplification products are detected at a dilution ratio of 1:16.
[0044] In an exemplary embodiment, the lysis buffer comprises 0.8% Triton X-100 and 0.3% Tween 20 added to 1 mM Tris, 10mM ethylenediaminetetraacetic acid (EDTA) at pH 8 as stabilizing agents to maintain nucleic acid integrity during storage and processing. The RPA reagent mix consists of the degenerate forward primer configured for simultaneous detection of HPV 18 and HPV 45. The LFA reagent is configured to provide a visual result within 45 minutes of processing the sample. The amplification is optimized for a temperature of 30 °C and an incubation time of 30 minutes. The amplification detects at least 1000 copies of human papillomavirus (HPV) DNA in the sample. The RPA reagent mix consists of the set of primers for RPA amplification targeting E6-E7 regions of HPV types 16, 18, and 45 at concentration of at concentration of 10 picomolar (pM) of HPV 16 forward primer and reverse primer and 15 pM of HPV 18-45 forward primer and 10 pM of HPV 18-45 reverse primer.
[0045] In another embodiment of the present invention, a composition for detecting HPV types 16, 18, and 45 in a biological sample is provided. The composition for detecting HPV types 16, 18, and 45 in a biological sample comprises a lysis buffer comprising 0.8% Triton X-100 and 0.3% Tween 20 for viral DNA release at room temperature; and a set of primers for RPA amplification targeting the E6-E7 regions of HPV types 16, 18, and 45. The set of primers for HPV 16 comprises a forward primer comprises a sequence a sequence 5’- FAM-CACAGTTATGC[+A]CA[+G]AGCTGC -3’ (SEQ ID NO: 51), and a reverse primer comprises a sequence 5’- Biotin -CATATATTCA[+T]G[+C]AATGTAGGTGTA -3’ (SEQ ID NO: 52). The set of primers for HPV 18 and HPV 45 comprises a degenerate forward primer comprises a sequence 5’- DIG-ACAAT[+G]GC[+K]GATCCAGAAGGTAC -3’ (SEQ ID NO: 53), and a reverse primer comprises a sequence 5’- Biotin -TCAATAAAATCTACCATATC[+C]GACC[+C]TGT -3’ (SEQ ID NO: 54). The set of primers for HPV 16 and the set of primers for HPV 18 and HPV 45 consist of modified bases to minimize primer-dimer formation and secondary structures configured to optimize amplification efficiency.
[0046] In another embodiment of the present invention, a method for detecting human papillomaviruses (HPV) is provided. The method comprises the steps of self-sampling a vaginal region using a self-sampling kit of the present invention, at step 102. The collected sample is introduced into the reagent solution to suspend epithelial cells and extract nucleic acids, at step 104. The sample-reagent mixture is incubated at room temperature for 30 minutes to lyse cells and release nucleic acids, at step 106. The viral DNA sequences are amplified at ambient temperature (25±3?) using the amplification mix containing the gene-specific primers targeting HPV16, 18, and 45, at step 108. The isothermal amplification of viral DNA is carried out at room temperature. The amplified products are visualized using polymerase chain reaction detection (PCRD) lateral flow technology, which provides rapid and user-friendly detection through the formation of distinct test and control lines, at step 110. Interpreting the results based on the presence or absence of visual signals, indicating one of presence and absence of HPV16, 18, and 45 infections, at step 112. The test outcomes are reported to direct individuals testing positive for HPV16, 18, or 45 infections to seek appropriate medical treatment and follow-up care, at step 114.
[0047] In another embodiment of the present invention, the method comprises the steps of an isothermal amplification by using recombinase polymerase amplification (RPA) technology. The amplified products are visualized using PCRD lateral flow technology, which provides rapid and user-friendly detection through the formation of distinct test and control lines. The instructions for self-testing and reporting HPV16, 18, and 45 infections include guidance on proper sample collection, reagent handling, and result interpretation, ensuring user-friendly and accurate testing.
