Sign In to Follow Application
View All Documents & Correspondence

Portable Food Borne Allergen Detector

Abstract: The present invention discloses a portable, pocket size detector to detect food borne allergens and to generate the data therein. The detector (1) comprises of a housing containing an absorbent pad (10) at its bottom; a processor (20); a display (30); and plurality of indicators (41,42). The present invention further discloses a method of detecting food borne allergens and generating the data therein.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
19 February 2024
Publication Number
36/2025
Publication Type
INA
Invention Field
CHEMICAL
Status
Email
Parent Application

Applicants

Inkoolu Design private limited
Flat 102, Green city heights, Vadlapudi, Visakhapatnam - 530046 Andhra Pradesh India
Olemus Bioteck private limited
Door. no. 24 - 112-3/g2, Flat G-2, Srinidhi residency 2 Chinna ganthiada, Visakhapatnam - 530026, Andhra Pradesh India

Inventors

1. INKOOLU, Krishna sai
Flat 102, Green city heights, Vadlapudi, Visakhapatnam - 530046 Andhra Pradesh India
2. RAO, Kolla Venkata Atchuta
Door. no. 24 - 112-3/g2, Flat G-2, Srinidhi residency 2 Chinna ganthiada Visakhapatnam - 530026 Andhra Pradesh India

Claims

1. A portable detector (1) for detecting food borne allergens & generating data representing the same comprising: a housing; an absorbent pad (10) at a bottom end of the housing to be dipped into the food, the absorbent pad (10) being defined with a detection area (11) coated with metal nano-particles with selective aptamers, wherein the detection area (11) displays a colour change proportional to the concentration of the allergens; at least one sensor configured to detect the colour change in the detection area (11); a processor (20) configured to receive & store various data from the at least one sensor as well as from other devices, wherein the various data includes: (a) a concentration data representing the concentration of the allergens, and corresponding to the extent of colour change on the detection area, (b) a sensitivity data representing a persons sensitivity to specific allergens, (c) a consumable data representing the food with specific allergens allowed to be consumed by the person, wherein the consumable data includes a historical data representing the persons recorded data of consumed allergens to which the person is sensitive; plurality of indicators (41,42) configured to visually indicate acceptable level of allergens upon receiving signal from the at least sensors; and a display (30).

2. The detector as claimed in Claim 1, wherein the absorbent pad (10) is disposable.

3. The detector as claimed in Claim 1, wherein the aptamer is allergen sensitive.

4. The detector as claimed in Claim 1, wherein the aptamer are having a ssDNA sequence represented by SEQ ID No: 1.

5. The detector as claimed in Claim 1, wherein the aptamer represented by SEQ ID No: 1 specifically binds to lactose.

6. The detector as claimed in Claim 1, wherein the metal nano-particles are selected from a gold nanoparticles.

7. The detector as claimed in Claim 1, wherein the other devices include devices used by medical personnel.

8. The detector as claimed in Claim 1, wherein the plurality of indicators include a red indicator and a green indicator.

9. A method of detecting food based allergens & generating data representing the same by means of a portable detector (1) comprising: dipping an absorbent pad (10) in a food, wherein the absorbent pad (10) being defined with a detection area (11) coated with metal nano-particles with selective aptamers; detecting presence of the allergens by at least one sensor, wherein the sensor detects a colour change in the detection area (11) proportional to the concentration of the allergens; additionally visually indicating the acceptable level of the allergens in the food by means of plurality of indicators (41,42); and receiving & storing various data in a processor (20) from the at least one sensor as well as from other devices, wherein the various data includes: (a) a concentration data representing the concentration of the allergens, (b) a sensitivity data representing a persons sensitivity to specific allergens, (c) a consumable data representing the food with specific allergens is allowed to be consumed by the person

10. The method as claimed in Claim 9, wherein the method includes disposing the absorbent pad (10) after the use.

11. The method as claimed in Claim 9, wherein the aptamer is allergen sensitive.

12. The method as claimed in Claim 9, wherein the aptamer are having a ssDNA sequence represented by SEQ ID No: 1.

13. The method as claimed in Claim 9, wherein the aptamer represented by SEQ ID No: 1 specifically binds to lactose.

14. The method as claimed in Claim 9, wherein the metal nano-particles are selected from a gold nanoparticles.

15. The method as claimed in Claim 9, wherein the concentration data corresponds to the colour change on the detection area (11).

