Sign In to Follow Application
View All Documents & Correspondence

A Novel Qpcr (Rt Pcr) Assay For Detection And Identification Of Mycoplasma Sp

Abstract: Described herein a novel, rapid and sensitive qPCR (RT-PCR) assay method for detection and identification of different Mycoplasma species, including Mycoplasma agalactiae, Mycoplasma capricolum subspecies capripneumoniae (Mccp), Mycoplasma mycoides subspecies capri (Mmc), Mycoplasma putrefaciens (Mput)infection and any other Mycoplasma spp.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
23 August 2024
Publication Number
37/2025
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

Resinno Biotech Private Limited
324, Turbhe Industrial Park, Plot C 56/1, TTC Industrial Area, Thane Creek MIDC, Pawane, Navi Mumbai-400710, Maharashtra, India.

Inventors

1. AHMED, Kafil
Majesta E- 1104 , Casa Bella Palava city , Kalyan Shil road , Nilje Thane – 421204, Maharashtra, India.
2. PIDIYAR, Vyankatesh
Flat 1&2 , Madhuban Apartment, Tagore Nagar , Nashik Pune Road Nashik – 422006 Maharashtra, India.
3. AHMED, Aqsa
Majesta E- 1104 , Casa Bella Palava city , Kalyan Shil road , Nilje Thane – 421204, Maharashtra, India.

Claims

1. A composition for detecting polC gene and FusA gene in a pathological sample for detection of Mycoplasma, wherein the composition comprises: a. a forward primer; b. a reverse primer, and c. a probe sequence.

2. The composition as claimed in claim 1, wherein the composition for detecting polC gene comprises of, a. forward primer set comprising sequence of SEQ ID1; b. reverse primer set comprising sequence of SEQ ID2; c. probe1-a sequences comprising sequence of SEQ ID3, d. probe1-b sequences comprising sequence of SEQ ID4; e. probe2-a sequences comprising sequence of SEQ ID5, and f. probe2-b sequences comprising sequence of SEQ ID6.

3. The composition as claimed in claim 2, wherein the composition is for detecting Mycoplasma agalactiae.

4. The composition as claimed in claim 1, wherein the composition for detecting FusA gene comprises of, a) forward primer set comprising SEQ ID7; b) reverse sequences comprising SEQ ID8, c) probe 1 sequences comprising SEQ ID9, and d) probe 1 a sequences comprising SEQ ID10.

5. The composition as claimed in claim 4, wherein the composition is for detecting Mycoplasma capricolum subspecies capripneumoniae (Mccp), Mycoplasma mycoides subspecies capri (Mmc), Mycoplasma putrefaciens (Mput).

6. The composition as claimed in claim 1, wherein the composition for detecting 18S rRNA of host bearing GENE ID KY129860.1, comprising; a) forward primer set comprising SEQ ID11; b) reverse sequences comprising SEQ ID12; c) probe sequences comprising SEQ ID13; d) probe sequence comprising SEQ ID14; and e) probe sequence comprising SEQ ID15.

7. The composition as claimed in claim 1, wherein the probe is targeted to the sequence of the conserved region of the Mycoplasma selected from Gene ID: 23778894 and Gene ID: 93357833.

8. A kit for detecting Mycoplasma in ruminant animals, comprising a. a Primer cocktail; and b. a Probe cocktail.

9. The kit as claimed in claim 7, wherein the primer cocktail comprises of, a. Forward primer for Pol C gene : 20 µl b. Reverse primer for Pol C gene : 20 µl c. Forward primer for Fus A gene : 20 µl d. Reverse primer for Fus A gene : 20 µl e. Forward primer for 18S rRNA gene: 20 µl f. Reverse primer for 18S rRNA gene: 20 µl

10. The kit as claimed in claim 7, wherein the probe cocktail comprises of, a. Probe for Pol C gene : 20 µl b. Probe for Fus A gene : 20 µl c. Probe for 18S rRNA gene : 20 µl

11. The kit as claimed in claim 7, wherein the targeted sequence is the conserved region of the Mycoplasma as shown in Gene ID: 23778894 and Gene ID: 93357833

Specification

DESC:Field of Invention:
The invention relates to detection of contagious bacteria in ruminant animals. More particularly, the current invention relates to an qPCR (RT-PCR) assay for detection and identification of different Mycoplasma species in cattle, goats & sheep.

