Sign In to Follow Application
View All Documents & Correspondence

A Formulation Comprising A Homogeneous Population Of Mesenchymal Stem Cells And Implementations Thereof

Abstract: ABSTRACT A FORMULATION COMPIRISING A HOMOGENEOUS POPULATION OF MESENCHYMAL STEM CELLS AND IMPLEMENTATIONS THEREOF 5 The present disclosure relates to a formulation comprising: a) a population of mesenchymal stem cells (MSCs); and b) a carrier selected from serelaxin, Ringer’s lactate solution, human serum albumin (HSA), dextran, heparin, hyaluronidase, or combinations thereof; wherein said population of MSCs is a homogeneous population having size in the range of 15-30 µm; wherein at least 50% of the MSCs 10 express at least one marker selected from the group consisting of CD 90, CD73, and CD 105. The MSCs as part of the disclosed formulation exhibited 97% cell recovery and more than 90% cell viability. 15

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
22 April 2024
Publication Number
43/2025
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

REGROW BIOSCIENCES PRIVATE LIMITED
Regrow Biosciences Private Limited Ground Floor, 22, Shah Industrial Estate, Nagargaon, Pune, Maharashtra 410401, India

Inventors

1. SANGHAVI, Satyen
Regrow Biosciences Private Limited Ground Floor, 22, Shah Industrial Estate, Nagargaon, Pune, Maharashtra 410401, India
2. KEDAGE, Vinayak
Regrow Biosciences Private Limited Ground Floor, 22, Shah Industrial Estate, Nagargaon, Pune, Maharashtra 410401, India

Claims

1. A formulation comprising: a) a population of mesenchymal stem cells (MSCs); and b) a carrier selected from serelaxin, Ringer’s lactate solution, human serum 5 albumin (HSA), heparin, dextran, or combinations thereof; wherein said population of MSCs is a homogeneous population having size in the range of 15-30 µm; wherein at least 50% of the MSCs express at least one marker selected from the group consisting of CD 90, CD73, and CD

105. 10 2. The formulation as claimed in claim 1, wherein the carrier further comprises hyaluronidase.

3. The formulation as claimed in claim 1, wherein the MSCs exhibit increased expression of COL12A1 gene, IGFBP5 gene, THBS2 gene and GREM 1 gene, as compared to the expression of GAPDH gene, wherein the 15 increased expression of COL12A1 is in the range of 14 to 19 folds as compared to the expression of GAPDH gene; wherein the increased expression of IGFBP5 gene is in the range of 14 to 18 folds as compared to the expression of GAPDH gene; wherein the increased expression of THBS2 gene is in the range of 15 to 17 folds as compared to the expression 20 of GAPDH gene; wherein the increased expression of GREM 1 gene is in the range of 18 to 21 folds as compared to the expression of GAPDH gene.

4. The formulation as claimed in claim 1, wherein said formulation comprises secretome of said MSCs comprising VEGF in an amount in the range of 2050 to 2390 µg per million MSCs, and IL-10 in an amount in the range of 25 1430 to 1690 µg per million MSCs.

5. The formulation as claimed in claim 1, wherein the carrier is in a weight percentage range of 0.5 to 2.5% of the formulation.

6. The formulation as claimed in claim 1 or claim 2, wherein the serelaxin is a 0.5 to 5 ng/ml concentration solution; the Ringer’s lactate solution 30 comprises 25 to 30 mM of sodium lactate, 100 to 105 mM of sodium chloride, and 3.5 to 4.5 mM of potassium chloride and 1.5 to 2 mM of calcium chloride; HSA is a 1 to 20% concentration solution; dextran is a 0.5% to 19% concentration solution; heparin is in a concentration range of 500 to 2000 U/ml; and hyaluronidase is in a concentration range of 500 to 5000 U/ml. 5 7. The formulation as claimed in claim 1, wherein the MSCs are present in the range of 0.5 x 106 cells/ ml to 2 x 106 cells/ml of the formulation, preferably 1.8 x 106 cells/ ml of the formulation.

8. The formulation as claimed in claim 1, wherein the homogeneous population of MSCs is obtained by artificial intelligence driven 10 microfluidic sorting of culture expanded MSCs, preferably using an artificial intelligence-based tool.

9. The formulation as claimed in claim 1, wherein the MSCs are derived from umbilical cord tissue, cord blood, adipose tissue, bone marrow, or dental pulp. 15 10. The formulation as claimed in claim 1, wherein the homogeneous population of MSCs are present in a suspension comprising an excipient selected from DMEM, human serum albumin (HSA) or combinations thereof; preferably the excipient is DMEM and 20% HSA solution in a weight ratio in a range of 1:2 to 2:1, more preferably the excipient is 20 DMEM and 20% HSA solution in a weight ratio of 1:1.

11. The formulation as claimed in claim 1, wherein the formulation comprises additives selected from DMEM medium, saline solution, phosphate buffered saine (PBS) buffer, Hank’s balanced salt solution (HBSS), human plasma, plasma lysate, or mixtures thereof. 25 12. The formulation as claimed in claim 1, wherein percentage cell recovery of said MSCs in the formulation estimated after 0 to 24 hours is in the range of 99 to 80% and a percentage cell viability of said MSCs in the formulation estimated after 0 to 24 hours is in the range of 99.8% to 80%.

13. The formulation as claimed in claim 1, wherein the formulation has a pH 30 in the range of 6.4 to 6.6; and wherein the formulation has an osmolarity in the range of 275 to 310 mOsm/L.

14. The formulation as claimed in claim 1, wherein the population of MSCs comprises less than 6% of early apoptotic cells; and less than 3% of late apoptotic cells.

15. A method for preparing the formulation as claimed in claim 1, wherein 5 the method comprises: mixing the plurality of MSCs with the carrier to obtain the formulation.

16. The method as claimed in claim 15, wherein the method further comprises the addition of one or more additives.

17. A method of inducing tissue regeneration, comprising: 10 administering to a tissue in need thereof the formulation as claimed in claim 1 or obtained by the method as claimed in claim 15; wherein the tissue is selected from epithelial tissue; connective tissue like bone tissue, cartilage tissue or elastic tissue; muscle tissue; or nervous tissue.

18. A method of treating autoimmune or fibrotic disease in a subject, 15 comprising: administering the formulation as claimed in claim 1 or obtained by the method as claimed in claim 15 to the subject.

19. The method as claimed in claim 18, wherein administering the formulation is via the intravenous, intramuscular, intraosseous, 20 subcutaneous, intraplantar, or intraarticular route.

20. Use of the formulation as claimed in claim 1 in the manufacture of a medicament for treating autoimmune or fibrotic disease in a subject.

21. The method as claimed in claim 18 or the use as claimed in claim 20, wherein the auto immune disease or fibrotic disease is selected from the 25 group consisting of Acromegaly, Acquired Aplastic Anemia, Acquired Hemophilia, Agammaglobulinemia, Alopecia Areata, Ankylosing Spondylitis (AS), Anti-NMDA Receptor Encephalitis, Antiphospholipid Syndrome (APS), Arteriosclerosis, Autoimmune Addison’s Disease (AAD), Autoimmune Autonomic Ganglionopathy (AAG), Autoimmune 30 Encephalitis (AE)/Acute Disseminated Encephalomyelitis (ADEM), Autoimmune Gastritis, Autoimmune Hemolytic Anemia (AIHA), Autoimmune Hepatitis, Autoimmune Hyperlipidemia, Autoimmune Hypophysitis/Lymphocytic Hypophysitis, Autoimmune Inner Ear Disease (AIED), Autoimmune Lymphoproliferative Syndrome (ALPS), Autoimmune Myelofibrosis (AIMF), Autoimmune Myocarditis, 5 Autoimmune Oophoritis, Autoimmune Pancreatitis (AIP), Autoimmune Polyglandular Syndromes (APS), Autoimmune Progesterone Dermatitis (APD), Autoimmune Retinopathy (AIR), Autoimmune Sudden Sensorineural Hearing Loss, Balo Disease/Concentric Sclerosis, Behçet’s Disease, Birdshot Chorioretinopathy/Birdshot Uveitis, Bullous 10 Pemphigoid, Castleman Disease, Celiac Disease, Chagas Disease, Chronic Inflammatory Demyelinating Polyneuropathy (CIDP), Chronic Autoimmune Urticaria, Churg-Strauss Syndrome/Eosinophilic Granulomatosis with Polyangiitis (EGPA), Cogan's Syndrome (CS), Cold Agglutinin Disease (CAD), Crest Syndrome, Crohn's Disease, Stricturing 15 Crohn's Disease, Cronkhite-Canada Syndrome (CCS), Cryptogenic Organizing Pneumonia (COP), Dermatitis Herpetiformis (DH), Dermatomyositis, Diabetes, Type 1 (T1D), Discoid Lupus Erythematosus (DLE), Dressler’s Syndrome/ Post myocardial Infarction/ Post pericardiotomy Syndrome, Eczema/Atopic Dermatitis, Eosinophilic 20 Fasciitis, Erythema Nodosum, Essential Mixed Cryoglobulinemia, Evans Syndrome, Fibrosing Alveolitis/Idiopathic Pulmonary Fibrosis (IPF), Giant Cell Arteritis/Temporal Arteritis/Horton's Disease, Giant Cell Myocarditis, Glomerulonephritis (GN), Goodpasture’s Syndrome/Anti-Gbm/Anti-Tbm Disease, Granulomatosis With Polyangiitis (GPA)/Wegener's 25 Granulomatosis, Graves’ Disease (GD), Guillain-Barrè Syndrome (GBS), Hashimoto’s Thyroiditis/Autoimmune Thyroiditis, Henoch-Schölein Purpura (HSP)/Iga Vasculitis, Hidradenitis Suppurativa, Hurst’s Disease/Acute Hemorrhagic Leukoencephalitis (AHLE), Hypogammaglobulinemia, Iga Nephropathy/Berger’s Disease, Immune- 30 Mediated Necrotizing Myopathy (IMNM), Immune Thrombocytopenia (Itp)/Autoimmune Thrombocytopenia Purpura, Inclusion Body Myositis (IBM), Igg4-Related Sclerosing Disease (ISD), Interstitial Cystitis, Juvenile Idiopathic Arthritis (Jia)/Adult-Onset Still's Disease, Juvenile polymyositis/Juvenile dermatomyositis/ juvenile myositis, Kawasaki disease, Lambert-Eaton Myasthenic Syndrome (LEMS), Leukocytoclastic 5 vasculitis, Lichen Planus, Lichen Sclerosus, Ligneous conjunctivitis, Linear Iga Disease (LAD), Lupus Nephritis (LN), Lyme Disease / Chronic Lyme Disease / Post-Treatment Lyme Disease Syndrome (PTLDS), Lymphocytic colitis/microscopic colitis, Lymphocytic hypophystitis/autoimmune hypophystitis, Ménière’s Disease, Microscopic 10 Polyangiitis (MPA)/ANCA-Associated Vasculitis, Mixed Connective Tissue Disease (MCTD), Mooren’s ulcer, Mucha-Habermann disease, Multifocal motor neuropathy, Multiple Sclerosis (MS), Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS), Myasthenia Gravis (MG), Narcolepsy, Neuromyelitis Optica/Devic's Disease, Ocular 15 Cicatricial Pemphigoid, Opsoclonus-myoclonus syndrome (OMS), Palindromic Rheumatism, Paraneoplastic Cerebellar Degeneration (PCD), Paraneoplastic Pemphigus, Parry-Romberg Syndrome (PRS)/Hemifacial Atrophy (HFA)/Progressive Facial Hemiatrophy, Paroxysmal Nocturnal Hemoglobinuria (PNH), Peripheral uveitis/pars planitis, PANS/PANDAS, 20 Parsonage-Turner Syndrome (PTS), Pemphigoid Gestationis (PG), Pemphigus Foliaceus, Pemphigus Vulgaris, Pernicious anemia, POEMS Syndrome, Polyarteritis Nodosa (PAN), Polymyalgia Rheumatica, Polymyositis, Postural Orthostatic Tachycardia Syndrome (Pots), Primary Biliary Cirrhosis (PBC), Primary Sclerosing Cholangitis (PSC), Psoriasis, 25 Palmoplantar Pustulosis (PPP), Psoriatic Arthritis, Pulmonary fibrosis, idiopathic (IPF), Pure Red Cell Aplasia (PRCA), Pyoderma gangrenosum, Rasmussen's encephalitis, Raynaud’s Syndrome, Reactive Arthritis, Reflex sympathetic dystrophy syndrome (RSD)/ Complex regional pain syndrome (CRPS), Relapsing Polychondritis (RP), Restless leg syndrome 30 (RLS)/Willis-Ekbom disease, Rheumatic Fever, Rheumatoid Arthritis (RA), Sarcoidosis, Schmidt Syndrome/Autoimmune Polyendocrine Syndrome Type II, Scleritis, Scleroderma, Sclerosing Mesenteritis/Mesenteric Panniculitis, Serpiginous choroidopathy, Sjögren's Syndrome, Stiff person syndrome (SPS), Small Fiber Sensory Neuropathy (SFSN), Small Fiber Sensory Neuropathy (SFSN), Systemic 5 Lupus Erythematosus (SLE), Subacute bacterial endocarditis (SBE), Subacute cutaneous lupus, Susac’s syndrome, Sydenham’s Chorea, Sympathetic ophthalmia, Takayasu’s arteritis (vasculitis), Testicular Autoimmunity, Tolosa-Hunt syndrome, Transverse myelitis (TM), Tubulointerstitial nephritis uveitis syndrome (TINU), Ulcerative Colitis, 10 Undifferentiated Connective Tissue Disease, Uveitis, Vasculitis, VEXAS Syndrome, Vogt-Koyanagi-Harada syndrome (VKH),Osteoarthritis, AVN, vertebral compression factor, urethral stricture, ureteric stricture, eye fibrosis, heart fibrosis, hepatic fibrosis, intestinal fibrosis, lung fibrosis, Pancreas fibrosis, renal fibrosis, and skin fibrosis.