16. The method as claimed in Claim 9, wherein consumable data includes a historical data representing the persons recorded data of consumed allergens to which the person is sensitive.

17. The method as claimed in Claim 9, wherein the other devices include devices used by medical personnel.

18. The method as claimed in Claim 9, wherein the plurality of indicators (41,42) include a red indicator and a green indicator.

19. An aptamer of SEQ ID No: 1 for detecting food borne allergens selected from lactose.

20. The aptamere as claimed in Claim 19, wherein the SEQ ID No: 1 is 5'- GCTACGTCGTAGTACGACTAGCTAGCGTACGCTAGCTAGCGTACGCTAGCTAGC -3'.

Specification

Description:FIELD OF INVENTION:
[001] The present invention generally relates to detecting food based allergens. More particularly, the present invention relates to a portable, pocket size detector to detect allergens that mainly include lactose.

BACKGROUND & PRIOR ART:
[002] Hypersensitivity reactions, also known as allergic reactions, are exaggerated or abnormal immunological responses of the body to a substance that is typically harmless. The hypersensitivity could be immediate, i.e. occurring within 24 hours of ingestion, or delayed which take more than 24 hours to surface. These reactions can range from mild to severe, and can include symptoms such as itching, hives, difficulty breathing, and in severe cases, anaphylaxis. Some of the most common causes of hypersensitivity reactions include pollen, pet dander, or certain foods, and medications.
[003] The prevalence of allergies has been increasing in recent years, and it is now estimated that around 30% of the global population is affected by some form of allergy. The reason for this increase is not fully understood, but this rise is thought to be due to a combination of genetic and environmental factors. Allergies and allergic reactions can have a significant impact on a person's quality of life. Symptoms can range from mild to severe and can include itching, hives, difficulty breathing, and in severe cases, anaphylaxis. These symptoms can be debilitating and can affect a person's ability to work, study and carry out daily activities. Allergies and allergic reactions can also have a significant economic impact. The cost of treatment, including medications and hospital visits, can be significant. Additionally, allergies can also lead to lost productivity, as people may have to take time off work or school due to symptoms. Allergies and allergic reactions are not easily preventable or curable, and the cause of the increase in prevalence is not fully understood, which makes it a global problem statement. Overall, hypersensitivity reactions are a global problem because of their increasing prevalence.
[004] Amongst them is lactose hypersensitivity. Lactose hypersensitivity or intolerance is a condition where a person has a difficulty digesting a food containing lactose. This condition occurs due to deficiency of lactase, an enzyme present in the small intestine. A person suffering from lactose hypersensitivity may show symptoms of abdominal pain, nausea, vomiting, abdominal cramps. In some cultures, where milk based foods or products are key in daily dietary habits, the person having such sensitivity or intolerance for lactose may cause him / her a great deal.
[005] Some methods have been proposed for detection of the presence of lactose in foods. For example, CN104122250A discloses a method for rapid detection of lactose in milk, wherein the method is based on raman spectroscopy. In this method, the milk is mixed with a reference substance in certain mixture to obtain a raman spectroscopic data. Based on this data and its peak analysis, the presence of lactose is verified.
[006] However, such devices have certain disadvantages. The devices with raman spectroscopy requires sample preparation process and homogeneity of the sample for accurate detection, which may not be possible in wide varieties of food samples. Further, raman spectroscopy give out a relatively weak signal, which can limit its sensitivity for detecting low concentrations of lactose. This can be particularly challenging in complex matrices, such as food or biological samples, where other components may interfere with the Raman signal. Furthermore, to obtain accurate and reproducible results, samples may need to be carefully prepared, which can be time-consuming and require specialized expertise. Even further, raman spectroscopy may not be able to capture the full heterogeneity of a sample. This can be particularly challenging in complex matrices. Some materials can fluoresce when exposed to laser light, which can interfere with the Raman signal and make it more difficult to detect lactose.
[007] Another device such as “lactoscope” may also be used. But they are generally bulky, complex, requires experts for sample preparations for analysis and not suitable for home care or personal portable applications.
[008] “Lactosense” is a portable lactose detection and quantification biosensor works on amperometry with immobilized lactose bio-receptor on electrode chip. requires sample preparations with their provided buffers, linked with computer based results analysis and visualization that lacks the personal care ergonomics and have the challenges of enzyme based immobilization and interference like glucose and other polysaccharides with similar amperage. However, the lactosense may not be able to distinguish between lactose and other molecules that can be oxidized under similar conditions. This can lead to false positive or false negative results if there are other molecules present in the sample that can interfere with the measurement. The sensitivity of amperometry can be limited by several factors, including electrode surface area, sample volume, and electrode fouling. This can be particularly challenging when detecting low concentrations of lactose in complex matrices. Some materials, such as proteins and fats, can interfere with the electrochemical measurement of lactose by adsorbing onto the electrode surface and reducing the effective electrode area. This can lead to inaccurate measurements and reduced sensitivity. Further, the amperometry based device requires careful calibration to ensure accurate and reproducible measurements. This can be challenging if the lactose concentration in the sample is not well-characterized, or if the electrode surface area changes over time.
[009] Another device “Hydrogen Breath analyser” detects hydrogen exhaled by the person due to indigestion of lactose. But some individuals may not produce hydrogen gas even if they are unable to digest lactose properly, leading to false negative results. Additionally, hydrogen breath testing can be influenced by a variety of factors, including diet, medication, and the presence of other gastrointestinal disorders leading to the variability in results and making it difficult to interpret the test accurately. Further. hydrogen breath testing involves measuring the levels of hydrogen gas over a period of several hours. The interpretation of the test results may also be complex sometimes.
[010] Another device “food allergen detector” works on antibodies based testing, and may involve higher cost in manufacturing along with other issues such as sensitivity of the device, immobilization of the antibodies for multiple food allergens.
[011] Use of aptamers as food analytes is known in the literature. In a paper titled “In vitro selection of DNA aptamers targeting ß-lactoglobulin and their integration in graphene-based biosensor for the detection of milk allergen”, the authors have developed an aptamer / graphene-based electrochemical biosensor for on-step, sensitive and low cost detection of ß-lactoglobulin (ß-LG) milk protein. The aptamer is integrated in a voltammetric biosensor utilizing graphene-modified screen printed carbon electrodes. The binding is monitored by following the change in the square wave voltammetry (SWV) reduction peak signal of ferrocyanide / ferricyanide redox couple due to the removal of the negatively charged aptamers from the surface upon protein binding. This one-step "signal on" biosensor takes 20 min for the sensitive and selective detection of ß-LG without using any labelling or sophisticated designs.
[012] US20210063395 relates to detecting a food-borne analyte, wherein the sensor comprising a photoluminescent matrix-material (PMM) and an analyte-specific aptamer (ASA), wherein the PMM is configured to change a photoluminescent property when a binding event occurs between the sensor and the food-borne analyte.
[013] There is a need of an efficient point of care device, which is capable of quickly detecting presence of specified allergens, with other added features and advantages.