Background of the Invention:
Animal health is challenged both acutely and chronically by infectious diseases, regardless of their origin; bacterial, viral, or otherwise. Of particular concern are respiratory tract infections that are frequently encountered by livestock which cause huge loses. Diseases of the respiratory system, especially those of the viral and bacterial varieties, are common in animals of all ages, though they are frequently more severe in the very young and the very old animals.

The virulent Bacteria can include species of Mycoplasma, which are bacteria without cell walls, as well as Gram positive and Gram negative bacteria. Yeasts, fungus, and other microscopic disease-causing organisms may also be responsible for certain diseases, including respiratory disorders, in addition to bacteria that cause them.

Mycoplasma species are highly contagious bacteria; have a global distribution. The Mycoplasma are cause of numerous serious diseases in ruminant animals such as, cattle, goats & sheep. These bacteria are unique because they lack a cell wall, making them challenging to detect and treat. The diseases caused by this phyla, include contagious bovine pleuropneumonia (CBPP), contagious caprine pleuropneumonia (CCPP), contagious agalactia, mastitis, arthritis, pneumonia, otitis media and reproductive disorders.

Mycoplasma pneumonia in sheep and goats is usually covert, but causes huge economic losses to the sheep and goat industry. Contagious caprine pleuropneumonia (CCPP) caused by Mycoplasma capricolum subspecies capripneumoniae (Mccp) is a severe and devastating respiratory disease with high morbidity and mortality in goats.
Traditionally, the identification and diagnosis of Mycoplasma has been performed via microbial culture on solid agar, liquid media, or semi-solid media. Other tools, like DNA hybridization, DAPI Staining and electron microscopy are now available for typing Mycoplasma spp. isolates, allowing for genetic characterization in disease outbreak investigations.

Serological diagnosis using indirect ELISA allows the detection of anti-Mycoplasma antibodies in sera and milk, with their use demonstrated on individual animal samples as well as Bulk Tank Milk (BTM) samples.

Teshome et al have reported Mccp detection from clinically affected goats in Ethiopia that tested positive in the cELISA were analysed and confirmed using conventional PCR.

For instance, WO2011133433 discloses method for the detection of bacterial respiratory pathogens, particularly real-time multiplex PCR for detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella spp.

Different genes targeted for detection of different Mycoplasma species by conventional PCR and RT-PCR includes 16S rRNA gene, 16S-23S intergenic spacer region, oppD/F genes, fusA gene, rpoB gene, uvrC gene.

For instance, EP3438280 discloses a molecular technique and assay to detect bacteria of the haemoplasma group of Mycoplasmas with a broad coverage. The assay is done by amplifying a segment of a 16S rRNA gene by real-time PCR (qPCR) using an oligonucleotide primer pair.

Mycoplasma putrefaciens (Mput) is new cause of mastitis in goats, its infection in the udder is the lack of clinical signs and rapid growth of the organisms, followed by inflammatory cells in the milk and complete halt to lactation.

Mycoplasma mycoides subsp. mycoides SC (Mmc), the aetiological agent of contagious bovine pleuropneumonia (CBPP), is considered the most pathogenic of the Mycoplasma species. Its virulence is probably the result of a coordinated action of various components of an antigenically and functionally dynamic surface architecture.

Amores et al have detected the presence of Maga & Mmc from ear swabs of goats using PCR.

PCR assays capable of discriminating among hemoplasmas have greatly enhanced diagnosis of these parasites and have led to identification of several new Mycoplasma species from whole blood and aspirates of the spleen.

One more instance could be found in Anna Ligasová et al’s “A New Sensitive Method for the Detection of Mycoplasmas Using Fluorescence Microscopy” of 2019, discloses a new immunofluorescence assay for the detection of Mycoplasmas. The method is based on the enzymatic labelling using DNA polymerase I and modified nucleotides utilizing nicks in the Mycoplasmas’ DNA. Modified nucleotides are incorporated into Mycoplasmas’ DNA and subsequently visualized by immunofluorescence microscopy. The developed approach is independent of the Mycoplasma strain, does not intensely stain nuclear DNA, does not stain other bacteria, and provides higher sensitivity than the approach based on the direct labelling using DAPI or Hoechst dyes.

Overall, the currently available PCR techniques used for detection and identification of Mycoplasma species are time consuming and require manual manipulation steps.