Specification

FORM 2
THE PATENTS ACT, 1970 (39 of 1970) & THE PATENTS RULES, 2003
COMPLETE SPECIFICATION
(See section 10, rule 13)
1. Title of the invention: A FORMULATION COMPRISING A HOMOGENEOUS
POPULATION OF MESENCHYMAL STEM CELLS AND IMPLEMENTATIONS THEREOF
2. Applicant(s)
NATIONALITY
ADDRESS
NAME
Indian
Regrow Biosciences Private Limited Ground Floor, 22, Shah Industrial Estate, Nagargaon, Pune, Maharashtra 410401, India
REGROW BIOSCIENCES
PRIVATE LIMITED

3. Preamble to the description
COMPLETE SPECIFICATION
The following specification particularly describes the invention and the manner in which it
is to be performed.

FIELD OF INVENTION
[001] The present disclosure relates to the field of mesenchymal stem cells (MSCs)
and, particularly to, a formulation comprising MSCs and a carrier. The present
disclosure further relates to a method of treating autoimmune or fibrotic disease
5 using the formulation.
BACKGROUND OF THE INVENTION
[002] Dysfunction of the immune system plays significant role in the clinical manifestation of diseases, such as autoimmune diseases, inflammatory diseases like fibrotic diseases. Immunosuppressants have been widely used in the treatment of
10 fibrotic diseases. Several varieties of drugs are available for treatment of
autoimmune diseases like rheumatoid arthritis (RA), which includes immunosuppressants, steroid hormones, anti-rheumatic drugs, and anti-inflammatory drugs. But reported side effects of immunosuppressants and other drugs include immune deficiency, gastrointestinal tract disorders, hormonal
15 disturbances, and complications in cardiovascular system; and sometimes patients
become resistant to long-term treatments. Thus, the therapeutic approach for autoimmune disease, fibrotic disease and other such diseases demands an effective biological substitute, which is economical, long effective with no side effects. [003] Recently, Mesenchymal Stem Cells (MSCs) have been explored as an
20 effective biological substitute in the treatment of several diseases. MSCs are adult
stem cells that have the ability to self-renew and differentiate into multiple cell types. They are characterized by an extensive capacity for self-renewal, proliferation, potential to differentiate into multiple lineages and their immunomodulatory role on various cells. The majority of MSC products or
25 therapies describe the use of cryopreservation conditions to store and transport the
final product, which is usually thawed within a few hours prior to infusion. There are many challenges regarding the potential functionality of MSC products after preservation and thawing processes, particularly when bioactivity measurements are commonly conducted on MSCs before or without cryopreservation or following
30 culture post-thaw.

[004] The transport/storage conditions including temperature, chemical
composition of the transport media and duration of transfer/storage are among the
most critical factors that vary between cell production facilities and transplantation
centres/laboratories. Transportation is challenging, requiring careful control of cell
5 integrity, viability, and temperature to maintain the efficacy of the cellular product
while conforming to important safety constraints.
[005] Different types of carrier solutions have been tested previously, such as PBS,
M199, culture medium, plasma lysate A, DMEM supplemented with 1% human
serum albumin (HSA), NaCl etc., However, many of such carriers are not suitable
10 for clinical and therapeutic treatment because they are not approved vehicles for
safe infusion into patients.
SUMMARY OF INVENTION
[006] In an aspect of the present disclosure, there is provided a formulation
comprising: a) a population of mesenchymal stem cells (MSCs); and a carrier
15 selected from serelaxin, Ringer’s lactate solution, human serum albumin (HSA),
heparin, dextran, or combinations thereof; wherein said population of MSCs is a homogeneous population having size in the range of 15-30 µm; wherein at least 50% of the MSCs express at least one marker selected from the group consisting of CD 90, CD73, and CD 105.
20 [007] In an aspect of the present disclosure, there is provided a method for preparing
the formulation as disclosed herein, wherein the method comprises: mixing the plurality of MSCs with the carrier to obtain the formulation.
[008] In an aspect of the present disclosure, there is provided a method of inducing tissue regeneration, comprising: administering to a tissue in need thereof the
25 formulation as disclosed herein or obtained by the method as disclosed herein;
wherein the tissue is selected from epithelial tissue; connective tissue like bone tissue, cartilage tissue, and elastic tissue; muscle tissue; or nervous tissue. [009] In an aspect of the present disclosure, there is provided a method of treating autoimmune or fibrotic disease in a subject, comprising: administering the
30 formulation as disclosed herein or obtained by the method as disclosed herein to the
subject.

[0010] These and other features, aspects, and advantages of the present subject
matter will be better understood with reference to the following description and
appended claims. This summary is provided to introduce a selection of concepts in
a simplified form. This summary is not intended to identify key features or essential
5 features of the claimed subject matter, nor is it intended to be used to limit the scope
of the claimed subject matter.
BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
[0011] The following drawings form a part of the present specification and are
included to further illustrate aspects of the present disclosure. The disclosure may
10 be better understood by reference to the drawings in combination with the detailed
description of the specific embodiments presented herein.
[0012] Figure 1 depicts the flow cytometry results for UC-MSC characterization after storage/transport in Ringer lactate + 1% HSA + Dextran 40 (1%),+ Heparin (1000 U/ml) + Serelaxin (1ng/ml) as carrier at A) 0 hrs, B) 6 hrs, C) 12 hrs, D) 24
15 hrs, and E) Annexin V Analysis of UC-MSC in Ringer lactate + 1% HSA + Dextran
40 (1%),+ Heparin (1000 U/ml) + Serelaxin (1ng/ml) as carrier for different time intervals (0h, 6h, 12h and 24h), in accordance with the embodiments herein. [0013] Figure 2 depicts the flow cytometry results for UC-MSC characterization after storage/transport in hyaluronidase as carrier at A) 0 hrs, B) 3 hrs, C) 6 hrs, D)
20 12 hrs, and E) Annexin V Analysis of UC-MSC in hyaluronidase as carrier for
different time intervals (0h, 3h, 6h and 12h), in accordance with the embodiments herein.
DETAILED DESCRIPTION OF THE INVENTION
[0014] Those skilled in the art will be aware that the present disclosure is subject
25 to variations and modifications other than those specifically described. It is to be
understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.
30 Definitions

[0015] For convenience, before further description of the present disclosure, certain
terms employed in the specification, and examples are delineated here. These
definitions should be read in the light of the remainder of the disclosure and
understood as by a person of skill in the art. The terms used herein have the
5 meanings recognized and known to those of skill in the art, however, for
convenience and completeness, particular terms and their meanings are set forth below.
[0016] The articles “a”, “an” and “the” are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
10 [0017] The terms “comprise” and “comprising” are used in the inclusive, open
sense, meaning that additional elements may be included. It is not intended to be construed as “consists of only”.
[0018] Throughout this specification, unless the context requires otherwise the word “comprise”, and variations such as “comprises” and “comprising”, will be
15 understood to imply the inclusion of a stated element or step or group of element or
steps but not the exclusion of any other element or step or group of element or steps. [0019] The term “including” is used to mean “including but not limited to”. “Including” and “including but not limited to” are used interchangeably. [0020] The term “osmolarity” as used herein refers to the number of particles of
20 solute per liter of solution and is expressed as mOsm/L of solution.
[0021] The term “U/ml (units/ml)” as used herein refers to a unit of measurement that indicates the biological activity of substances like enzymes or hormones. The term “U/ml” may be used interchangeably with the term “IU/ml” (International units/ml) throughout the present disclosure.
25 [0022] Embodiments herein include a formulation comprising a population of
MSCs and a carrier. MSCs are increasingly being used as off the shelf products for treating various diseases. The population of MSCs included in the present disclosure is a homogeneous population having size in the range of 15-30 µm and are therapeutically potent. Further, the MSCs secrete biologically active substances
30 that have the paracrine ability called secretome, which is composed of cytokines,
chemokines, growth factors, proteins, and extracellular vesicles. Specifically, the