[0048] In another embodiment of the present invention, a method for preparing a set of primers for detecting high-risk human papillomavirus (HPV) types 16, 18, and 45 is provided. The method comprises the steps of designing a forward and reverse primer specific to E6-E7 region of HPV 16, designing a degenerate forward primer and a reverse primer specific to the E6-E7 region of HPV 18 and HPV 45, and modifying the primers to minimize primer-dimer formation and secondary structures. The forward primer comprises a sequence 5’- FAM-CACAGTTATGC[+A]CA[+G]AGCTGC -3’ (SEQ ID NO: 51), and the reverse primer comprises a sequence 5’- Biotin -CATATATTCA[+T]G[+C]AATGTAGGTGTA -3’ (SEQ ID NO: 52). The degenerate forward primer comprises a sequence 5’- DIG-ACAAT[+G]GC[+K]GATCCAGAAGGTAC -3’ (SEQ ID NO: 53), and the reverse primer comprises a sequence 5’- Biotin -TCAATAAAATCTACCATATC[+C]GACC[+C]TGT -3’ (SEQ ID NO: 54). The forward and the reverse primer specific to a E6-E7 region of HPV 16 and the degenerate forward primer and the reverse primer specific to the E6-E7 region of HPV 18 and HPV 45 consist of modified bases to minimize primer-dimer formation and secondary structures configured to optimize amplification efficiency.
[0049] In another embodiment of the present invention, a system for detecting high-risk human papillomavirus (HPV) types 16, 18, and 45 is provided. The system for detecting high-risk human papillomavirus (HPV) types 16, 18, and 45 comprises a self-sampling kit, a set of primers, and a lateral flow assay (LFA) test strip as claimed in claim 1 configured to detect amplification products generated using a recombinase polymerase amplification (RPA) reagent mix. The amplification products are detected at a dilution ratio of 1:16.
[0050] The amplified products are visualized using PCRD lateral flow technology, which provides rapid and user-friendly detection through the formation of distinct test and control lines. The reagents for visualization of amplified DNA products enable the rapid and accurate detection of HPV16, 18, and 45 infections, thereby facilitating timely intervention and treatment.
[0051] In another embodiment of the present invention, a step-by-step protocol for rapid self-testing is provided. The step-by-step protocol for rapid self-testing comprises clear instructions for sample collection and preparation, defined incubation times and temperatures for reagent reactions, and simplified procedures for result visualization and interpretation.
[0052] The present invention is explained further in the following specific examples, which are only by way of illustration and are not to be construed as limiting the scope of the invention.
Examples
[0053] Sample Collection
Vaginal samples were collected using sterile swabs to ensure minimal contamination. The collected sample was transferred into a collection tube containing following buffer solutions:
Unique extraction buffer optimized for effective viral DNA release at room temperature.
Buffer composition:
0.8 % triton X-100 (range 0.1 % to 3.25%)
0.3 % tween 20 (range 0.1 % to 2.8 %)
[0054] Viral DNA Extraction
The collected sample was incubated in above lysis buffer at room temperature for 15 min to release viral DNA. The extracted DNA can be used immediately for isothermal amplification and result analysis.
[0055] Assay Optimization Protocol for HPV 16, 18, and 45 Using Synthetic Gene Controls
Design of Synthetic Gene Controls: Synthetic gene controls were designed for HPV 16, 18, and 45. These controls were used as templates for assay optimization.
Primer Selection and RPA Reaction Setup:
Primer
Designing and Selection: Multiple primer sets were designed for each HPV type.
Primer Design:
The E6 and E7 genes of high-risk HPV types encode oncoproteins that interfere with tumor suppressor proteins and play a key role in cellular transformation by disrupting tumor suppressor pathways. Primers were designed using Primer-BLAST and primedRPA, specifically targeting the overlapping E6-E7 region of HPV types 16, 18, and 45, (~70-627 bps) ensuring suitability for RPA conditions.
HPV_16:
Seq_ID HPV_16 Forward Primers
Seq1 5’-CATCAAGAACACGTAGAGAAACCCAGC-3’
Seq2 5’- CACAGTTATGCACAGAGCTGC-3’
Seq3 5’- GTCAAAAGCCACTGTGTCC-3’
Seq4 5’- GAACAGCAATACAACAAACCG-3’
Seq5 5’- ATCAAGAACACGTAGAGAAACCCAGCT-3’
Seq6 5’- CATCAAGAACACGTAGAGAAACCCAGC-3’
Seq7 5’- ACAGGAGCGACCCAGAAAGTTACCACA-3’
Seq8 5’- CATCAAGAACACGTAGAGAAACCCAGCT-3’
Seq9 5’- ATCAAGAACACGTAGAGAAACCCA-3’
Seq10 5’- GACTTTGCTTTTCGGGATTTATGC-3’