SUMMARY OF THE INVENTION:
[014] It is an object of the invention to detect food based allergens that may be injurious to health of a person.
[015] It is a primary object of the invention to disclose a portable, pocket sized detector to detect lactose content in food.
[016] It is another object of the invention in which the detector is adapted to store data related to consumable threshold value pertaining to the allergens, and a historical data representing the consumed allergens.
[017] It is a yet another object of the invention to indicate whether a person should consume the food having lactose content, and the quantity allowed to be consumed.
[018] Accordingly, a portable detector for detection of food borne allergens is disclosed herein.
[019] The portable detector comprises of a housing; an absorbent pad at a bottom end of the housing to be dipped into the food; at least one sensor, a processor; a display; and plurality of indicators to visually convey the presence of the allergens in the food.
[020] In the same embodiment, the absorbent pad is defined with a detection area coated with metal nano-particles with selective aptamers. The detection area (11) undergoes a colour change proportional to the concentration of the allergens due to reaction of the aptamers with the allergens.
[021] In the same embodiment, a sensor is provided to detect the change in colour at the absorbent pad. The sensor is configured to detect the amount of change in colour and transmit the same to the processor.
[022] The processor configured to receive & store various data from the at least one sensor as well as from other devices. The various data includes a concentration data representing the concentration of the allergens, a sensitivity data representing a person’s sensitivity to specific allergens, a consumable data representing the food with specific allergens is allowed to be consumed by the person.
[023] In the same embodiment, the aptamer is a ssDNA sequence represented by SEQ ID No: 1.
[024] In the same embodiment, the aptamer represented by SEQ ID No: 1 which specifically binds to lactose.
[025] In the same embodiment, the SEQ ID No:1 comprises the following sequence:
5'- GCTACGTCGTAGTACGACTAGCTAGCGTACGCTAGCTAGCGTACGCTAGCTAGC -3'.
[026] The present invention further discloses a method detecting food based allergens & generating data representing the same by means of a portable detector.
[027] The method comprises dipping an absorbent pad in a food; detecting presence of the allergens; additionally indicating visually the presence of the allergens in the food by means of plurality of indicators; generating a threshold data representing threshold value of the allergens allowed to be consumed for the user by means of a processor; and generating a historical data representing the amount of allergens consumed by means of the processor.
[028] In the same embodiment, the absorbent pad is defined with a detection area coated with metal nano-particles with selective aptamers. Further, the detection area induces a colour change proportional to the concentration of the allergens.