secretome of the MSCs population comprises VEGF and IL-10 that produce different effects leading to the process of therapeutic action of MSCs-derived secretome when transplanted to a patient.
[0023] Despite the increased demand for therapeutic MSCs, there is also a
5 continued challenge of formulating the MSCs in appropriate carrier solutions for
clinical and therapeutic treatment, ensuring safe infusion into patients. Also, choosing appropriate carriers is essential for the control of cell integrity, viability, and temperature to maintain the efficacy of the cellular product while conforming to important safety constraints. Based on the theory of cell ions and osmotic
10 homeostasis, cell viability is strongly regulated by the osmolality and electrolyte
concentration of the extracellular environment. Accordingly, embodiments herein provide a formulation comprising a population of MSCs and a carrier selected from serelaxin, Ringer’s lactate solution, human serum albumin (HSA), heparin, dextran, hyaluronidase, or combinations thereof for therapeutic applications.
15 [0024] The Ringer’s lactate solution is a mixture of not only sodium and chloride
ions but also potassium ions and calcium ions, mimicking the extracellular fluid in the human body. The Ringer’s lactate solution maintains high cell viability, cell attachment and recovery after 24 h of storage. Heparin aids in decreasing the formation of blood clots, while delivering the MSCs and thereby improves the
20 effectiveness of cell therapy. Dextran 40 ensures slow release of the MSCs, thereby
enabling a more gradual delivery of the MSCs at the target site and potentially improving the intended therapeutic effect. Hyaluronidase helps in the dispersion of the therapeutic agent, along with ensuring patient safety and comfort. Thus, the specific combination of serelaxin, Ringer’s lactate solution, human serum albumin
25 (HSA), heparin, and dextran ensures improved cell viability and recovery even after
storage and thaw cycle. Embodiments herein also provide a method of preparing the formulation. Further, embodiments herein also include a method of inducing tissue degeneration and a method of treating autoimmune or fibrotic disease in a subject using the formulation.
30 [0025] Embodiments herein provide a formulation comprising a population of
MSCs and a carrier. The term “mesenchymal stem cell” or “MSCs”, as used herein,

refers to cell population of multipotent cells. According to the International Society
for Cellular Therapy (ISCT), the criteria to define MSCs are their plastic-adherent
ability; the high expression of positive markers, such as CD105, CD73 and CD90,
as well as the lack of expression of negative markers, such as CD45, CD34,
5 CD14/CD11b, CD79a/CD19 and HLA class II. The MSCs, according to
embodiments herein, are characterized by the expression of one or more cell surface markers selected from CD73, CD90, or CD105. In further embodiments herein, the MSCs may be characterized by lack of expression of one or more of the markers selected from HLADR, CD34, or CD45.
10 [0026] In an embodiment, at least 50% of the MSCs express at least one marker
selected from the group consisting of CD 90, CD73, and CD 105. In another embodiment, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% of the MSCs express at least one marker selected from the group consisting of CD 90, CD73, and
15 CD 105.
[0027] In an embodiment, less than 1% of the the MSCs may be characterized by lack of expression of one or more of the markers selected from HLADR, CD34, or CD45. In another embodiment, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than
20 0.2%, or less than 0.1%, of the MSCs may be characterized by lack of expression
of one or more of the markers selected from HLADR, CD34, or CD45. [0028] The MSCs may be obtained from commercial sources or, alternatively, derived from tissues of mammals. [0029] In an embodiment, the MSCs are derived from umbilical cord tissue, cord
25 blood, adipose tissue, bone marrow, or dental pulp, preferably derived from
Umbilical Cord Tissue (UCT) of mammals, in particular humans. HUC-MSCs are one of the most widely used MSC populations due to their therapeutic/regenerative properties and have advantages compared with MSCs from other sources. [0030] The MSCs isolated from UCT may be a heterogeneous population of MSCs.
30 The term “heterogeneous population”, as used herein, refers to a mixed population
of small, medium, or large sized MSCs. According to embodiments herein, the

MSCs having medium size may be expanded and produced using the methods generally known in the art.
[0031] In an embodiment, the homogeneous population of MSCs is obtained by
artificial intelligence driven microfluidic sorting of culture expanded MSCs. In
5 another embodiment, the homogeneous population of MSCs is obtained by
automated size-based microfluidic sorting driven by artificial intelligence of culture expanded MSCs.
[0032] In an exemplary embodiment, the homogeneous population of MSCs is obtained by a process comprising the steps of:
10 a) culturing a heterogeneous population of MSCs in a culture medium for a period
in a range of 20 to 35 days; b) staining the MSCs to obtain a heterogeneous population of stained MSCs; c) adding droplet encapsulation media, comprising a density gradient solution to the heterogenous population of stained MSCs, to obtain a population of microfluidic droplets, wherein each droplet preferably comprises a
15 single MSC; d) providing the population of microfluidic droplets obtained from
step (c) to a microfluidics device; and e) identifying and selecting a homogeneous population of MSCs of medium size in the range of 15 to 30 µm; wherein the step (e) further comprises: imaging the MSCs in the population of microfluidic droplets to record the size of the MSCs; and subjecting the population of microfluidic
20 droplets to automated size-based sorting to obtain a population of homogeneous
MSCs having medium size; and wherein the step (a) further comprises: reseeding the heterogeneous population of MSCs at a cell density in the range of 5000 to 11,000/cm2 and expanding the heterogeneous population of MSCs up to passage 3, wherein the population of MSCs obtained from step (e) are viable MSCs,
25 expressing MSC specific markers selected from CD 73, CD 90, and combinations
thereof; and having increased expression of genes selected from the group consisting of COL12 A1 gene, IGFBP5 gene, THBS2 gene, GREM1 gene, CDH2 gene, and combinations thereof. [0033] The term “medium-sized MSCs” as used herein refers to a homogeneous
30 population of MSCs having a size in the range of 15 to 30 µm.

[0034] In an embodiment, the population of MSCs is of medium size in the range of 15 to 30 µm. In another embodiment, the population of MSCs is of medium size in the range of 17 to 22 µm.
[0035] In further embodiments, the medium-sized MSCs are characterized by the
5 expression of certain genes that aid in their therapeutic potential. In an embodiment,
medium-sized MSCs are characterized by the increased expression of genes selected from a group consisting of COL12A gene, IGFBP5 gene , THBS2 gene, GREM1 gene and combinations thereof. [0036] In an embodiment, the MSCs exhibit increased expression of COL12A1
10 gene, IGFBP5 gene, THBS2 gene and GREM1 gene, as compared to the expression
of GAPDH gene, wherein the increased expression of COL12A1 is in the range of 14 to 19 folds as compared to the expression of GAPDH gene; wherein the increased expression of IGFBP5 gene is in the range of 14 to 18 folds as compared to the expression of GAPDH gene; wherein the increased expression of THBS2
15 gene is in the range of 15 to 17 folds as compared to the expression of GAPDH
gene; wherein the increased expression of GREM 1 gene is in the range of 18 to 21 folds as compared to the expression of GAPDH gene.
[0037] In an embodiment, the formulation comprises secretome of said MSCs. [0038] The term “secretome” as used herein refers to the biologically active
20 substances that are secreted by the MSCs and have the paracrine ability. The
secretome is composed of cytokines, chemokines, growth factors, proteins, and extracellular vesicles. In an embodiment, the formulation comprises secretome of said MSCs comprising VEGF and IL-10. [0039] The term “Vascular endothelial growth factor (VEGF)” as used herein refers
25 to a family of polypeptides that includes VEGF-A, VEGF-B, VEGF-C, VEGF-D
and placental growth factor (PlGF). VEGF shows paracrine and autocrine properties and can act intracellularly, secreting to the extracellular space, participating in the regulation of the cell-cycle and metabolism of cells. VEGF, an important angiogenic factor secreted by MSCs, promotes cell survival by inducing
30 the expression of anti-apoptotic molecules such as Bcl-2.

[0040] The term “Interleukin-10 (IL-10)” as used herein refers to a type of cytokine
that is found in the secretome of MSCs. IL-10 is characterized by its anti¬
inflammatory effect related to the induction of immune tolerance. It is an anti¬
inflammatory cytokine that inhibits the IL-2 and Interferon (IFN)-G. The IL-10 act
5 as an inducer for immune tolerance on the dendritic cells. It has been established
that IL-10 suppresses the functions of macrophages and neutrophils, inhibits the Th1 immune response, influences NF-κB synthesis and causes expression of anti-inflammatory molecules, such as protease inhibitors and IL-1 and TNFα antagonists.
10 [0041] The major function of IL-10 in induction of immune tolerance is its effect
on the antigen presenting cells and particularly on the dendritic cells (DCs). IL-10 suppresses the secretion of pro-inflammatory cytokines (TNFα, IL-1, IL-6, IL-8, IL-12) by DCs and the expression of MHC Ⅱ molecules, as well as co-stimulatory complex B7 on their surface. In parallel to that, IL-10 is capable of inducing anergy
15 of T lymphocytes by directly inhibiting the phosphorylation of CD28. In that way,
one of the basic immunosuppressive mechanisms is executed by IL-10 by inducing a tolerogenic type of dendritic cells with reduced HLA-Ⅱ and B7 expression and by suppression of CD28 (the partner of B7) expression on the surface of the T lymphocytes. This “two sided” suppression of the second signal which is
20 unconditionally needed for activation of the T lymphocytes induces a deep anergy
in this cell population. Overall, IL-10 acts as a key immunoregulatory molecule, playing a crucial role in this "two-sided" suppression, leading to T cell anergy and preventing excessive immune responses that could damage healthy tissues. [0042] In an embodiment, the formulation comprises secretome of said MSCs
25 comprising VEGF in an amount in the range of 2050 to 2390 pg/ml, and IL-10 in
an amount in the range of 1430 to 1690 ng/ml.
[0043] In an embodiment, the population of MSCs comprises less than 6% of early apoptotic cells; and less than 3% of late apoptotic cells. [0044] In an embodiment, the MSCs are present in the range of 0.5 x 106 cells/ ml
30 to 2 x 106 cells/ml of the formulation, preferably 1.8 x 106 cells/ml of the
formulation.

[0045] In an embodiment, the homogeneous population of MSCs are present in a
suspension comprising an excipient selected from DMEM, human serum albumin
(HSA) or combinations thereof; preferably the excipient is DMEM and 20% HSA
solution in a weight ratio in a range of 1:2 to 2:1, more preferably the excipient is
5 DMEM and 20% HSA solution in a weight ratio of 1:1.
[0046] The term “carrier” as used herein refers to any known carrier, or adjuvants known to a person skilled in the art, and which can be used for preparing the formulation comprising the population of MSCs for therapeutic applications and is pharmaceutically acceptable.
10 [0047] In an embodiment, the carrier is in a weight percentage range of 0.5 to 2.5%
of the formulation.
[0048] In an embodiment, the carrier is selected from serelaxin, Ringer’s lactate solution, human serum albumin (HSA), heparin, dextran, hyaluronidase, or combinations thereof.
15 [0049] The term “serelaxin” as used herein refers to a recombinant form of human
relaxin 2, a naturally occurring peptide. It exerts its effects by binding to one of two receptors, LGR7 and LGR8, to activate a G protein coupled receptor pathway and upregulates the vascular endothelin B receptor, vascular endothelin growth factor (VEGF). Serelaxin with an acceptable hemodynamic profile and no known
20 infusion-related significant adverse drug events is used as one of the components
of carrier solution of the present disclosure.
[0050] In an embodiment, the serelaxin is a 0.5 to 5 ng/ml concentration solution. In another embodiment, the serelaxin is a 0.75 to 3 ng/ml concentration solution. In yet another embodiment, the serelaxin is a 0.9 to 1.5 ng/ml concentration solution.
25 [0051] The term “Ringer’s lactate (RL)” as used herein refers to a mixture of
sodium ions (Na+), chloride ions (Cl-), potassium ions (K+), calcium ions (Ca2+), and lactate ions mimicking the extracellular fluid in the human body. Several mechanisms are found to support the protective functions of RL on cell viability, which are linked to the extracellular concentrations of Na+, K+, and Ca2+ ions.
30 [0052] In an embodiment, Ringer’s lactate solution comprises salts of sodium
lactate, sodium chloride, potassium chloride, and calcium chloride in water.