Seq_ID HPV_16 Reverse Primers
Seq11 5’- ACGCACAACCGAAGCGTAGAGTCACAC -3’
Seq12 5’- CATATATTCATGCAATGTAGGTGTA -3’
Seq13 5’- ATCCCGAAAAGCAAAGTCATATACCTC -3’
Seq14 5’- GCATAAATCCCGAAAAGCAAAGTC -3’
Seq15 5’- GCTGGGTTTCTCTACGTGTTCTTG -3’
Seq16 5’- TGGGTTTCTCTACGTGTTCTTG -3’
Seq17 5’- CGGTTTGTTGTATTGCTGTTCT -3’
Seq18 5’- GATGTCTTTGCTTTTCTTCAGG -3’

HPV_18:
Seq_ID HPV_18 Forward Primers
Seq19 5’- CTCCAACGACGCAGAGAAACACAAGTA -3’
Seq20 5’- GACTCCAACGACGCAGAGAAACACAAG -3’
Seq21 5’- CGACTCCAACGACGCAGAGAAACACAA-3’
Seq22 5’- TTGTGTATGTGTTGTAAGTGTGAAGCC -3’
Seq23 5’- GTTGTGTATGTGTTGTAAGTGTGAAGC -3’
Seq24 5’- CACGAGCAATTAAGCGACTCAGAGGAA-3’
Seq25 5’- AAGCGACTCAGAGGAAGAAAACGATGA -3’
Seq26 5’- TAAGCGACTCAGAGGAAGAAAACGATG-3’
Seq27 5’- ACGAGCCGAACCACAACGTCACACAAT-3’

Seq_ID HPV_18 Reverse Primers
Seq28 5’- GCTTCACACTTACAACACATACACAAC -3’
Seq29 5’- GGCTTCACACTTACAACACATACACAA -3’
Seq30 5’- GGCTTCACACTTACAACACATACACAACA -3’
Seq31 5’- CTGGAATGCTCGAAGGTCGTCTGCTGA-3’

HPV_45:
Seq_ID HPV_45 Forward Primers
Seq32 5’- CCTGTTGACCTGTTGTGTTACG -3’
Seq33 5’- TCCTGTTGACCTGTTGTGTTAC -3’
Seq34 5’- GAAACCATTGAACCCAGCAGAAAA-3’
Seq35 5’- CATGCACAACTACCAGCCCGACGA-3’
Seq36 5’- ACCAGGCACGGCAAGAAAGACTT-3’
Seq37 5’- AGAAACCATTGAACCCAGCAGAAA-3’

Seq_ID HPV_45 Reverse Primers
Seq38 5’-CCGTCACACTTACAACATACACACAAA-3’
Seq39 5’-GCCGTCACACTTACAACATACACACAA-3’
Seq40 5’- GCTCTCTACTGTAAGCTCAATTCTGCC -3’
Seq 41 5’- TCTGCTTCATCGTTTTCCTCCTCT -3’
Seq42 5’-CGTCACACTTACAACATACACACAAA-3’

A single degenerate primer was designed for HPV 18 and HPV 45 to simultaneously detect another HPV high risk in single reaction efficiently.
HPV18-45:

Seq_ID HPV_18-45 Forward Primers
Seq43 5’- TACCAGCCCGACGAGCCGAACCACA -3’
Seq44 5’- ACAATGGCKGATCCAGAAGGTAC -3’

Seq_ID HPV_18-45 Reverse Primers
Seq45 5’- GCACACCACGGACACACAAAGGACA -3’
Seq46 5’- TCAATAAAATCTACCATATCCGACCCTGT -3’
The designed primers underwent rigorous specificity checks using Primer-BLAST to confirm their exclusive targeting of HPV DNA. Further validation was performed to assess the potential for primer dimer formation and secondary structures using computational tools such as OligoAnalyzer, Oligo Analysis Tool, Primer Stats Tool, and MFEprimer 3.
Multiple primer pairs were screened individually for efficiency and specificity.
Amplicon lengths for HPV16 range from 70 bps to 627 bps.
Amplicon lengths for HPV18 range from 78 bps to 302 bps.
Amplicon lengths for HPV45 range from 73 bps to 397 bps.
Amplicon lengths for HPV18-45 range from 158 bps to 334 bps.
Below is the list of primers that were successfully designed and validated for optimal performance.
Seq_ID HPV_16 Amplicon length
Forward-Seq2 5’- CACAGTTATGCACAGAGCTGC -3’ 457 bps
Reverse-Seq12 5’- CATATATTCATGCAATGTAGGTGTA -3’