BRIED DESCRIPTION OF DRAWINGS:
[029] Following figures illustrate working mode of the invention.
Figure 1 illustrates a portable lactose hypersensitivity detector.
Figure 2 illustrates a colour change associated with a concentration of allergens.

DETAILED DESCRIPTION OF THE INVENTION:
[030] The figures appended at the end of the specification represent specific working embodiments, including the alternate/secondary embodiments, of the present invention. With reference to these figures, the present invention may be comprehended. However, the figures do not limit the scope of the present invention. Any variations that do not depart from the embodiments may be envisaged, though not specifically stated.
[031] Referring to figures, a portable detector (1) for detecting food borne allergens & generating data representing the same is disclosed herein. It comprises a housing; an absorbent pad (10) at a bottom end of the housing to be dipped into the food, the absorbent pad (10) being defined with a detection area (11) coated with metal nano-particles with selective aptamers, wherein the detection area (11) shows a colour change proportional to the concentration of the allergens; at least one sensor configured to detect the colour change in the detection area (11); a processor (20) configured to receive & store various data from the at least one sensor as well as from other devices; plurality of indicators (41,42) configured to visually indicate acceptable level of allergens upon receiving signal from the at least sensors; and a display (30).
[032] In an embodiment, the various data includes: (a) a concentration data representing the concentration of the allergens, (b) a sensitivity data representing a persons sensitivity to specific allergens, (c) a consumable data representing the food with specific allergens is allowed to be consumed by the person. The consumable data includes a historical data representing the persons recorded data of consumed allergens to which the person is sensitive.
[033] The processor (20) may be any data receiving and storage device, implementing methods of real time data acquisition, or artificial intelligence methods etc.
[034] The aptamers herein are fluorescent tagged, which induce colour change upon reaction with the allergens. The selection of aptamers may be made based on which allergens are to be detected. The aptamer is a ssDNA sequence represented by SEQ ID No: 1.
[035] In the same embodiment, the aptamer represented by SEQ ID No: 1 which specifically binds to lactose.
[036] In the same embodiment, the SEQ ID No:1 comprises the following sequence:
5'- GCTACGTCGTAGTACGACTAGCTAGCGTACGCTAGCTAGCGTACGCTAGCTAGC -3'.
[037] In an embodiment, the aptamers are extracted by SELEX method and can be mass produced by recombinant DNA technology over host organisms for ready availability of the bioreceptors.
[038] The portable detector (1) described in this specification is capable of outputting instant result regarding the presence of the allergens. The detector (1) is further capable of generating the data relating to presence of allergens as well as the customized data as to acceptable limits of allergens may be consumed.
[039] The portable detector (1) is also advantageous for its pocket size.
[040] The present invention further discloses a method of detecting food based allergens & generating data representing the same by means of a portable detector (1). The method comprises dipping an absorbent pad (10) in a food, wherein the absorbent pad (10) being defined with a detection area (11) coated with metal nano-particles with selective aptamers; detecting presence of the allergens by at least one sensor, wherein the sensor detects a colour change in the detection area (11) proportional to the concentration of the allergens; additionally visually indicating the acceptable level of the allergens in the food by means of plurality of indicators (41,42); and receiving & storing various data in a processor (20) from the at least one sensor as well as from other devices.
[041] The various data includes: a concentration data representing the concentration of the allergens, a sensitivity data representing a persons sensitivity to specific allergens, a consumable data representing the food with specific allergens is allowed to be consumed by the person.
[042] While obtaining the concentration data, the sensor or the sensor system first detects the colour change on the detection area, due to the reaction between the ingredients and the coated material on the detection. The concentration of the allergens is determined by the sensor system depending upon the extent of the colour change. This data is sent to the processor.