Hence, there is a need to develop a rapid, accurate & affordable diagnosis method for detection of Mycoplasma to prevent and control disease outbreaks.

Therefore, the current inventors propose a rapid qPCR (RT-PCR) assay for detection and identification of different Mycoplasma species from cattle, goats and sheep and the probes and primers thereof:

Object of the invention:
The primary object of the invention is to provide a certain primers and probes which are specific to certain mycoplasma species.

In yet another object of the present invention is to provide a quick, sensitive, and reliable assay for detection and identification of different Mycoplasma species.

Summary of Invention:
In view of the above objects, the primary aspect of the present invention is to provide novel probes and primers for detection and identification of different Mycoplasma species.

The binding of said forward and reverse primers are detected by fluorophores.

The binding is further detected through gel electrophoresis.

The said primer and probes are designed to detect polC gene of Mycoplasma agalactiae.

In yet another aspect, the present invention provides a primer and probes which are designed to detect FusA gene for detection of Mycoplasma capricolum subspecies capripneumoniae (Mccp), Mycoplasma mycoides subspecies capri (Mmc), Mycoplasma putrefaciens (Mput) infection.

In yet another aspect, the present invention provides a primer and probes are designed to detect 18S rRNA of the host.

Said primer and probes amplify different genes from the swab and/or other samples from different cattle, goats and/or sheeps which are effectively detected by qPCR (RT-PCR) assay.

SEQUENCE LISTING
SEQ ID 1: 5’GCRCATGCTACMGCTTATGT3’
SEQ ID 2: 5’CTAGCATAAAATGCCAAAGGTTCA3’
SEQ ID 3: Texas Red-ATGGCACTATGAATAGC-BHQ2
SEQ ID 4: Texas Red-ATGGCACTATGAATAGCCT-BHQ2
SEQ ID 5: Cy5-AATGGCGCTATGAATAG-BHQ2
SEQ ID 6: Cy5-AATGGCGCTATGAATAGCCT-BHQ2
SEQ ID 7: 5’CAAAAAGARCGTGTTGGWCGTA3’
SEQ ID 8: 5’CCAACAGCTGYAGCAATATC3’
SEQ ID 9: FAM-CGTACTGAAATTGAAGAAG-BHQ1
SEQ ID 10: FAM-CGTACTGAAATTGAAGAAGTTTATKC-BHQ1
SEQ ID 11: 5’GGAGTATGGTTGCAAAGCTGA3’
SEQ ID 12: 5’GGTGAGGTTTCCCGTGTTG3’
SEQ ID 13: Cy5-AAGGAATTGACGGAAGGGCA-BHQ2
SEQ ID 14: HEX-AAGGAATTGACGGAAGGGCA-BHQ1
SEQ ID 15: HEX-AAGGAATTGACGGAAGGG-BHQ1

Brief Description of Drawings:
Fig 1 illustrates the results of qPCR of the nasal swab sample of goat which is processed by DNA isolation by QIAamp DNA extraction kit.

Fig 2 illustrates a qPCR of the nasal swab sample of infected goat processed for DNA isolation by boiling method.

Fig 3 illustrates qPCR of the gene specific synthetic DNA.
Detailed Description of Drawings:
Figure 1 describes a qPCR of the nasal swab sample collected from infected goat for the detection of Mycoplasma species. The swab sample was processed for DNA isolation by QIAamp DNA extraction kit.
(a) The PCR products (10 µl) were run on 2% agarose gel electrophoresis using 1X Tris Borate Buffer. Lane 1: multiplex qPCR, Lan2: 50 bp ladder, Lane 3: Pol1 gene qPCR, Lane4: Fus A gene qPCR, Lane 5: 18S rRNA gene qPCR.
(b) Amplification plot indicating the amplification curves for different genes in multiplex qPCR.

Figure 2 describes qPCR of the two nasal swab samples collected from infected goat for the detection of Mycoplasma species. The swab samples were processed for DNA isolation by boiling method.
(a) The PCR products (10 µl) were run on 2% agarose gel electrophoresis using 1X Tris Borate Buffer. Lane 1: multiplex qPCR, Lan2: 50 bp ladder, Lane 3: Pol1 gene qPCR, Lane4: Fus A gene qPCR, Lane 5: 18S rRNA gene qPCR.
The same gel loading pattern was maintained for another sample in Lane 6 to Lane 10.
(b) Amplification plot indicating the amplification curves for different genes in multiplex qPCR.