Seq_ID HPV_18-45 Amplicon length
Forward-Seq44 5’- ACAATGGCKGATCCAGAAGGTAC -3’ 158 bps
Reverse-Seq46 5’- TCAATAAAATCTACCATATCCGACCCTGT -3’
These primers were further modified to enhance specificity and to avoid primer-dimer formation.
Seq_ID HPV_16 Amplicon length
Forward-Seq47 5’- CACAGTTATGC[+A]CA[+G]AGCTGC -3’ 457 bps
Reverse-Seq48 5’- CATATATTCA[+T]G[+C]AATGTAGGTGTA -3’

Seq_ID HPV_18-45 Amplicon length
Forward-Seq49 5’- ACAAT[+G]GC[+K]GATCCAGAAGGTAC -3’ 158 bps
Reverse-Seq50 5’- TCAATAAAATCTACCATATC[+C]GACC[+C]TGT -3’

Seq_ID HPV_16 Amplicon length
Forward-Seq51 5’- FAM-CACAGTTATGC[+A]CA[+G]AGCTGC -3’ 457 bps
Reverse-Seq52 5’- Biotin-CATATATTCA[+T]G[+C]AATGTAGGTGTA -3’

Seq_ID HPV_18-45 Amplicon length
Forward-Seq53 5’- DIG-ACAAT[+G]GC[+K]GATCCAGAAGGTAC -3’ 158 bps
Reverse-Seq54 5’- Biotin-TCAATAAAATCTACCATATC[+C]GACC[+C]TGT -3’