[0053] In an embodiment, Ringer’s lactate solution comprises 25 to 30 mM of
sodium lactate, 100 to 105 mM of sodium chloride, and 3.5 to 4.5 mM of potassium
chloride and 1.5 to 2 mM of calcium chloride. In another embodiment, Ringer’s
lactate solution comprises 26 to 29 mM of sodium lactate, 101 to 103 mM of sodium
5 chloride, and 3.8 to 4.1 mM of potassium chloride and 1.5 to 2 mM of calcium
chloride.
[0054] The Ringer’s lactate solution may be prepared by methods generally known in the art. In an exemplary embodiment, the Ringer’s lactate solution is prepared by mixing predetermined amounts of sodium lactate, sodium chloride, potassium
10 chloride, and calcium chloride in water.
[0055] In an embodiment, the Ringer’s lactate solution has an osmolarity in the range of 270 mOsm/L to 275 mOsm/L.
[0056] The term “Human Serum Albumin (HSA)” as used herein refers to a lipid peroxidation inhibitor or an emulsifying substance to protect lipids against
15 oxidation. Further, HSA plays a significant role in the membrane structure
stabilization and reduces cell damage caused by osmotic stress and has anti-oxidative activity, so it helps to maintain osmolarity of the formulation. [0057] In an embodiment, the HSA is a 1 to 20% solution of HSA. In another embodiment, the HSA is a 10 to 20% solution of HSA.
20 [0058] The term “heparin” as used herein refers to an anticoagulant that prevents
the formation of blood clots. Heparin prevents the blood clot formation while delivering the MSCs and also improves the effectiveness of cell therapy. [0059] In an embodiment, heparin is in a concentration range of 500 to 2000 U/ml. In another embodiment, heparin is in a concentration range of 750 to 1500 U/ml.
25 [0060] The term “dextran” as used herein refers to a polysaccharide composed of
glucose. It is made from natural sources of glucose, and this makes it generally well-tolerated by the body and reduces the risk of immune reactions compared to synthetic materials when used in a therapeutic formulations. Dextran occurs in various molecular weights, such as dextran 40 (40 kDa) and dextran 70 (70 kDa),
30 which are both commonly used as carriers. Dextran 40, when used along with cells
can be designed for slow release. This allows for a more gradual delivery of the

cells to the target site, potentially improving their survival and therapeutic effect.
Also, dextran can be chemically modified to target specific tissues. This could be
useful for directing the delivered cells to a particular area of the body for treatment.
[0061] In an embodiment, dextran is a 0.5% to 19% concentration solution. In
5 another embodiment, dextran is a 1% to 5% concentration solution.
[0062] In an embodiment, the formulation further comprises hyaluronidase. [0063] The term “hyaluronidase” as used herein refers an enzyme that breaks down hyaluronic acid (HA). HA is a major component of the extracellular matrix of subcutaneous tissue. Hyaluronidase specifically cleaves the glycosidic bonds
10 within the hyaluronic acid molecule, essentially breaking it down. This breakdown
creates temporary channels within the ECM, allowing other injected fluids and medications to diffuse more readily throughout the tissue. Thus, hyaluronidase increases tissue permeability when used in a medication, allowing the injected medication to spread more easily, and be absorbed faster into the bloodstream. With
15 quicker absorption, the medication reaches its target site and starts working sooner.
This can be particularly beneficial for drugs where a rapid response is critical. Hyaluronidase can facilitate the administration of larger volumes of medication subcutaneously. Normally, injecting a large volume into a localized area can be uncomfortable or cause pooling of the medication. Hyaluronidase helps the
20 medication disperse more readily, reducing discomfort and improving delivery.
Also, certain medications can irritate or damage tissues if they pool at the injection site. By promoting faster absorption, hyaluronidase can minimize this risk and improve patient comfort. [0064] In an embodiment, hyaluronidase is in a concentration range of 500 to 5000
25 IU/ml of the carrier. In an embodiment, hyaluronidase is in a concentration of 1500
units to 3000 units per ml of the carrier.
[0065] In an embodiment, the serelaxin is a 0.5 to 5 ng/ml concentration solution; the Ringer’s lactate solution comprises 25 to 30 mM of sodium lactate, 100 to 105 mM of sodium chloride, and 3.5 to 4.5 mM of potassium chloride and 1.5 to 2 mM
30 of calcium chloride; and HSA is a 1 to 20% concentration solution; dextran is a

0.5% to 19% concentration solution; heparin is in a concentration range of 500 to
2000 U/ml; and hyaluronidase is in a concentration range of 500 to 5000 U/ml.
[0066] In an embodiment, the formulation comprises additives. The term “additive”
as used herein refers to substances that are optionally provided in the formulation
5 to improve its stability.
[0067] In an embodiment, the formulation comprises additives selected from
DMEM medium, saline solution, phosphate buffered saine (PBS) buffer, Hank’s
balanced salt solution (HBSS), human plasma, plasma lysate, or mixtures thereof.
[0068] In an embodiment, the formulation has a pH in the range of 6.4 to 6.6.
10 [0069] In an embodiment, the formulation has an osmolarity in the range of 275 to
310 mOsm/L.
[0070] In an embodiment, the percentage cell recovery of said MSCs in the
formulation estimated after 0 to 24 hours is in the range of 99 to 80% and a
percentage cell viability of said MSCs in the formulation estimated after 0 to 24
15 hours is in the range of 99.8% to 80%.
[0071] Embodiments herein include a method of preparing the formulation.
[0072] In an embodiment, the method for preparing the formulation comprises:
mixing the plurality of MSCs with the carrier to obtain the formulation.
[0073] In an embodiment, the method further comprises the addition of one or more
20 additives.
[0074] Embodiments herein further include a method of inducing tissue
regeneration.
[0075] In an embodiment, there is provided a method of inducing tissue
regeneration comprising: administering to a tissue in need thereof the formulation
25 as disclosed herein or obtained by the method as disclosed herein; wherein the tissue
is selected from epithelial tissue; connective tissue like bone tissue, cartilage tissue,
or elastic tissue; muscle tissue, or nervous tissue.
[0076] Embodiments herein further include a method of treating autoimmune or
fibrotic disease in a subject.
30 [0077] The term “subject”, as used herein, refers to mammals, e.g., human, and
non-human mammals. Examples of non-human animals include non-human

primates, dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, mice, rats, hamsters, guinea pigs and etc. Unless otherwise noted, the terms “patient” or “subject” are used herein interchangeably. Preferably, the subject is human.
[0078] In an embodiment, there is provided a method of treating a disease in a
5 subject, comprising administering the formulation as disclosed herein or obtained
by the method as disclosed herein to the subject.
[0079] In an embodiment, the formulation is administered via the intravenous, intramuscular, intraosseous, subcutaneous, intraplantar, or intraarticular route. [0080] In an embodiment, there is provided a use of the formulation as disclosed
10 herein in the manufacture of a medicament for treating autoimmune or fibrotic
disease in a subject.
[0081] In an embodiment, the auto immune disease or fibrotic disease is selected from the group of consisting of Acromegaly, Acquired Aplastic Anemia, Acquired Hemophilia, Agammaglobulinemia, Alopecia Areata, Ankylosing Spondylitis
15 (AS), Anti-NMDA Receptor Encephalitis, Antiphospholipid Syndrome (APS),
Arteriosclerosis, Autoimmune Addison’s Disease (AAD), Autoimmune Autonomic Ganglionopathy (AAG), Autoimmune Encephalitis (AE)/Acute Disseminated Encephalomyelitis (ADEM), Autoimmune Gastritis, Autoimmune Hemolytic Anemia (AIHA), Autoimmune Hepatitis, Autoimmune Hyperlipidemia,
20 Autoimmune Hypophysitis/Lymphocytic Hypophysitis, Autoimmune Inner Ear
Disease (AIED), Autoimmune Lymphoproliferative Syndrome (ALPS), Autoimmune Myelofibrosis (AIMF), Autoimmune Myocarditis, Autoimmune Oophoritis, Autoimmune Pancreatitis (AIP), Autoimmune Polyglandular Syndromes (APS), Autoimmune Progesterone Dermatitis (APD), Autoimmune
25 Retinopathy (AIR), Autoimmune Sudden Sensorineural Hearing Loss, Balo
Disease/Concentric Sclerosis, Behçet’s Disease, Birdshot
Chorioretinopathy/Birdshot Uveitis, Bullous Pemphigoid, Castleman Disease, Celiac Disease, Chagas Disease, Chronic Inflammatory Demyelinating Polyneuropathy (CIDP), Chronic Autoimmune Urticaria, Churg-Strauss
30 Syndrome/Eosinophilic Granulomatosis with Polyangiitis (EGPA), Cogan's
Syndrome (CS), Cold Agglutinin Disease (CAD), Crest Syndrome, Crohn's

Disease, Stricturing Crohn's Disease, Cronkhite-Canada Syndrome (CCS),
Cryptogenic Organizing Pneumonia (COP), Dermatitis Herpetiformis (DH),
Dermatomyositis, Diabetes, Type 1 (T1D), Discoid Lupus Erythematosus (DLE),
Dressler’s Syndrome/ Post myocardial Infarction/Post pericardiotomy Syndrome,
5 Eczema/Atopic Dermatitis, Eosinophilic Fasciitis, Erythema Nodosum, Essential
Mixed Cryoglobulinemia, Evans Syndrome, Fibrosing Alveolitis/Idiopathic Pulmonary Fibrosis (IPF), Giant Cell Arteritis/Temporal Arteritis/Horton's Disease, Giant Cell Myocarditis, Glomerulonephritis (GN), Goodpasture’s Syndrome/Anti-Gbm/Anti-Tbm Disease, Granulomatosis With Polyangiitis (GPA)/Wegener's
10 Granulomatosis, Graves’ Disease (GD), Guillain-Barrè Syndrome (GBS),
Hashimoto’s Thyroiditis/Autoimmune Thyroiditis, Henoch-Schölein Purpura (HSP)/Iga Vasculitis, Hidradenitis Suppurativa, Hurst’s Disease/Acute Hemorrhagic Leukoencephalitis (AHLE), Hypogammaglobulinemia, Iga Nephropathy/Berger’s Disease, Immune-Mediated Necrotizing Myopathy
15 (IMNM), Immune Thrombocytopenia (Itp)/Autoimmune Thrombocytopenia
Purpura, Inclusion Body Myositis (IBM), Igg4-Related Sclerosing Disease (ISD), Interstitial Cystitis, Juvenile Idiopathic Arthritis (Jia)/Adult-Onset Still's Disease, *Juvenile polymyositis/Juvenile dermatomyositis/ juvenile myositis, Kawasaki disease, Lambert-Eaton Myasthenic Syndrome (LEMS), Leukocytoclastic
20 vasculitis, Lichen Planus, Lichen Sclerosus, Ligneous conjunctivitis, Linear Iga
Disease (LAD), Lupus Nephritis (LN), Lyme Disease/Chronic Lyme Disease/Post-Treatment Lyme Disease Syndrome (PTLDS), Lymphocytic colitis/microscopic colitis, Lymphocytic hypophystitis/autoimmune hypophystitis, Ménière’s Disease, Microscopic Polyangiitis (MPA)/ANCA-Associated Vasculitis, Mixed Connective
25 Tissue Disease (MCTD), Mooren’s ulcer, Mucha-Habermann disease, Multifocal
motor neuropathy, Multiple Sclerosis (MS), Myalgic Encephalomyelitis/Chronic
Fatigue Syndrome (ME/CFS), Myasthenia Gravis (MG), Narcolepsy,
Neuromyelitis Optica/Devic's Disease, Ocular Cicatricial Pemphigoid,
Opsoclonus-myoclonus syndrome (OMS), Palindromic Rheumatism,
30 Paraneoplastic Cerebellar Degeneration (PCD), Paraneoplastic Pemphigus, Parry-
Romberg Syndrome (PRS)/Hemifacial Atrophy (HFA)/Progressive Facial