Figure 3 describes qPCR of the gene specific synthetic DNA. The PCR was run on QuantStudio5 machine.
(a) The PCR products (10 µl) were run on 2% agarose gel electrophoresis using 1X Tris Borate Buffer. Lane 1: multiplex qPCR, Lan2: 50 bp ladder, Lane 3: Pol1 gene qPCR, Lane4: Fus A gene qPCR, Lane 5: 18S rRNA gene qPCR.

(b) Amplification plot indicating the amplification curves for different genes in multiplex qPCR.

Detailed Description of the Invention:
The invention will now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more fully understood and appreciated. As used herein, the following terms and phrases shall have the meaning set forth below.

Unless specified otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art, to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. To describe the invention, certain terms are defined herein specifically as follows.

Unless stated to the contrary, any of the words “contains”, “containing”, "including," "includes," "comprising," and "comprises" mean "including without limitation" and shall not be construed to limit any general statement that it follows to the specific or similar items or matters immediately following it. Embodiments of the invention are not mutually exclusive but may be implemented in various combinations. The described embodiments of the invention and the disclosed examples are given for the purpose of illustration rather than limitation of the invention as set forth in the appended claims.

Further, words like “a”, “an”, “at least” and “the” should be construed to not only cover singular quantities but also plural quantities of the elements immediately following them.

Described herein is a novel primers and probes for detection and identification of mycoplasma from ruminant animals. The primers and probes are designed to detect mycoplasma species, such as, Mycoplasma agalactiae, Mycoplasma capricolum subspecies capripneumoniae (Mccp), Mycoplasma mycoides subspecies capri (Mmc), Mycoplasma putrefaciens (Mput) infection and any other Mycoplasma spp.
In an embodiment, the invention provides a composition containing primers and probes for detection and identification of polC gene and FusA gene. The invention also provides the primers and probes for 18S rRNA.

Accordingly, the invention provides the new set of forward and reverse primers whose amplicon can be detected by fluorophores or fluorescent dyes attached at 5’end of the probes, which are specific to Mycoplasma spp.

In an specific embodiment, the present invention provides a primer set for detection of polC gene of Mycoplasma agalactiae infection, comprising;
a) forward primer set comprising SEQ ID1: 5’GCRCATGCTACMGCTTATGT3’;
b) reverse primer set comprising SEQ ID2; 5’CTAGCATAAAATGCCAAAGGTTCA3’:
c) probe1-a sequences comprising SEQ ID3: Texas Red-ATGGCACTATGAATAGC-BHQ2,
d) probe1-b sequences comprising SEQ ID4: Texas Red-ATGGCACTATGAATAGCCT-BHQ2;
e) probe2-a sequences comprising SEQ ID5: Cy5-AATGGCGCTATGAATAG-BHQ2, and
f) probe2-b sequences comprising SEQ ID6: Cy5-AATGGCGCTATGAATAGCCT-BHQ2,
wherein Mycoplasma the amplicon size is 80 bp.
For PolC gene:
MAG_RS00340 PolC-type DNA polymerase III [Mycoplasmopsis agalactiae PG2] - Gene ID: 93357833

In another embodiment, the present invention provides a primer set for detection of FusA gene of Mycoplasma capricolum subspecies capripneumoniae (Mccp), Mycoplasma mycoides subspecies capri (Mmc), Mycoplasma putrefaciens (Mput), comprising;
a) forward primer set comprising SEQ ID7: 5’CAAAAAGARCGTGTTGGWCGTA3’;
b) reverse sequences comprising SEQ ID8: 5’CCAACAGCTGYAGCAATATC3’,
c) probe 1 sequences comprising SEQ ID9: FAM-CGTACTGAAATTGAAGAAG-BHQ1;, and
d) probe 1 a sequences comprising SEQ ID10: FAM-CGTACTGAAATTGAAGAAGTTTATKC-BHQ1
wherein the amplicon size is 91 bp.