[0056] RPA Reaction Setup
Materials:
Recombinase Polymerase Amplification (RPA) kit (manufacturer's recommended reagents), Forward and reverse primers (10 pM stock), Synthetic gene control (target DNA template), Magnesium acetate (280 mM), and Nuclease-free water.
Procedure
Preparing the RPA master mix in a sterile PCR tube: Adding, 29.5 µL Rehydration buffer, 2.4 µL Forward primer (10 pM), 2.4 µL Reverse primer (10 pM), 2.0 µL Template DNA (synthetic gene control), 12.2 µL Nuclease-free water, and 2.5 µL Magnesium acetate (280 mM). Briefly vortexing and spinning down. Incubating the reaction at 30 °C for 30 minutes. Mixing by tapping every 5 minutes to ensure proper amplification.
Product Purification
Materials: PCR cleanup kit (column-based purification), Elution buffer.
Procedure: Adding 250 µL binding buffer to the RPA reaction. Transferring to a purification column and centrifuge at 12,000 × g for 1 min. Washing with 700 µL wash buffer and centrifuge at 12,000 × g for 1 min. Repeating the wash step with 700 µL wash buffer. Dry spinning at 12,000 × g for 1 min. Eluting the purified DNA with 50 µL elution buffer, and Purified product analyzed in gel electrophoresis.
[0057] Gel Electrophoresis Analysis
Materials: 2% Agarose gel, 1X TAE buffer, Loading dye, DNA ladder (1 kb ladder), and Gel electrophoresis apparatus.
Procedure: Preparing a 2% agarose gel in 1X TAE buffer. Adding 1 µL ethidium bromide (or safe alternative) per 50 mL gel. Loading 5 µL purified RPA product mixed with 1 µL loading dye. Running the gel at 100V for 40 minutes. Visualizing under UV or blue light transilluminator. Identifying specific, intense bands corresponding to expected product sizes for primer selection.
[0058] Interpretation and Primer Selection
Primers yielding specific, intense bands with minimal non-specific amplification were selected for further validation. Primer pairs Seq51, Seq52, Seq53, and Seq54 was used for assay optimization and validation in subsequent experiments.
[0059] HPV 16 Primer Selection:
Various combinations of primer pairs were initially tested for their ability to amplify the target HPV 16 sequence.
The primer pairs were diluted and subjected to isothermal amplification reactions, including the necessary controls. Following electrophoresis on an agarose gel, the amplification products were analysed.
Among all the tested primer pairs, Seq51, Seq52 exhibited a clean, crisp and bright band of amplicon at desired size without the presence of any non-specific bands, visible on the agarose gel.
Consequently, Seq51, Seq52 of HPV16 was selected for further optimization and experimental procedures.
[0060] Optimisation of Primer concentration for HPV 16 detection by RPA
Isothermal amplification with the following concentrations of the primer pair was performed: 10 pM, 15 pM, 20 pM. 10 pM was chosen as the optimal concentration due to its balance between yield and specificity, providing reliable results without non-specific amplification.
[0061] FIG. 4 depicts a gel image for optimization of HPV 16 primer concentration, in accordance with an embodiment of the present invention.
[0062] Optimisation of template volume for isothermal amplification for HPV 16 detection
Isothermal amplification with the following template concentrations was performed: 1µL, 2 µL and 3µL. 1µL was chosen as the optimal template concentration due to its balance between yield and specificity, providing reliable results without non-specific amplification.