[043] The sensor is calibrated and trained with the data of lactose tolerances on most common case scenarios. Prior to use the device is calibrated and personalized according the user case sheet with respect to levels of hypersensitivity and the threshold values are defined accordingly. The processor also learns and records the food habits, through computational methods, to enhance the results.
[044] The sensor for the purpose of detection of change in colour, or more specifically, the amount of change of colour may be any sensor selected from the RGB sensor, the spectrum sensor, the CMOS sensor. However, the type of the sensor is not restricted to the aforesaid categories. Any sensor suitable for the detection of change in colour, or more specifically, the amount of change of colour may be employed herein.
[045] The aptamers herein are fluorescent tagged, which induce colour change upon reaction with the allergens. The selection of aptamers may be made based on which allergens are to be detected. The aptamer is a ssDNA sequence represented by SEQ ID No: 1.
[046] In the same embodiment, the aptamer represented by SEQ ID No: 1 which specifically binds to lactose.
[047] In the same embodiment, the SEQ ID No:1 comprises the following sequence:
5'- GCTACGTCGTAGTACGACTAGCTAGCGTACGCTAGCTAGCGTACGCTAGCTAGC -3'.
[048] The metal nanoparticles are selected from gold nano particles, which are prepared by standard Turkevich method and seed mediated methods, and were subjected to incubation with aptamers specific for lactose with a chromogenic label. This mixture is spray coated on nitrocellulose strip.
[049] Figure 2 illustrates a colour change of gold nono-particles associated with a concentration of allergens, specifically with lactose. The leftmost image with minimal colour change shows absence of lactose. The gradual colour change of the gold non-particles occurs with increased concentration (0-1000 nM) of lactose specific aptamers. This colour change is detected by the sensor which compares the detected data with the calibration data to determine the concentration of lactose specific aptamers.
[050] The preferred embodiment of the present invention is for detection of lactose hypersensitivity and generating data thereof. However, the use of the present invention is not restricted to the detection of lactose in the food and may be extended for detection of any kind of food borne allergens.
[051] The present device has extended applications. For example, the sensor is configured to detect wide varieties of allergens by the specific colour change over the sensing strip. Thus the sensing strip which is an external reaction module is configured to have multi allergen sensitive aptamers conjugated with metal nanoparticles as bio-recptors to detect them. Thus the sensor can sense wide
varieties of allergens in food products and biological samples like serum, blood, sweat, saliva, sputum etc by using their specific lateral flow assay strips.
[052] Further, a detection of dust and chemical allergy is possible using the present device. These allergies are caused mostly by molds, dust mite proteins, pollen and chemicals. Most common allergens are screened of their protein structure and immune eliciting components. The target receptors are developed through aptamers and coated with different sizes of nanoparticles by self assembled mono layer method to give specific colour signal for respective allergen.
[053] Furthermore, detection of inflammations is possible through the use of the present device. The inflammations are the immune responses to allergens with post exposure. The immune components like interleukins, cytokines, macrophages act as good biomarkers in case of allergic conditions as they are expresses with respect to the antigens/allergens. These helps in detecting the range and severeness of the allergies and detected by the ESR,CRP, TNF etc analytical methods by ELISA, blotting and SDS, these inflammatory biomarkers can be coated over the lateral flow assay strip of the sensor to detect the type of inflammations and severity by colour correlation in both qualitatively and quantitatively.
[054] Advantages of the invention:
1. The present device is a tiny, portable, pocket size device. This is useful not just for a medical personnel but for a person who is allergic to certain foods.
2. The user can test the content qualitatively as well as quantitatively and can adjust or avoid the ingredients causing allergy containing food in the diet.
3. The device not just indicates the presence of a particular ingredient to which a user is allergic, but also indicates the amount of the ingredients. Hence, if the user is allowed to consume a certain level of that particular ingredient, he/she can have the assessment regarding the same.
, Claims:1. A portable detector (1) for detecting food borne allergens & generating data representing the same comprising:
a housing;