Hemiatrophy, Paroxysmal Nocturnal Hemoglobinuria (PNH), Peripheral
uveitis/pars planitis, PANS/PANDAS, Parsonage-Turner Syndrome (PTS),
Pemphigoid Gestationis (PG), Pemphigus Foliaceus, Pemphigus Vulgaris,
Pernicious anemia, POEMS Syndrome, Polyarteritis Nodosa (PAN), Polymyalgia
5 Rheumatica, Polymyositis, Postural Orthostatic Tachycardia Syndrome (Pots),
Primary Biliary Cirrhosis (PBC), Primary Sclerosing Cholangitis (PSC), Psoriasis, Palmoplantar Pustulosis (PPP), Psoriatic Arthritis, Pulmonary fibrosis, idiopathic (IPF), Pure Red Cell Aplasia (PRCA), Pyoderma gangrenosum, Rasmussen's encephalitis, Raynaud’s Syndrome, Reactive Arthritis, Reflex sympathetic
10 dystrophy syndrome (RSD)/Complex regional pain syndrome (CRPS), Relapsing
Polychondritis (RP), Restless leg syndrome (RLS)/Willis-Ekbom disease, Rheumatic Fever, Rheumatoid Arthritis (RA), Sarcoidosis, Schmidt Syndrome/Autoimmune Polyendocrine Syndrome Type II, Scleritis, Scleroderma, Sclerosing Mesenteritis/Mesenteric Panniculitis, Serpiginous choroidopathy,
15 Sjögren's Syndrome, Stiff person syndrome (SPS), Small Fiber Sensory
Neuropathy (SFSN), Small Fiber Sensory Neuropathy (SFSN), Systemic Lupus Erythematosus (SLE), Subacute bacterial endocarditis (SBE), Subacute cutaneous lupus, Susac’s syndrome, Sydenham’s Chorea, Sympathetic ophthalmia, Takayasu’s arteritis (vasculitis), Testicular Autoimmunity, Tolosa-Hunt syndrome,
20 Transverse myelitis (TM), Tubulointerstitial nephritis uveitis syndrome (TINU),
Ulcerative Colitis, Undifferentiated Connective Tissue Disease, Uveitis, Vasculitis, VEXAS Syndrome, Vogt-Koyanagi-Harada syndrome (VKH), Osteoarthritis, AVN, vertebral compression factor, urethral stricture, ureteric stricture, eye fibrosis, heart fibrosis, hepatic fibrosis, intestinal fibrosis, lung fibrosis, Pancreas
25 fibrosis, renal fibrosis, and skin fibrosis .
[0082] Although the subject matter has been described with reference to specific embodiments, this description is not meant to be construed in a limiting sense. Various modifications of the disclosed embodiments, as well as alternate embodiments of the subject matter, will become apparent to persons skilled in the
30 art upon reference to the description of the subject matter. It is therefore

contemplated that such modifications can be made without departing from the spirit or scope of the present subject matter as defined.
EXAMPLES
[0083] The disclosure will now be illustrated with working examples, which is
5 intended to illustrate the working of disclosure and not intended to take restrictively
to imply any limitations on the scope of the present disclosure. Unless defined
otherwise, all technical and scientific terms used herein have the same meaning as
commonly understood to one of ordinary skill in the art to which this disclosure
belongs. Although methods and materials similar or equivalent to those described
10 herein can be used in the practice of the disclosed methods and compositions, the
exemplary methods, devices, and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary.
Materials
15 [0084] Components of ringer lactate (274mOsm/L) procured commercially is as
follows:
1.Sodium Lactate(C3H5NaO3)-1.55g/500mL
2.Sodium Chloride (NaCl)-3.0g/500mL
3.Potassium Chloride (KCL)-1.15g/500mL
20 4.Calcium Chloride (CaCl2.2H2O)-0.1g/500mL
5.Water for injection-500mL
6. Na+ 130.3mEq/L
7. K+ 4mEq/L
8. Lactate (HCO3-) -27.7mEq/L 25 9. Cl- 109.4mEq/L
10. Ca++ 2.7mEq/L
Example 1: Preparation of Formulation
[0085] Mesenchymal stem cells from umbilical cord tissues (UCT) from single or
multiple donors were isolated and expanded in vitro up to passage 3 (P3) by using
30 2D and 3D culture system. In 2D culture system culture flasks were used, while in
3D culture system such as in a continuous feedback system, a microcarrier which

has a porous membrane, hollow fibre bioreactor of pore size of 80µm, and enables
scalable cell culture was used. Microfluidic system sorting of these expanded cells
at P3 stage was performed to obtained medium sized MSCs of 15 to 30 µm, and
cell banking of these medium size sorted cells was carried out. Freshly sorted
5 UCMSCs as well as some cryopreserved UCMSC (using 20% Human serum
albumin (HSA) with 10% DMSO below -150 ℃ till thawing) were used for analysis of delivery system by using different carrier solution. In cryopreservation, after thawing, the mesenchymal stem cells were suspended in DMEM+ 20% HSA (1:1) as excipient. The excipient remains same for fresh or cryopreserved product. This
10 final product was resuspended into five types of carrier in different formulations of
isotonic electrolyte solutions, namely 0.9% Sodium chloride (NaCl) and HSA (0.4%) (F1); Ringer Lactate and HSA (0.4%) (F2); Ringer lactate and 0.4% HSA and Dextran 40 (1%)(F3); Ringer lactate, 1% HSA and Dextran 40 (1%)+ Heparin (1000 U/ml) (F4); Ringer lactate, 1% HSA, Dextran 40 (1%), Heparin (1000 U/ml),
15 and Serelaxin (F5); and hyaluronidase (F6) by maintaining temperature at 15-28
℃.
[0086] The dose designed and established for humans was 1 to 5 million cells/kg, preferably 5 million cells/kg body weight of human. Considering this value, the final concentration of MSCs in each carrier solution was 0.7 × 106 MSCs/ml in a
20 final volume of 500 ml to obtain the formulation. The cell count was taken as soon
as the final product are suspended in carrier solution for 0h readings. The formulation (~100 ml) was collected from collection port using syringe and needle under aseptic conditions in 50 ml centrifuge tubes (2-3 tubes) at a speed of 5 ml/minute. Before collection the formulation was mixed well. The collected
25 formulation was then centrifuged at 1300 rpm for 5-10 minutes at room temperature
to obtain a cell suspension (cell pellet suspended in DMEM+20% HSA (1:1)) and a cell supernatant. Similarly, cell suspension and supernatants were obtained, and analysis performed after storing the formulation for 6h,12h and 24h; or 3h, 6h and 12h.

[0087] Cell recoveries were calculated from the cell suspension at same time points,
such as 0h, 6h,12h and 24h or 0h, 3h, 6h and 12h using an automated counter. The
cell recovery percentage was calculated using the below formulae:
[0088] Cell recovery%= (Initial cell count/Final cell count) x 100
5 [0089] Cell Viability of the cells were determined by staining 100 µl cells with 10
µl of 7AAD stain in a tube. 100 µl of unstained cells were taken in another tube as control.
[0090] Both the tubes were incubated for 10 min. After incubation 400 µl of PBS buffer was added and the tubes were vortexed gently before loading. The samples
10 were acquired on flow cytometry and analysed to determine the percentage of viable
and non-viable cells.
[0091] Cell surface positive markers and negative markers were estimated at different time points such as 0h, 6h, 12h, and 24h from cell suspension using AAD-flow cytometer. Briefly, cells were stained with 5 µl cell surface marker specific
15 (Positive and Negative) antibody conjugated with respective fluorochromes
(PE/FITC/PerCP/APC) in a tube. The tube was vortexed gently to mix and incubated for 30 minutes in the dark at 2-80 ℃. Simultaneously a tube of unstained cells was used as control. 500µl of PBS was added to both stained and unstained tube of cells. The suspension was centrifuged at 1500 rpm for 5mins, then the
20 supernatant was discarded, and the pellet was resuspended in 500 µl of PBS. The
tubes were gently vortexed before loading. The samples were acquired on the flow cytometer within 1 hour or until then the tubes on were placed on wet ice in the dark. After the acquisition, the graphs were analysed to determine the positive and negative markers expression on the MSCs.
25 [0092] Annexin V Analysis was performed to determine the apoptotic status of
cells. Briefly, 100 µl of cells were stained with 5 µl of Annexin V in a tube. 100 µl of unstained cells were taken in another tube as a control. The tubes were incubated for 10min at room temperature. After incubation, 195 µl 1X Buffer was added to the tubes, then centrifuged at 1000 rpm for 2-3 min. The supernatant was discarded,
30 and 10 µl of PI was added to the cell pellet and mixed well. Further, 190 µl of 1X

buffer was added, and vortexed gently to mix. The samples were acquired on flow cytometry.
[0093] After acquisition, analysis was performed to determine healthy cells, early
apoptotic cells, late apoptotic cells, and dead cells population in the sample.
5 [0094] Secretome analysis (IL-10 and VEGF analysis): Standard dilutions of the
were prepared. Microwell strips were washed twice with wash buffer, before adding 100 µl of these standard dilutions in the microwell strips. 100 µl of sample diluent, in duplicate, was added to the blank wells. 50 µL of sample diluent was added to sample wells. Then 50 µl sample in duplicate was added to designated sample wells.
10 50 µl of Biotin-Conjugate was added to all wells. The microwell strips were covered
and incubated for 2 hours at room temperature (18°C to 25°C). The microwell strips were emptied and washed 3 times with Wash Buffer. 100 µL of diluted Streptavidin-HRP was added to all wells. The microwell strips were covered and incubated for 1h at room temperature (18°C to 25°C). The microwell strips were
15 emptied and washed 3 times with Wash Buffer. 100 µL of TMB Substrate Solution
was added to all wells. The microwell strips were incubated for about 10 minutes at room temperature (18°C to 25°C). Then 100 µl of Stop Solution was added to all wells. Blank microwell reader and colour intensity was measured at 450 nm. [0095] pH, and osmolarity were analysed using the cell supernatant with a pH
20 meter, and osmometer, respectively.
[0096] Gene expression studies was carried out using the formulation at 0 h- and 24 h- time point only by RT-PCR. Briefly, RNA was isolated from target MSCs cells. mRNA was reverse transcribed to cDNA. The modified gene-specific PCR primers for the required genes (COL12 A1; IGFBP5; THBS2; GREM1) were used
25 to amplify a segment of the cDNA of interest, following the reaction in real time;
and the initial concentration of the selected transcript in the MSCs was calculated from the exponential phase of the reaction. The primers used are listed below: [0097] COL12 A1 Forward: CAGTGCCTGTAGTCAGCCTGAA [0098] COL12 A1 Reverse: GGTCTTGTTGGCTCTGTGTCCT
30 [0099] IGFBP5 Forward: CGTGCTGTGTACCTGCCCAATT
[00100] IGFBP5 Reverse: ACTTGTCCACGCACCAGCAGAT