[0063] FIG. 5 depicts optimization of template volume with selected HPV 16 primer, in accordance with an embodiment of the present invention.
[0064] Optimisation of temperature for isothermal amplification for HPV 16 detection
To determine the optimal reaction temperature, a gradient of isothermal amplification reactions was conducted, ranging from 30 °C to 47 °C. By observing the results, 30 °C temperature was selected as optimal temperature for isothermal amplification as, intensity and clarity of the amplicon band was highest at this temperature.
[0065] Optimisation of time for HPV 16 detection by RPA:
Isothermal amplification reactions were performed with varying incubation times of 20 minutes, 30 minutes, and 40 minutes to assess the effect of reaction time on amplicon yield and specificity. The reaction at 30 minutes yielded a bright band without the presence of non-specific bands, making it the optimal incubation time for subsequent experiments.
[0066] FIG. 6 depicts optimization of temperature and time with selected HPV 16 primer, in accordance with an embodiment of the present invention.
[0067] HPV 18-45 Primer Validation
Various combinations of primer pairs were initially tested for their ability to amplify the target HPV 18 and HPV 45 sequence. The primer pairs were diluted and subjected to isothermal amplification reactions, including the necessary controls. Following electrophoresis on an agarose gel, the amplification products were analysed. Among all the tested primer pairs, primer pair Seq53, Seq54 exhibited a clean, crisp and bright band of amplicon at desired size without the presence of any non-specific bands, visible on the agarose gel. Consequently, primer pair Seq53, Seq54 of HPV18 and HPV45 was selected for further optimization and experimental procedures.
[0068] HPV 18-45 Primer concentration Optimisation:
Isothermal amplification with the following concentrations of the primer pair was performed: 10 pM concentration of forward and reverse primer was chosen as the optimal concentration due to its balance between yield and specificity, providing reliable results without non-specific amplification.
[0069] FIG. 7 depicts a gel image for optimization of HPV 18-45 primer concentration, in accordance with an embodiment of the present invention.
[0070] Optimisation of template volume for isothermal amplification for HPV 18-45 detection
Isothermal amplification with the following template concentrations was performed: 1µL, 2 µL and 3µL. 1µL was chosen as the optimal template concentration due to its balance between yield and specificity, providing reliable results without non-specific amplification.
[0071] FIG. 8 depicts optimization of template volume with selected HPV 18-45 primer, in accordance with an embodiment of the present invention.
[0072] HPV16,18-45 Multiplex reaction optimization:
HPV16, 18-45 multiplex PCR reaction was set up using the usual optimized reaction volumes. The optimized primer concentrations were incorporated into the multiplex reaction. The initial concentrations did not produce proper amplification. Therefore, Multiple isothermal reactions were carried out with varying reaction volumes and altered concentrations of HPV16, HPV18-45 primers. Reactions were incubated at different temperatures and time intervals. The optimisation was carried out until clear amplicons for HPV16 and HPV18-45 were observed on the agarose gel. The following conditions were optimized for the multiplexing reaction:
Reaction Component Reagent Condition
Primer HPV 16 primer for multiplex reaction Primer Concentration:
Forward- 10pM
Reverse- 10pM