Targeted Gene Sequences:
For FusA gene:
fusA elongation factor G [Mycoplasma capricolum subsp. capricolum ATCC 27343 ] - Gene ID: 23778894

Further to the above embodiment, the present invention provides a primer set for detection of 18S rRNA common to all Mycoplasma species, comprising;
a) forward primer set comprising SEQ ID11: 5’GGAGTATGGTTGCAAAGCTGA3’;
b) reverse sequences comprising SEQ ID12: 5’GGTGAGGTTTCCCGTGTTG3’
c) probe sequences comprising SEQ ID13: Cy5-AAGGAATTGACGGAAGGGCA-BHQ2;
d) probe sequence comprising SEQ ID14: HEX-AGGAATTGACGGAAGGGCA-BHQ1; and
e) probe sequence comprising SEQ ID No. 15 HEX-AAGGAATTGACGGAAGGG-BHQ1.

wherein the amplicon size is 100 bp.

For 18S:
Ovis aries 18S ribosomal RNA gene, complete sequence - GenBank: KY129860.1
In an embodiment, the present invention provides a kit for detection of Mycoplasma species including Mycoplasma agalactiae, Mycoplasma capricolum subspecies capripneumoniae (Mccp), Mycoplasma mycoides subspecies capri (Mmc), Mycoplasma putrefaciens (Mput).

In an advantageous embodiment, the present invention provides following benefits
Quick accurate results.
Highly sensitive.
Less sample quantity required.
Reduce the reaction time.

EXAMPLES
Several examples are set forth below to further illustrate the nature of the invention and the manner of carrying it out. However, the invention should not be considered as being limited to the details thereof.
Example 1:
Sr No Target Gene Primer / Probe Sequence Mycoplasma species Amplicon Size (bp)
1 polC gene Forward: SEQ ID 1: 5’GCRCATGCTACMGCTTATGT3’ Mycoplasma agalactiae (Mag) 80
Reverse: SEQ ID 2: 5’CTAGCATAAAATGCCAAAGGTTCA3’
Probe1-a: SEQ ID 3:
Texas Red-ATGGCACTATGAATAGC-BHQ2
Probe1-b: SEQ ID 4:
Texas Red-ATGGCACTATGAATAGCCT-BHQ2
Probe2-a: SEQ ID 5:
Cy5-AATGGCGCTATGAATAG-BHQ2
Probe2-b: SEQ ID 6:
Cy5-AATGGCGCTATGAATAGCCT-BHQ2
Target Gene Gene ID: 93357833
2 FusA gene Forward: SEQ ID 7: 5’CAAAAAGARCGTGTTGGWCGTA3’ Mycoplasma capricolum subspecies capripneumoniae (Mccp),
Mycoplasma mycoides subspecies capri (Mmc)
Mycoplasma putrefaciens (Mput) 91
Reverse: SEQ ID 8: 5’CCAACAGCTGYAGCAATATC3’
Probe 1: SEQ ID 9:
FAM-CGTACTGAAATTGAAGAAG-BHQ1

Probe 1a: SEQ ID 10:
FAM-CGTACTGAAATTGAAGAAGTTTATKC-BHQ1
Target Gene Gene ID: 23778894
3 18S rRNA Forward: SEQ ID 11: 5’GGAGTATGGTTGCAAAGCTGA3’ All Mycoplasma species 100
Reverse: SEQ ID 12: 5’GGTGAGGTTTCCCGTGTTG3’
Probe: SEQ ID 13:
Cy5-AAGGAATTGACGGAAGGGCA-BHQ2
SEQ ID 14: HEX-AGGAATTGACGGAAGGGCA-BHQ1SEQ ID 15 HEX-AAGGAATTGACGGAAGGG-BHQ1
Host GenBank: KY129860.1

The qPCR (RT-PCR) reaction can be set as
Initial denaturation : 95oC for 3 min
For 40 cycles follow the conditions as
Denaturation : 95oC for 15 Sec
Annealing : 60oC for 15 Sec
Repeat cycles : 39
Final Extension : 72 oC for 1 min
Storage : 4oC forever