[00101] THSB2 Forward: CAGTCTGAGCAAGTGTGACACC
[00102] THSB2 Reverse: TTGCAGAGACGGATGCGTGTGA
[00103] GREM1 Forward: TCATCAACCGCTTCTGTTACGGC
[00104] GREM1 Reverse: CAGAAGGAGCAGGACTGAAAGG
5 Table 1: Analysis of homogeneous medium size 1x106 UC-MSCs

Parameters Result
Cell Viability (%) 98.90
Annexin V
Early Apoptotic cells (%) 0.18
Late Apoptotic cells (%) 0.00
CELL SURFACE MARKERS (%)
Positive Markers
CD90+ 99.20
CD73+ 97.85
CD105+ 98.60
Negative marker
CD34- 0.22
CD45- 0.07
HLADR- 0.011
Potency (Secretomes estimation)
IL10 ng/ml 1430-1690
VEGF pg/ml 2050-2390
Gene expression (Fold expression) *
COL12 A1 19.5
IGFBP5 18.22
THBS2 17.80
GREM1 21.25
Table Descriptions
[00105] *Data represented as fold expression when compared with GAPDH gene. [00106] One million cells comprising of 9.92 x 105 CD90+ cells, 9.78 x 105 CD73+ cells and 9.86 x 105 CD105+ cells.

[00107] One million cells comprising of 9.89 x 105 viable cells with only 1800 early
apoptotic cells and without any late apoptotic cells. One million homogeneous
medium size MSCs population comprising of 1430-1690 µg of IL10 Secretomes.
[00108] One million homogeneous medium size MSCs population comprising of
5 2050-2390 µg of VEGF Secretomes.
[00109] One million homogeneous medium size MSCs showing gene expression of 19.5-fold COL12 A1, 18.22-fold of IGFBP5, 17.80-fold of THBS2 and 21.25-fold of GREM1.
Example 2: F1-Formulation comprising NaCl (0.9%) and HSA (0.4%) as
10 carrier
[00110] Result suggested that HUC-MSCs could be ideally stored in 0.9% NaCl and 0.4% HSA at 15-28°C for up to 6h with a maximum viability of 82%. NaCl-based media did not support the viability of UC-MSC at room temperature. A significant decrease in cell viability in NaCl and HSA solution was observed. It was
15 also noted that other biological characteristics, such as immunophenotype, and
immunosuppressive were affected (Table 2).
Table 2: Evaluation of the effects of carrier comprising NaCl (0.9%) and HSA (0.4%) on UC-MSC
UC-MSC quality check parameters Time interval (In Hours)

0h 6h 12h 24h
Cell recovery (%) 99 83 71 65
Cell Viability (%) 99.69 82.22 69.34 54.51
Annexin V
Early Apoptotic cells (%) 2.87 9.62 18.87 27.00
Late Apoptotic cells (%) 0.00 1.030 2.006 3.450
pH 6.5 6.4 6.1 6.0
OSMOLARITY (mOsm/L) 273 250 241 212
CELL SURFACE MARKERS (%)
Positive Markers
CD90+ 99.860 73.821 61.851 53.153
CD73+ 96.541 76.541 64.321 56.121
CD105+ 96.541 76.251 70.111 52.111

Negative marker
CD34- 0.27 0.22 0.36 0.12
CD45- 0.08 0.001 0.02 0.15
HLADR- 0.014 0.03 0.01 0.05
Potency (Secretomes estimation)
IL10 ng/ml 955 968 1026 973
VEGF pg/ml 1653 1700 1795 1698
Gene expression (Fold expression) *
COL12 A1 17.80 - - 11.56
IGFBP5 16.90 - - 10.33
THBS2 15.40 - - 10.98
GREM1 20.50 - - 14.97
*Data represented as fold expression when compared with GAPDH gene.
Example 3: F2-Formulation comprising Ringer Lactate + HSA (0.4%) as carrier
[00111] The concentration of 0.4% HSA was chosen because it has been used
5 intensively as a supplement for preserving immune cells and is effective in
maintaining the high quality of these cells before administration as a suspension solution. Ringer’s lactate solution (RL), also known as sodium lactate solution, was conceived as an injectable solution for medical use. The osmolarity of RL is 275.52 mOsm/L, which is almost in the physiological osmotic range (280 -310 mOsmol/L).
10 It is an isotonic fluid and contains some extra salts (potassium, calcium, chloride,
lactate), which support cells more efficiently compared with 0.9% saline. The supplementation of Ringer lactate with 0.4% HSA showed improvement in viability of MSCs (Table 3) at 12h and 24h as compared to the use of 0.9% NaCl and 0.4% HSA as carrier.
15 Table 3: Evaluation of the effects of carrier Ringer Lactate +0.4%HSA on UC-
MSC

UC-MSC quality check parameters Time interval

0h 6h 12h 24h
Cell recovery (%) 99 86 81 78

Cell Viability (%) 96.41 93.01 88.33 76.46
Annexin V
Early Apoptotic cells (%) 3.17 9.04 10.21 11.41
Late Apoptotic cells (%) 0.00 1.004 2.659 3.964
pH 6.5 6.3 6.0 5.9
Osmolarity (mOsm/L) 275 270 266 261
CELL SURFACE MARKERS (%)
Positive Markers
CD90+ 97.28 92.26 87.16 81.36
CD73+ 98.58 93.52 87.16 82.65
CD105+ 99.54 91.36 86.36 81.35
Negative markers
CD34- 0.15 0.37 0.76 0.17
CD45- 0.05 0.036 0.07 0.09
HLADR- 0.02 0.07 0.11 0.27
Potency (Secretomes estimation)
IL10 (ng/ml) 1026 1123 1189 1010
VEGF (pg/ml) 1795 1860 1820 1077
Gene expression (Fold expression)*
COL12 A1 17.80 - - 13.09
IGFBP5 16.90 - - 14.66
THBS2 15.40 - - 13.39
GREM1 20.50 - - 17.66
*Data represented as fold expression when compared with GAPDH gene.
Example 4: F3-Formulation comprising Ringer lactate+ 0.4% HSA+ Dextran 40 (1%) as carrier
[00112] RL along with 0.4% HSA and Dextran 40 (1%) supported the survivability
5 of MSCs derived from umbilical cord tissue for up to 24h (Table 4).

Table 4: Evaluation of the effects of carrier Ringer lactate+ 0.4% HSA+ Dextran 40 (1%) on UC-MSC

UC-MSC quality check parameters Time interval

0h 6h 12h 24h
Cell recovery (%) 99 93 85 79
Cell Viability (%) 95.53 94.61 91.77 89.13
Annexin V
Early Apoptotic cells (%) 2.48 4.51 6.38 7.05
Late Apoptotic cells (%) 0.00 1.364 3.628 5.624
pH 6.5 6.4 6.4 6.3
Osmolarity (mOsm/L) 275 270 266 261
CELL SURFACE MARKERS (%)
Positive Markers (%)
CD90+ 99.26 97.12 89.12 84.12
CD73+ 97.56 93.35 87.58 82.35
CD105+ 98.56 94.65 86.35 81.65
Negative marker (%)
CD34- 0.13 0.36 0.45 0.98
CD45- 0.33 0.64 0.07 0.06
HLADR- 0.38 0.06 0.31 0.03
Potency (Secretomes estimation) pg/ml
IL10 (Ng/ml) 1026 1120 1236 1004
VEGF (pg/ml) 1795 1801 1823 1705
Gene expression (Fold expression)*
COL12 A1 17.80 - - 12.68
IGFBP5 16.90 - - 12.04
THBS2 15.40 - - 12.10
GREM1 20.50 - - 17.69
*Data represents as fold Expression when compared with GAPDH gene.
Example 5: F4-Formulation comprising Ringer lactate+ 1% HSA+ Dextran 40
5 (1%)+ Heparin (1000 U/ml) as carrier

[00113] HSA works like bovine serum albumin (BSA), as a lipid peroxidation inhibitor or an emulsifying substance to protect lipids against oxidation, plays a significant role in the membrane structure stabilization and reduces damage caused by osmotic stress. It has anti-oxidative activity and so it helps to maintain osmolarity. RL with 1% HSA, dextran 40 (1%) and heparin (1000 U/ml) supported the survivability of MSCs (93.70 %) derived from umbilical cord tissue for up to 24h (Table 5).
Table 5: Evaluation of the effects of carrier Ringer lactate+ 1% HSA+ Dextran 40 (1%)+Heparin (1000 Units) on UC-MSC

UC-MSC quality check parameters Time interval

0h 6h 12h 24h
Cell recovery (%) 99 96 94 91
Cell Viability (%) 99.20 97.40 95.15 93.70
Annexin V
Early Apoptotic cells (%) 0.85 1.91 3.23 3.62
Late Apoptotic cells (%) 0.00 0.964 2.635 3.462
pH 6.5 6.5 6.4 6.3
Osmolarity (mOsm/L) 275 273 270 268
CELL SURFACE MARKERS (%)
Positive Markers (%)
CD90+ 98.28 92.68 85.64 81.78
CD73+ 99.12 93.62 89.46 83.68
CD105+ 97.99 94.99 88.89 83.35
Negative marker (%)
CD34- 0.35 0.98 0.65 0.15
CD45- 0.06 0.01 0.13 0.30
HLADR- 0.03 0.008 0.13 0.95
Potency (Secretomes estimation)
IL10 (ng/ml) 1026 1041 1068 998
VEGF (pg/ml) 1795 1806 1834 1712

Gene expression (Fold expression)*
COL12 A1 17.80 - - 14.73
IGFBP5 16.90 - - 13.99
THBS2 15.40 - - 13.01
GREM1 20.50 - - 17.47
*Data represents as fold expressions when compared with GAPDH gene.
Example 6: F5-Formulation comprising Ringer lactate + 1% has + Dextran 40 (1%) + Heparin (1000 U/ml) + Serelaxin as carrier
[00114] Results revealed that all tested UCMSCs steadily maintained CD73 and
5 CD90 expression at 0h and 24h storage at RT in the tested media, the expression
was higher than 85%. The expression of negative markers, including CD19, CD34, CD45 and HLA-DR remained below 10% regardless of storage media and storage duration. [00115] Prolong exposure of MSCs in serum free medium have showed increase in
10 secretomes. Notably, the preservation conditions directly altered the secretory
profiles of MSCs from all the tested sources, and their behaviour in response to the surrounding environment was also distinct. This was proved by the increasing concentration of total protein concentration after 24h. Carrier solution comprising Ringer lactate, 1% HSA, Dextran 40 (1%), Heparin (1000 U/ml) and Serelaxin
15 (1ng/ml), which gives better results than other carriers used in the study up to 24h.
[00116] The results indicated that transport/storage of clinical-grade UC-MSCs successfully preserved viability rates above the allowable limits, stimulatory factors, pH, osmolarity and surface marker expression at 15-28˚C temperatures, preferably in RL-based media supplemented with 1% HSA, Dextran 40 (1%),
20 Heparin (1000 U/ml) and Serelaxin (1ng/ml).
[00117] In the gene expression studies for different genes such as COL 12A1, IGFBP5, THBS2 and GREM1, carrier solution having Ringer lactate 1% HSA, Dextran40 (1%), Heparin (1000 U/ml) and Serelaxin (1ng/ml) was found better when compared with other carrier solutions, The gene expression was found more
25 in this carrier as compared with others (Table 6).