HPV 18-45 primer for multiplex reaction Primer Concentration:
Forward- 15pM
Reverse- 10pM

Temperature Incubation temperature for multiplex reaction 300 C
Time Incubation time for multiplex reaction 30mins

[0073] FIG. 9 depicts a gel image for optimization of multiplexed HPV 16 and HPV 18-45 primer concentration, in accordance with an embodiment of the present invention.
[0074] Optimization of Lateral flow assay (LFA)
Lateral flow assay (LFA) was used for the detection of the isothermal reaction. The isothermal reaction was performed using no template control for the optimization of dilution buffer ratios in order to avoid any bias introduced by left -over unused labelled primers. The isothermal reaction product was diluted to 1:14, 1:16 and 1:18 with lateral flow buffer and loaded onto the lateral flow device. (PCRD, Abingdon Health, UK). A ratio of 1:16 was optimized, as it provided accurate results in no template control without any bias of left -over unused labelled primers.
[0075] FIG. 10 depicts optimization of buffer dilution for lateral flow assay (LFA), in accordance with an embodiment of the present invention.
[0076] Visualization of the HPV 16 detection with lateral flow assay
The isothermal reaction was performed under optimized condition using HPV 16 synthesized template. The isothermal reaction product was diluted to 1:16 with lateral flow buffer and loaded onto the lateral flow device.
[0077] FIG. 11 depicts visualization of the HPV16 detection with lateral flow assay (LFA), in accordance with an embodiment of the present invention.
[0078] Visualization of the HPV 18-45 detection with lateral flow assay
The isothermal reaction was performed under optimized condition using HPV 18-45 synthesized template The isothermal reaction product was diluted to 1:16 with lateral flow buffer and loaded onto the lateral flow device.
[0079] FIG. 12 depicts visualization of the HPV18-45 detection with lateral flow assay (LFA), in accordance with an embodiment of the present invention.
[0080] Visualization of the multiplexed HPV16 and HPV 18-45 detection with lateral flow assay
The isothermal reaction was performed under optimized condition using HPV 16 and HPV 18-45 synthesized template The isothermal reaction product was diluted to 1:16 with lateral flow buffer and loaded onto the lateral flow device.
[0081] FIG. 13 depicts visualization of the multiplexed HPV 16 and HPV18-45 detection with lateral flow assay (LFA), in accordance with an embodiment of the present invention.
[0082] Determination of limit of detection of HPV16 and HPV 18-45
Serial dilutions of synthetic template were prepared as 106, 105 ,104 ,103 ,102 and detection was successfully achieved down to 1000 copies.
[0083] FIG. 14 depicts limit of detection (LOD) determination with LFA, in accordance with an embodiment of the present invention.
[0084] Cross reactivity of the assay
To evaluate specificity, cross-reactivity testing was conducted by pooling DNA templates isolated from multiple microorganisms responsible for causing STIs. The same pooled template was used for isothermal amplification under optimized condition with optimized primers. The assay demonstrated high accuracy in distinguishing target pathogens from non-target species, reducing false positives and improving diagnostic reliability.
[0085] FIG. 15 depicts a cross-reactivity assay, in accordance with an embodiment of the present invention.
[0086] A further embodiment involves strategies for cost-effective mass production, including optimization of reagent formulations for scalability and cost efficiency, identification of affordable raw materials and production methods, and streamlined packaging and distribution processes to minimize overhead costs.
[0087] Therefore, the present invention provides a novel and comprehensive approach to HPV detection, encompassing the entire process from sample collection to result interpretation. The development of a novel lysis buffer enables efficient cell lysis at room temperature, eliminating the need for thermal or enzymatic disruption, thereby simplifying sample processing while preserving nucleic acid integrity. Furthermore, the present invention employs a uniquely designed single degenerate primer capable of concurrently detecting two distinct HPV strains, enhancing assay sensitivity and specificity. Furthermore, the incorporation of modified bases in the primer design optimizes assay performance by minimizing primer-dimer formation, thereby improving amplification efficiency and overall assay robustness. These innovations collectively establish a highly efficient, accurate, and scalable method for cervical cancer screening detection, offering significant improvements over existing molecular diagnostic approaches.
[0088] The present invention provides a self-sampling kit facilitating convenient and rapid screening for HPV infections. By enabling individuals to conduct tests at home, accessibility to screening is greatly improved, particularly for remote or underserved populations. With results available within an hour, timely intervention and treatment for positive cases are ensured, contributing to improved healthcare outcomes. The present invention offers a cost-effective and user-friendly self-sampling kit and method that addresses critical challenges in traditional screening methods, making significant strides towards cervical cancer prevention on a global scale.
[0089] The self-sampling kit of the present invention allows individuals to conduct HPV testing in the comfort of their own homes, eliminating the need for visits to healthcare facilities. This increases accessibility to screening, particularly for individuals in remote or underserved areas. The use of PCR amplification and visualization enables rapid detection of HPV infections within a short timeframe, typically less than an hour. This facilitates timely intervention and treatment for positive cases, enhancing overall healthcare outcomes.
[0090] The self-sampling kit of the present invention utilizes readily available reagents and materials, making it a cost-effective alternative to traditional HPV testing methods. By eliminating the need for specialized equipment and laboratory infrastructure, the invention reduces the overall cost of screening. The amplification mixes and visualization strip used in the present invention offer high sensitivity and specificity in detecting HPV16, 18, and 45 infections. This ensures accurate diagnosis and reduces the likelihood of false-positive or false-negative results.
[0091] The present invention empowers individuals, especially women, to conduct self-tests and report results promoting health literacy and awareness about HPV infections and cervical cancer. By taking an active role in their own healthcare, individuals can make informed decisions about their health and seek appropriate medical care when necessary. Also, the simplicity and scalability of the present invention make it suitable for large-scale screening programs aimed at reaching vulnerable and underserved populations. This facilitates the achievement of global health goals related to cervical cancer prevention and elimination.
[0092] While considerable emphasis has been placed herein on the components and component parts of the preferred embodiments, it will be appreciated that many embodiments can be made and that many changes can be made in the preferred embodiments without departing from the principles of the present invention. These and other changes in the preferred embodiment as well as other embodiments of the disclosure will be apparent to those skilled in the art from the invention herein, whereby it is to be distinctly understood that the foregoing descriptive matter is to be interpreted merely as illustrative of the invention and not as a limitation.