an absorbent pad (10) at a bottom end of the housing to be dipped into the food, the absorbent pad (10) being defined with a detection area (11) coated with metal nano-particles with selective aptamers, wherein the detection area (11) displays a colour change proportional to the concentration of the allergens;
at least one sensor configured to detect the colour change in the detection area (11);
a processor (20) configured to receive & store various data from the at least one sensor as well as from other devices, wherein the various data includes:
(a) a concentration data representing the concentration of the allergens, and corresponding to the extent of colour change on the detection area,
(b) a sensitivity data representing a persons sensitivity to specific allergens,
(c) a consumable data representing the food with specific allergens allowed to be consumed by the person, wherein the consumable data includes a historical data representing the persons recorded data of consumed allergens to which the person is sensitive;
plurality of indicators (41,42) configured to visually indicate acceptable level of allergens upon receiving signal from the at least sensors;
and
a display (30).
2. The detector as claimed in Claim 1, wherein the absorbent pad (10) is disposable.
3. The detector as claimed in Claim 1, wherein the aptamer is allergen sensitive.
4. The detector as claimed in Claim 1, wherein the aptamer are having a ssDNA sequence represented by SEQ ID No: 1.
5. The detector as claimed in Claim 1, wherein the aptamer represented by SEQ ID No: 1 specifically binds to lactose.
6. The detector as claimed in Claim 1, wherein the metal nano-particles are selected from a gold nanoparticles.
7. The detector as claimed in Claim 1, wherein the other devices include devices used by medical personnel.
8. The detector as claimed in Claim 1, wherein the plurality of indicators include a red indicator and a green indicator.
9. A method of detecting food based allergens & generating data representing the same by means of a portable detector (1) comprising:
dipping an absorbent pad (10) in a food, wherein the absorbent pad (10) being defined with a detection area (11) coated with metal nano-particles with selective aptamers;
detecting presence of the allergens by at least one sensor, wherein the sensor detects a colour change in the detection area (11) proportional to the concentration of the allergens;
additionally visually indicating the acceptable level of the allergens in the food by means of plurality of indicators (41,42); and
receiving & storing various data in a processor (20) from the at least one sensor as well as from other devices, wherein the various data includes:
(a) a concentration data representing the concentration of the allergens,
(b) a sensitivity data representing a persons sensitivity to specific allergens,
(c) a consumable data representing the food with specific allergens is allowed to be consumed by the person
10. The method as claimed in Claim 9, wherein the method includes disposing the absorbent pad (10) after the use.
11. The method as claimed in Claim 9, wherein the aptamer is allergen sensitive.
12. The method as claimed in Claim 9, wherein the aptamer are having a ssDNA sequence represented by SEQ ID No: 1.
13. The method as claimed in Claim 9, wherein the aptamer represented by SEQ ID No: 1 specifically binds to lactose.
14. The method as claimed in Claim 9, wherein the metal nano-particles are selected from a gold nanoparticles.
15. The method as claimed in Claim 9, wherein the concentration data corresponds to the colour change on the detection area (11).
16. The method as claimed in Claim 9, wherein consumable data includes a historical data representing the persons recorded data of consumed allergens to which the person is sensitive.
17. The method as claimed in Claim 9, wherein the other devices include devices used by medical personnel.
18. The method as claimed in Claim 9, wherein the plurality of indicators (41,42) include a red indicator and a green indicator.
19. An aptamer of SEQ ID No: 1 for detecting food borne allergens selected from lactose.
20. The aptamere as claimed in Claim 19, wherein the SEQ ID No: 1 is 5'- GCTACGTCGTAGTACGACTAGCTAGCGTACGCTAGCTAGCGTACGCTAGCTAGC -3'.

Documents

Application Documents

# Name Date
1 202441011470-STATEMENT OF UNDERTAKING (FORM 3) [19-02-2024(online)].pdf 2024-02-19
3 202441011470-Sequence Listing in txt [19-02-2024(online)].txt 2024-02-19
4 202441011470-Sequence Listing in PDF [19-02-2024(online)].pdf 2024-02-19
5 202441011470-FORM 1 [19-02-2024(online)].pdf 2024-02-19
6 202441011470-DRAWINGS [19-02-2024(online)].pdf 2024-02-19
7 202441011470-DECLARATION OF INVENTORSHIP (FORM 5) [19-02-2024(online)].pdf 2024-02-19
8 202441011470-COMPLETE SPECIFICATION [19-02-2024(online)].pdf 2024-02-19
9 202441011470-Proof of Right [28-02-2024(online)].pdf 2024-02-28
10 202441011470-FORM-26 [28-02-2024(online)].pdf 2024-02-28