Table 6: Evaluation of the effects of carrier Ringer Lactate (RL) 1% HSA, Dextran 40 (1%), Heparin (1000 U/ml) and Serelaxin (1ng/ml) on UC-MSC (Figure 1A-1E)
UC-MSC quality check parameters Time Interval

0h 6h 12h 24h
Cell recovery (%) 99 99 98 97
Cell Viability (%) 99.78 99.01 98.66 97.54
Annexin V
Early Apoptotic cells (%) 0.019 1.38 2.65 5.51
Late Apoptotic cells (%) 0.00 0.00 0.364 2.658
pH 6.5 6.5 6.5 6.4
Osmolarity (mOsm/L) 275 280 282 310
CELL SURFACE MARKERS (%)
Positive Markers (%)
CD90+ 99.74 97.12 96.340 95.619
CD73+ 98.69 96.11 95.626 94.727
CD105+ 98.47 95.23 94.698 93.864
Negative marker (%)
CD34- 0.627 0.356 0.345 0.632
CD45- 0.018 0.095 0.951 0.462
HLADR- 0.089 0.038 0.753 0.645
Potency (Secretomes estimation)
IL10 (ng/ml) 1026 1039 1169 1002
VEGF (pg/ml) 1795 1873 1888 1701
Gene Expression (Fold expression)
COL12 A1 17.80 - - 16.40
IGFBP5 16.90 - - 15.50
THBS2 15.40 - - 15.20
GREM1 20.50 - - 18.25
5 *Data represented as fold expression when compared with GAPDH gene.

Example 7: F6-Formulation comprising hyaluronidase as carrier
[00118] Human hyaluronidase enzyme facilitates the subcutaneous delivery of the
formulation when used along or before with hyaluronidase enzyme. This enzyme
when administered locally, it depolymerizes hyaluronic acid in the subcutaneous
5 space, temporarily removing the barrier to subcutaneous administration of
relatively large volumes. The application of hyaluronidase enzyme to the existing subcutaneous drug formulation can optimize dosing and administration, remove the volume limitations associated with conventional subcutaneous delivery, and also enable reformulation of existing intravenous (IV) drugs for rapid subcutaneous
10 delivery.
[00119] The required dose of hyaluronidase enzyme is 2000 IU/ml with the formulation of the present disclosure. This hyaluronidase enzyme shall be co-infused with the formulation or infused at same site before infusion/injection of the formulation.
15 Table 7: Evaluation of the effect of carrier, Hyaluronidase (2000 IU/ml) on
UC-MSCs (Figure 2A-2E)

UC-MSC quality check parameters Time interval (In Hours)

0h 3h 6h 12h
Cell recovery (%) 98.10 81.20 70.15 64.35
Cell Viability (%) 99.18 84.14 67.46 53.41
Annexin V
Early Apoptotic cells (%) 1.30 7.69 19.81 30.99
Late Apoptotic cells (%) 0 0.82 2.12 4.16
pH 6.6 6.5 6.1 6.0
OSMOLARITY (mOsm/L) 271 253 244 210
CELL SURFACE MARKERS (%) Positive Markers
CD90+ 99.90 76.33 68.29 55.02
CD73+ 98.41 75.97 68.45 56.79
CD105+ 98.13 80.38 71.75 54.72
Negative marker
CD34 0.19 0.33 0.16 0.09

CD45 0.82 0.61 0.10 0.46
HLADR 0.72 0.14 0.06 0.08
Potency (Secretomes estimation)
IL10 ng/ml 957 1160 940 820
VEGF pg/ml 1714 1790 1690 1580
Gene expression (Fold expression) *
COL12 A1 18.10 - - 10.56
IGFBP5 17.80 - - 11.13
THBS2 14.90 - - 11.08
GREM1 21.00 - - 13.98
[00120] *Data represents as fold gene expression when compared with GAPDH
gene.
[00121] The cells when mixed with Hyaluronidase (2000 IU/ml), it shows that the
cell recovery is more than 98% at 0 hours of time and 81% at 3 hours of time. The
5 cell goes down at 70% at 6 hours and 64% at 12 hours (Table 7).
[00122] Further, cells when treated with hyaluronidase enzyme (2000 IU/ml) exhibit a similar initial viability (over 99% at 0 hours). However, this viability shows a more pronounced decline over time, dropping to 84% at 3 hours, 67% at 6 hours, and 53% at 12 hours.
10 [00123] Annexin V data showed that the cells gradually entered the early apoptotic
phase upon mixing with hyaluronidase.
[00124] The pH of the solution remained around 6.6 to 6 without much change over time. [00125] The cell marker expression for CD90, CD73 and CD105 also changed with
15 time when cells were mixed with hyaluronidase. There was not much change in the
expression of the negative markers CD34, CD45 and HLA-DR.
[00126] In the secretomes analysis, secretomes of IL-10 and VEGF increased at 3 hours and showed decrease 6 hour onwards. In the gene expression studies, all the gene expression of the cells decreased at 12 hours when the cells were mixed with
20 hyaluronidase.
[00127] Overall, the present disclosure provides important insights into the optimal transport/storage conditions for HUC-MSCs and suggest that RL with 1% HSA, 1

ng/ml serelaxin, 1% dextran 40 and heparin 1000 U/ml is the most suitable carrier in a formulation for the treatment of different autoimmune diseases or fibrotic diseases.
5 Advantages of the present disclosure
[00128] The present disclosure provides a formulation comprising a population of
MSCs with therapeutic potential and a carrier specifically comprising Ringer’s
lactate solution, serelaxin, HSA, heparin, and dextran with the following
advantages.
10 1. The MSCs viability was maintained at 97.54% for up to 24h.
2. The cell recovery was 97.00 % for up to 24 h.
3. Cell characterization for positive cell surface markers showed 95.61% for CD90; 94.72 % for CD73 and 93.86% for CD105 for up to 24 h.
4. Cell characterization for negative cell surface markers showed 0.632% for
15 CD34; 0.462% for CD45 and 0.645 for HLA-DR for up to 24 h.
5. The estimated amount of secretomes comprising IL-10 and VEGF was 1002 ng/ml and 1701 pg/ml, respectively for up to 24 h.
6. In gene expression analysis, 16.40-fold expression for COL12A1, 15.50-fold expression for IGFBP5, 15.20-fold expression for THBS2 and 18.25-fold
20 expression for GREM1 was observed for up to 24 h.
7. The MSCs by itself when suspended in an excipient comprising DMEM and HSA in 1:1 ratio showed stability for 48 h after freeze/thaw cycle at 15 to 28℃.
8. The MSCs when as part of the formulation was found to be stable for up to 24 h at 15 to 28 ℃.
25

I/We Claim:
1. A formulation comprising:
a) a population of mesenchymal stem cells (MSCs); and
b) a carrier selected from serelaxin, Ringer’s lactate solution, human serum 5 albumin (HSA), heparin, dextran, or combinations thereof;
wherein said population of MSCs is a homogeneous population having size
in the range of 15-30 µm; wherein at least 50% of the MSCs express at least
one marker selected from the group consisting of CD 90, CD73, and CD
105.
10 2. The formulation as claimed in claim 1, wherein the carrier further
comprises hyaluronidase.
3. The formulation as claimed in claim 1, wherein the MSCs exhibit increased
expression of COL12A1 gene, IGFBP5 gene, THBS2 gene and GREM 1
gene, as compared to the expression of GAPDH gene, wherein the
15 increased expression of COL12A1 is in the range of 14 to 19 folds as
compared to the expression of GAPDH gene; wherein the increased expression of IGFBP5 gene is in the range of 14 to 18 folds as compared to the expression of GAPDH gene; wherein the increased expression of THBS2 gene is in the range of 15 to 17 folds as compared to the expression
20 of GAPDH gene; wherein the increased expression of GREM 1 gene is in
the range of 18 to 21 folds as compared to the expression of GAPDH gene.
4. The formulation as claimed in claim 1, wherein said formulation comprises
secretome of said MSCs comprising VEGF in an amount in the range of
2050 to 2390 µg per million MSCs, and IL-10 in an amount in the range of
25 1430 to 1690 µg per million MSCs.
5. The formulation as claimed in claim 1, wherein the carrier is in a weight percentage range of 0.5 to 2.5% of the formulation.
6. The formulation as claimed in claim 1 or claim 2, wherein the serelaxin is a 0.5 to 5 ng/ml concentration solution; the Ringer’s lactate solution
30 comprises 25 to 30 mM of sodium lactate, 100 to 105 mM of sodium
chloride, and 3.5 to 4.5 mM of potassium chloride and 1.5 to 2 mM of

calcium chloride; HSA is a 1 to 20% concentration solution; dextran is a
0.5% to 19% concentration solution; heparin is in a concentration range of
500 to 2000 U/ml; and hyaluronidase is in a concentration range of 500 to
5000 U/ml.
5 7. The formulation as claimed in claim 1, wherein the MSCs are present in
the range of 0.5 x 106 cells/ ml to 2 x 106 cells/ml of the formulation, preferably 1.8 x 106 cells/ ml of the formulation.
8. The formulation as claimed in claim 1, wherein the homogeneous
population of MSCs is obtained by artificial intelligence driven
10 microfluidic sorting of culture expanded MSCs, preferably using an
artificial intelligence-based tool.
9. The formulation as claimed in claim 1, wherein the MSCs are derived from
umbilical cord tissue, cord blood, adipose tissue, bone marrow, or dental
pulp.
15 10. The formulation as claimed in claim 1, wherein the homogeneous
population of MSCs are present in a suspension comprising an excipient selected from DMEM, human serum albumin (HSA) or combinations thereof; preferably the excipient is DMEM and 20% HSA solution in a weight ratio in a range of 1:2 to 2:1, more preferably the excipient is
20 DMEM and 20% HSA solution in a weight ratio of 1:1.
11. The formulation as claimed in claim 1, wherein the formulation comprises additives selected from DMEM medium, saline solution, phosphate buffered saine (PBS) buffer, Hank’s balanced salt solution (HBSS), human plasma, plasma lysate, or mixtures thereof.
25 12. The formulation as claimed in claim 1, wherein percentage cell recovery of
said MSCs in the formulation estimated after 0 to 24 hours is in the range
of 99 to 80% and a percentage cell viability of said MSCs in the formulation
estimated after 0 to 24 hours is in the range of 99.8% to 80%.
13. The formulation as claimed in claim 1, wherein the formulation has a pH
30 in the range of 6.4 to 6.6; and wherein the formulation has an osmolarity in
the range of 275 to 310 mOsm/L.