,CLAIMS:WE CLAIM:
1. A self-sampling kit for detecting human papillomavirus (HPV) in a biological sample, comprising:
a sterile swab for collection of a sample;
a collection tube consisting of a lysis buffer comprising 0.8% Triton X-100 and 0.3% Tween 20,
wherein the lysis buffer is optimized for releasing viral DNA at room temperature;
a recombinase polymerase amplification (RPA) reagent mix comprising:
a set of primers for RPA amplification targeting E6-E7 regions of HPV types 16, 18, and 45 comprises:
a forward primer and a reverse primer specific to the E6-E7 regions of HPV 16,
wherein the forward primer comprises a sequence 5’- FAM-CACAGTTATGC[+A]CA[+G]AGCTGC -3’ (SEQ ID NO: 51), and the reverse primer comprises a sequence 5’- Biotin-CATATATTCA[+T]G[+C]AATGTAGGTGTA -3’ (SEQ ID NO: 52); and
a degenerate forward primer and a reverse primer specific to the E6-E7 region of HPV 18 and HPV 45,
wherein the degenerate forward primer comprises a sequence 5’- DIG-ACAAT[+G]GC[+K]GATCCAGAAGGTAC -3’ (SEQ ID NO: 53), and the reverse primer comprises a sequence 5’- Biotin -TCAATAAAATCTACCATATC[+C]GACC[+C]TGT -3’ (SEQ ID NO: 54);
wherein the set of primers consist of modified bases to minimize primer-dimer formation and secondary structures configured to optimize amplification efficiency; and
a lateral flow assay (LFA) test strip configured for detection of amplification products obtained using the recombinase polymerase amplification (RPA) reagent mix,
wherein the amplification products comprise atleast one of amplicon size of 457 bp for HPV 16 and the amplicon size of 158 bp for HPV 18-45; and
wherein the amplification products are detected at a dilution ratio of 1:16.
2. The self-sampling kit as claimed in claim 1, wherein the lysis buffer comprises 0.8% Triton X-100 and 0.3% Tween 20 added to 1 mM Tris, 10mM ethylenediaminetetraacetic acid (EDTA) at pH 8 as stabilizing agents to maintain nucleic acid integrity during storage and processing.
3. The self-sampling kit as claimed in claim 1, wherein the RPA reagent mix consists of the degenerate forward primer configured for simultaneous detection of HPV 18 and HPV 45.
4. The self-sampling kit as claimed in claim 1, wherein the LFA reagent is configured to provide a visual result within 45 minutes of processing the sample.
5. The self-sampling kit as claimed in claim 1, wherein the amplification is optimized for a temperature of 30 °C and an incubation time of 30 minutes.
6. The self-sampling kit as claimed in claim 1, wherein the amplification detects at least 1000 copies of human papillomavirus (HPV) DNA in the sample.
7. The self-sampling kit as claimed in claim 1, wherein the RPA reagent mix consists of the set of primers for RPA amplification targeting E6-E7 regions of HPV types 16, 18, and 45 at concentration of 10 picomolar (pM) of HPV 16 forward primer and reverse primer and 15 pM of HPV 18-45 forward primer and 10 pM of HPV 18-45 reverse primer.
8. A composition for detecting HPV types 16, 18, and 45 in a biological sample, comprising:
a lysis buffer comprising 0.8% Triton X-100 and 0.3% Tween 20 for viral DNA release at room temperature; and
a set of primers for RPA amplification targeting the E6-E7 regions of HPV types 16, 18, and 45, wherein:
the set of primers for HPV 16 comprises:
a forward primer comprises a sequence a sequence 5’- FAM-CACAGTTATGC[+A]CA[+G]AGCTGC -3’ (SEQ ID NO: 51); and
a reverse primer comprises a sequence 5’- Biotin -CATATATTCA[+T]G[+C]AATGTAGGTGTA -3’ (SEQ ID NO: 52);
the set of primers for HPV 18 and HPV 45 comprises:
a degenerate forward primer comprises a sequence 5’- DIG-ACAAT[+G]GC[+K]GATCCAGAAGGTAC -3’ (SEQ ID NO: 53); and
a reverse primer comprises a sequence 5’- Biotin -TCAATAAAATCTACCATATC[+C]GACC[+C]TGT -3’ (SEQ ID NO: 54);
wherein the set of primers for HPV 16 and the set of primers for HPV 18 and HPV 45 consist of modified bases to minimize primer-dimer formation and secondary structures configured to optimize amplification efficiency.
9. A method for preparing a set of primers for detecting high-risk human papillomavirus (HPV) types 16, 18, and 45, comprising:
designing a forward and reverse primer specific to a E6-E7 region of HPV 16,
wherein the forward primer comprises a sequence 5’- FAM-CACAGTTATGC[+A]CA[+G]AGCTGC -3’ (SEQ ID NO: 51), and the reverse primer comprises a sequence 5’- Biotin -CATATATTCA[+T]G[+C]AATGTAGGTGTA -3’ (SEQ ID NO: 52);
designing a degenerate forward primer and a reverse primer specific to the E6-E7 region of HPV 18 and HPV 45,
wherein the degenerate forward primer comprises a sequence 5’- DIG-ACAAT[+G]GC[+K]GATCCAGAAGGTAC -3’ (SEQ ID NO: 53), and the reverse primer comprises a sequence 5’- Biotin -TCAATAAAATCTACCATATC[+C]GACC[+C]TGT -3’ (SEQ ID NO: 54); and
modifying the primers to minimize primer-dimer formation and secondary structures;
wherein the forward and the reverse primer specific to a E6-E7 region of HPV 16 and the degenerate forward primer and the reverse primer specific to the E6-E7 region of HPV 18 and HPV 45 consist of modified bases to minimize primer-dimer formation and secondary structures configured to optimize amplification efficiency.
10. A system for detecting high-risk human papillomavirus (HPV) types 16, 18, and 45, comprising:
a self-sampling kit as claimed in claim 1;
a set of primers as claimed in claim 1; and
a lateral flow assay (LFA) test strip as claimed in claim 1 configured to detect amplification products generated using a recombinase polymerase amplification (RPA) reagent mix,
wherein the amplification products are detected at a dilution ratio of 1:16.

Dated this 21st Day of March, 2025

AGENT FOR APPLICANT

Dr. Suryawanshi Mohini K.
(IN/PA-2023)