Example 2:
Sample preparation for qPCR:
The standardization of qPCR protocol was done with different DNA samples such as synthetic DNA for the specific genes, DNA samples collected from field. The field samples were collected with sterile swabs from the animals and brought to laboratory in DNA transport medium. These are processed using different protocols as below:
Example 3:

qPCR from swab samples:
In total 20 nasal swab samples were collected from infected goats with runny nose. Out of twenty swabs samples 10 swabs were added to 1 ml of DNA transport medium and boiled directly for 5 minutes. It was then snap cooled on ice and centrifuged at 13000 RPM for 5 minutes. The supernatant was collected in fresh microcentrifuge tube and used directly for qPCR. The qPCR reaction volume was 20 µl and the reaction was set as below:
2x master mix : 10.0 µl
Forward primer (10 pmol/µl) : 01.0 µl
Reverse primer (10 pmol/µl) : 01.0 µl
Gene specific probe (10 pmol/µl) : 01.0 µl
DNA sample$ : 07.0 µl

$The input DNA can be increased if needed by using higher concentrations of primers and probes and by increasing the reaction final volume.
Another set of 10 swab samples were added to 500 µl of 1X Phosphate Buffer Saline (pH 7.4). The DNA isolation was done using QIAamp DNA isolation kit (Qiagen) as per manufacturers instructions and was used for qPCR. For the gene specific qPCR, the reaction volume was set to 20 µl as below:
2x master mix : 10.0 µl
Forward primer (10 pmol/µl) : 01.0 µl
Reverse primer (10 pmol/µl) : 01.0 µl
Gene specific probe (10 pmol/µl) : 01.0 µl
DNA sample* : 07.0 µl

*Maximum volume which can be adjusted (decreased) with nuclease free water if needed.

For multiplex qPCR reaction volume was 25 µl. The Primer cocktail, Probe cocktail were prepared separately and the reaction was set as below:

Example 4:
Primer Cocktail (20 pmol/µl):
The concentration primer stock solution used to prepare the primer cocktail was 20 pmol/µl. Equal volume of each primer was added to prepare the Primer Cocktail as below:
Forward primer for Pol C gene : 20 µl
Reverse primer for Pol C gene : 20 µl
Forward primer for Fus A gene : 20 µl
Reverse primer for Fus A gene : 20 µl
Forward primer for 18S rRNA gene: 20 µl
Reverse primer for 18S rRNA gene : 20 µl

Probe Cocktail (20 pmol/µl):
The concentration probe stock solution used to prepare the probe cocktail was 20 pmol/µl. Equal volume of each probe was added to prepare the Probe Cocktail as below:
Probe for Pol C gene : 20 µl
Probe for Fus A gene : 20 µl
Probe for 18S rRNA gene : 20 µl

The qPCR reaction was set as below with reaction volume of 25 µl.

2x master mix : 12.5 µl
Primer cocktail (20 pmol/µl) : 03.0 µl
Probe cocktail (20 pmol/µl) : 01.5 µl
DNA sample : 08.0 µl

Example 5:
qPCR from synthetic DNA for specific genes:
The synthetic DNA were used as per the sequence given in Table 1. The qPCR was set up using PCR master mix with 1 pmol/µl of synthetic DNA separately for each gene and together as multiplex PCR. The qPCR reaction volume was 20 µl and the reaction was set as below:
2x master mix : 10.0 µl
Forward primer (10 pmol/µl) : 01.0 µl
Reverse primer (10 pmol/µl) : 01.0 µl
Gene specific probe (10 pmol/µl) : 01.0 µl
Gene specific Synthetic DNA (1 pmol/µl) : 01.0 µl
Nuclease free water : 06.0 µl

Example 7:
For multiplex qPCR reaction the Primer cocktail, Probe cocktails as per Example 6. Gene specific synthetic DNA cocktail was prepared as below:

Gene Specific Synthetic DNA Cocktail (1 pmol/µl):
The concentration of gene specific synthetic DNA stock solution used to prepare the synthetic DNA cocktail was 1 pmol/µl. Equal volume of each synthetic DNA was added to prepare the cocktail as below:
Synthetic DNA for Pol C gene : 20 µl
Synthetic DNA for Fus A gene : 20 µl
Synthetic DNA for 18S rRNA gene : 20 µl

The qPCR reaction was set as below with reaction volume of 25 µl.

2x master mix : 12.5 µl
Primer cocktail (20 pmol/µl) : 03.0 µl
Probe cocktail (20 pmol/µl) : 01.5 µl
Synthetic DNA cocktail (1 pmol/µl) : 03.0 µl
Nuclease free water : 05.0 µl
,CLAIMS:1. A composition for detecting polC gene and FusA gene in a pathological sample for detection of Mycoplasma, wherein the composition comprises:
a. a forward primer;
b. a reverse primer, and
c. a probe sequence.