14. The formulation as claimed in claim 1, wherein the population of MSCs
comprises less than 6% of early apoptotic cells; and less than 3% of late
apoptotic cells.
15. A method for preparing the formulation as claimed in claim 1, wherein
5 the method comprises:
mixing the plurality of MSCs with the carrier to obtain the formulation.
16. The method as claimed in claim 15, wherein the method further comprises the addition of one or more additives.
17. A method of inducing tissue regeneration, comprising:
10 administering to a tissue in need thereof the formulation as claimed in
claim 1 or obtained by the method as claimed in claim 15; wherein the tissue is selected from epithelial tissue; connective tissue like bone tissue, cartilage tissue or elastic tissue; muscle tissue; or nervous tissue.
18. A method of treating autoimmune or fibrotic disease in a subject,
15 comprising:
administering the formulation as claimed in claim 1 or obtained by the method as claimed in claim 15 to the subject.
19. The method as claimed in claim 18, wherein administering the
formulation is via the intravenous, intramuscular, intraosseous,
20 subcutaneous, intraplantar, or intraarticular route.
20. Use of the formulation as claimed in claim 1 in the manufacture of a medicament for treating autoimmune or fibrotic disease in a subject.
21. The method as claimed in claim 18 or the use as claimed in claim 20, wherein the auto immune disease or fibrotic disease is selected from the
25 group consisting of Acromegaly, Acquired Aplastic Anemia, Acquired
Hemophilia, Agammaglobulinemia, Alopecia Areata, Ankylosing Spondylitis (AS), Anti-NMDA Receptor Encephalitis, Antiphospholipid Syndrome (APS), Arteriosclerosis, Autoimmune Addison’s Disease (AAD), Autoimmune Autonomic Ganglionopathy (AAG), Autoimmune
30 Encephalitis (AE)/Acute Disseminated Encephalomyelitis (ADEM),
Autoimmune Gastritis, Autoimmune Hemolytic Anemia (AIHA),

Autoimmune Hepatitis, Autoimmune Hyperlipidemia, Autoimmune
Hypophysitis/Lymphocytic Hypophysitis, Autoimmune Inner Ear Disease
(AIED), Autoimmune Lymphoproliferative Syndrome (ALPS),
Autoimmune Myelofibrosis (AIMF), Autoimmune Myocarditis,
5 Autoimmune Oophoritis, Autoimmune Pancreatitis (AIP), Autoimmune
Polyglandular Syndromes (APS), Autoimmune Progesterone Dermatitis
(APD), Autoimmune Retinopathy (AIR), Autoimmune Sudden
Sensorineural Hearing Loss, Balo Disease/Concentric Sclerosis, Behçet’s
Disease, Birdshot Chorioretinopathy/Birdshot Uveitis, Bullous
10 Pemphigoid, Castleman Disease, Celiac Disease, Chagas Disease, Chronic
Inflammatory Demyelinating Polyneuropathy (CIDP), Chronic
Autoimmune Urticaria, Churg-Strauss Syndrome/Eosinophilic
Granulomatosis with Polyangiitis (EGPA), Cogan's Syndrome (CS), Cold Agglutinin Disease (CAD), Crest Syndrome, Crohn's Disease, Stricturing
15 Crohn's Disease, Cronkhite-Canada Syndrome (CCS), Cryptogenic
Organizing Pneumonia (COP), Dermatitis Herpetiformis (DH), Dermatomyositis, Diabetes, Type 1 (T1D), Discoid Lupus Erythematosus (DLE), Dressler’s Syndrome/ Post myocardial Infarction/ Post pericardiotomy Syndrome, Eczema/Atopic Dermatitis, Eosinophilic
20 Fasciitis, Erythema Nodosum, Essential Mixed Cryoglobulinemia, Evans
Syndrome, Fibrosing Alveolitis/Idiopathic Pulmonary Fibrosis (IPF), Giant
Cell Arteritis/Temporal Arteritis/Horton's Disease, Giant Cell Myocarditis,
Glomerulonephritis (GN), Goodpasture’s Syndrome/Anti-Gbm/Anti-Tbm
Disease, Granulomatosis With Polyangiitis (GPA)/Wegener's
25 Granulomatosis, Graves’ Disease (GD), Guillain-Barrè Syndrome (GBS),
Hashimoto’s Thyroiditis/Autoimmune Thyroiditis, Henoch-Schölein
Purpura (HSP)/Iga Vasculitis, Hidradenitis Suppurativa, Hurst’s
Disease/Acute Hemorrhagic Leukoencephalitis (AHLE),
Hypogammaglobulinemia, Iga Nephropathy/Berger’s Disease, Immune-
30 Mediated Necrotizing Myopathy (IMNM), Immune Thrombocytopenia
(Itp)/Autoimmune Thrombocytopenia Purpura, Inclusion Body Myositis

(IBM), Igg4-Related Sclerosing Disease (ISD), Interstitial Cystitis,
Juvenile Idiopathic Arthritis (Jia)/Adult-Onset Still's Disease, Juvenile
polymyositis/Juvenile dermatomyositis/ juvenile myositis, Kawasaki
disease, Lambert-Eaton Myasthenic Syndrome (LEMS), Leukocytoclastic
5 vasculitis, Lichen Planus, Lichen Sclerosus, Ligneous conjunctivitis,
Linear Iga Disease (LAD), Lupus Nephritis (LN), Lyme Disease / Chronic
Lyme Disease / Post-Treatment Lyme Disease Syndrome (PTLDS),
Lymphocytic colitis/microscopic colitis, Lymphocytic
hypophystitis/autoimmune hypophystitis, Ménière’s Disease, Microscopic
10 Polyangiitis (MPA)/ANCA-Associated Vasculitis, Mixed Connective
Tissue Disease (MCTD), Mooren’s ulcer, Mucha-Habermann disease, Multifocal motor neuropathy, Multiple Sclerosis (MS), Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS), Myasthenia Gravis (MG), Narcolepsy, Neuromyelitis Optica/Devic's Disease, Ocular
15 Cicatricial Pemphigoid, Opsoclonus-myoclonus syndrome (OMS),
Palindromic Rheumatism, Paraneoplastic Cerebellar Degeneration (PCD), Paraneoplastic Pemphigus, Parry-Romberg Syndrome (PRS)/Hemifacial Atrophy (HFA)/Progressive Facial Hemiatrophy, Paroxysmal Nocturnal Hemoglobinuria (PNH), Peripheral uveitis/pars planitis, PANS/PANDAS,
20 Parsonage-Turner Syndrome (PTS), Pemphigoid Gestationis (PG),
Pemphigus Foliaceus, Pemphigus Vulgaris, Pernicious anemia, POEMS Syndrome, Polyarteritis Nodosa (PAN), Polymyalgia Rheumatica, Polymyositis, Postural Orthostatic Tachycardia Syndrome (Pots), Primary Biliary Cirrhosis (PBC), Primary Sclerosing Cholangitis (PSC), Psoriasis,
25 Palmoplantar Pustulosis (PPP), Psoriatic Arthritis, Pulmonary fibrosis,
idiopathic (IPF), Pure Red Cell Aplasia (PRCA), Pyoderma gangrenosum, Rasmussen's encephalitis, Raynaud’s Syndrome, Reactive Arthritis, Reflex sympathetic dystrophy syndrome (RSD)/ Complex regional pain syndrome (CRPS), Relapsing Polychondritis (RP), Restless leg syndrome
30 (RLS)/Willis-Ekbom disease, Rheumatic Fever, Rheumatoid Arthritis
(RA), Sarcoidosis, Schmidt Syndrome/Autoimmune Polyendocrine

Syndrome Type II, Scleritis, Scleroderma, Sclerosing
Mesenteritis/Mesenteric Panniculitis, Serpiginous choroidopathy,
Sjögren's Syndrome, Stiff person syndrome (SPS), Small Fiber Sensory
Neuropathy (SFSN), Small Fiber Sensory Neuropathy (SFSN), Systemic
5 Lupus Erythematosus (SLE), Subacute bacterial endocarditis (SBE),
Subacute cutaneous lupus, Susac’s syndrome, Sydenham’s Chorea,
Sympathetic ophthalmia, Takayasu’s arteritis (vasculitis), Testicular
Autoimmunity, Tolosa-Hunt syndrome, Transverse myelitis (TM),
Tubulointerstitial nephritis uveitis syndrome (TINU), Ulcerative Colitis,
10 Undifferentiated Connective Tissue Disease, Uveitis, Vasculitis, VEXAS
Syndrome, Vogt-Koyanagi-Harada syndrome (VKH),Osteoarthritis, AVN,
vertebral compression factor, urethral stricture, ureteric stricture, eye
fibrosis, heart fibrosis, hepatic fibrosis, intestinal fibrosis, lung fibrosis,
Pancreas fibrosis, renal fibrosis, and skin fibrosis.

Documents

Application Documents

# Name Date
1 202421031909-STATEMENT OF UNDERTAKING (FORM 3) [22-04-2024(online)].pdf 2024-04-22
2 202421031909-FORM FOR SMALL ENTITY(FORM-28) [22-04-2024(online)].pdf 2024-04-22
3 202421031909-FORM FOR SMALL ENTITY [22-04-2024(online)].pdf 2024-04-22
4 202421031909-FORM 1 [22-04-2024(online)].pdf 2024-04-22
5 202421031909-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [22-04-2024(online)].pdf 2024-04-22
6 202421031909-DRAWINGS [22-04-2024(online)].pdf 2024-04-22
7 202421031909-DECLARATION OF INVENTORSHIP (FORM 5) [22-04-2024(online)].pdf 2024-04-22
8 202421031909-COMPLETE SPECIFICATION [22-04-2024(online)].pdf 2024-04-22
9 202421031909-FORM-26 [30-04-2024(online)].pdf 2024-04-30
10 202421031909-Proof of Right [07-05-2024(online)].pdf 2024-05-07
11 202421031909-Request Letter-Correspondence [17-04-2025(online)].pdf 2025-04-17
12 202421031909-Power of Attorney [17-04-2025(online)].pdf 2025-04-17
13 202421031909-Form 1 (Submitted on date of filing) [17-04-2025(online)].pdf 2025-04-17
14 202421031909-Covering Letter [17-04-2025(online)].pdf 2025-04-17
15 202421031909-CERTIFIED COPIES TRANSMISSION TO IB [17-04-2025(online)].pdf 2025-04-17