2. The composition as claimed in claim 1, wherein the composition for detecting polC gene comprises of,
a. forward primer set comprising sequence of SEQ ID1;
b. reverse primer set comprising sequence of SEQ ID2;
c. probe1-a sequences comprising sequence of SEQ ID3,
d. probe1-b sequences comprising sequence of SEQ ID4;
e. probe2-a sequences comprising sequence of SEQ ID5, and
f. probe2-b sequences comprising sequence of SEQ ID6.

3. The composition as claimed in claim 2, wherein the composition is for detecting Mycoplasma agalactiae.

4. The composition as claimed in claim 1, wherein the composition for detecting FusA gene comprises of,
a) forward primer set comprising SEQ ID7;
b) reverse sequences comprising SEQ ID8,
c) probe 1 sequences comprising SEQ ID9, and
d) probe 1 a sequences comprising SEQ ID10.

5. The composition as claimed in claim 4, wherein the composition is for detecting Mycoplasma capricolum subspecies capripneumoniae (Mccp), Mycoplasma mycoides subspecies capri (Mmc), Mycoplasma putrefaciens (Mput).

6. The composition as claimed in claim 1, wherein the composition for detecting 18S rRNA of host bearing GENE ID KY129860.1, comprising;
a) forward primer set comprising SEQ ID11;
b) reverse sequences comprising SEQ ID12;
c) probe sequences comprising SEQ ID13;
d) probe sequence comprising SEQ ID14; and
e) probe sequence comprising SEQ ID15.

7. The composition as claimed in claim 1, wherein the probe is targeted to the sequence of the conserved region of the Mycoplasma selected from Gene ID: 23778894 and Gene ID: 93357833.

8. A kit for detecting Mycoplasma in ruminant animals, comprising
a. a Primer cocktail; and
b. a Probe cocktail.

9. The kit as claimed in claim 7, wherein the primer cocktail comprises of,
a. Forward primer for Pol C gene : 20 µl
b. Reverse primer for Pol C gene : 20 µl
c. Forward primer for Fus A gene : 20 µl
d. Reverse primer for Fus A gene : 20 µl
e. Forward primer for 18S rRNA gene: 20 µl
f. Reverse primer for 18S rRNA gene: 20 µl

10. The kit as claimed in claim 7, wherein the probe cocktail comprises of,
a. Probe for Pol C gene : 20 µl
b. Probe for Fus A gene : 20 µl
c. Probe for 18S rRNA gene : 20 µl

11. The kit as claimed in claim 7, wherein the targeted sequence is the conserved region of the Mycoplasma as shown in Gene ID: 23778894 and Gene ID: 93357833

Documents

Application Documents

# Name Date
1 202421063959-STATEMENT OF UNDERTAKING (FORM 3) [23-08-2024(online)].pdf 2024-08-23
2 202421063959-PROVISIONAL SPECIFICATION [23-08-2024(online)].pdf 2024-08-23
3 202421063959-FORM FOR SMALL ENTITY(FORM-28) [23-08-2024(online)].pdf 2024-08-23
4 202421063959-FORM FOR SMALL ENTITY [23-08-2024(online)].pdf 2024-08-23
5 202421063959-FORM 1 [23-08-2024(online)].pdf 2024-08-23
6 202421063959-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [23-08-2024(online)].pdf 2024-08-23
7 202421063959-EVIDENCE FOR REGISTRATION UNDER SSI [23-08-2024(online)].pdf 2024-08-23
8 202421063959-Proof of Right [10-09-2024(online)].pdf 2024-09-10
9 202421063959-FORM-26 [10-09-2024(online)].pdf 2024-09-10
10 202421063959-FORM-5 [22-08-2025(online)].pdf 2025-08-22
11 202421063959-DRAWING [22-08-2025(online)].pdf 2025-08-22
12 202421063959-COMPLETE SPECIFICATION [22-08-2025(online)].pdf 2025-08-22
13 202421063959-FORM-9 [26-08-2025(online)].pdf 2025-08-26
14 202421063959-MSME CERTIFICATE [28-08-2025(online)].pdf 2025-08-28
15 202421063959-FORM28 [28-08-2025(online)].pdf 2025-08-28
16 202421063959-FORM 18A [28-08-2025(online)].pdf 2025-08-28