Abstract: ABSTRACT CALCIUM ATPASE MODULATION FOR CANCER IMMUNOTHERAPY, COMPOSITIONS, METHODS AND KITS THEREFOR The present disclosure provides a pharmaceutical composition/combination for treating cancer, comprising a PMCA (plasma membrane Ca2+-ATPase) 5 inhibitor, or PMCA (plasma membrane Ca2+-ATPase) inhibitor and a SERCA (Sarco/Endoplasmic Reticulum Ca2+-ATPase) inhibitor; and a pharmaceutically acceptable carrier. The disclosure also provides a kit for treating cancer comprising a PMCA (plasma membrane Ca2+-ATPase) inhibitor, or PMCA (plasma membrane Ca2+-ATPase) 10 inhibitor and a SERCA (Sarco/Endoplasmic Reticulum Ca2+-ATPase) inhibitor. Methods of enhancing T cell activity, or treating cancer in a subject. 54
1. A pharmaceutical composition for treating cancer, comprising a PMCA (plasma membrane Ca2+-ATPase) inhibitor and a pharmaceutically acceptable carrier.
2. The pharmaceutical composition as claimed in claim 1, further 5 comprising a SERCA (Sarco/Endoplasmic Reticulum Ca2+-ATPase) inhibitor.
3. The pharmaceutical composition as claimed in claim 1, wherein the PMCA inhibitor inhibits PMCA1, PMCA4, or both, and wherein the PMCA inhibitor is selected from a peptide inhibitor; a small molecule inhibitor; a nucleic acid 10 inhibitor; or a combination thereof.
4. The pharmaceutical composition as claimed in claim 3, wherein the peptide inhibitor comprises a peptide having an amino acid sequence of at least 90% sequence identity to a sequence selected from a group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID 15 NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, and SEQ ID NO. 20; or wherein the nucleic acid inhibitor is an shRNA comprising a nucleotide sequence of at least 80% identity to a sequence selected from a group consisting of SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, ID NO. 12, and 20 SEQ ID NO. 13.
5. The pharmaceutical composition as claimed in claim 1, wherein the SERCA inhibitor is selected from thapsigargin, cyclopiazonic acid, 2,5-di-tertbutylhydroquinone (DBHQ), Mipsagargin, Casearin J, or a derivative thereof. 46
6. The pharmaceutical composition as claimed in claim 1, wherein the pharmaceutically acceptable carrier is selected from aqueous vehicles; sugars or sugar alcohols; starches or cellulose derivatives; proteins or polymers; lipids; surfactants; preservatives; antioxidants; pH adjusting agents; tonicity adjusting agents; chelating agents; viral vectors; non-viral delivery 5 systems, or combination thereof.
7. The pharmaceutical composition as claimed in claim 2, wherein the PMCA inhibitor and the SERCA inhibitor are present at a molar ratio in the range of 500:1 to 10000:1, preferably 5000:1, or wherein the PMCA inhibitor is present 10 at a weight percentage in the range of 0.002% to 0.04% w/w and the SERCA inhibitor is present at a weight percentage in the range of 5 x 10-7 % to 2 x 10-4 % w/w, in respect of the total composition.
8. A kit for treating cancer, said kit comprising a PMCA (plasma membrane Ca2+-ATPase) inhibitor; and optionally, a SERCA (Sarco/Endoplasmic 15 -ATPase) inhibitor.
9. The kit as claimed in claim 8, wherein the PMCA inhibitor and the SERCA inhibitor are present in a single pharmaceutical composition.
10. The kit as claimed in claim 8, wherein the PMCA inhibitor is selected from a peptide inhibitor; a small molecule inhibitor; a nucleic acid inhibitor; or 20 combination thereof.
11. The kit as claimed in claim 8, wherein said peptide inhibitor comprises a peptide having an amino acid sequence of at least 90% sequence identity to a sequence selected from a group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 47 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20 or wherein the nucleic acid inhibitor is an shRNA comprising a nucleotide sequence of at least 80% identity to a sequence selected from a group consisting of SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, 5 and SEQ ID NO. 13.
12. The kit as claimed in claim 8, wherein the PMCA inhibitor and the SERCA inhibitor are present at a molar ratio of 500:1 to 10000:1, preferably 5000:1.
13. The kit as claimed in claim 8, wherein the kit further comprises a therapeutic agent selected from an immune checkpoint inhibitor, vascular endothelial 10 growth factor (VEGF) neutralizing agent, a chemotherapeutic drug, poly ADPribose polymerase (PARP) inhibitor, Transforming growth factor beta (TGF-) inhibitor, lipid inhibitor, adoptive T cell, or a combination thereof.
14. The kit as claimed in claim 13, wherein the immune checkpoint inhibitor is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a CD39 15 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT inhibitor, a CD36 inhibitor, or combination thereof; wherein the VEGF neutralizing agent is an anti-VEGF antibody or anti-VEGF receptor antibody, wherein the VEGF neutralizing agent is selected from Bevacizumab, Ramucirumab, Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib, or 20 combination thereof; wherein the chemotherapeutic drug is selected from Paclitaxel, Carboplatin, Doxorubicin, Topotecan, Gemcitabine, or combination thereof; wherein the PARP inhibitor is selected from Olaparib, Niraparib, Rucaparib, Talazoparib, or combination thereof; wherein the TGF beta inhibitor is selected from Galunisertib, HYL001, Vactosertib, SB-431542, 48 Fresolimumab, AVID200, LY2109761, Pirfenidone, Losartan, Ker-050, or combination thereof; or wherein the lipid inhibitor is selected from Denifanstat, Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline, Ranolazine, simvastatin, atorvastatin, Edelfosine, Miltefosine, and combination 5 thereof.
15. A method of enhancing T cell activity, comprising contacting the T cell with a PMCA inhibitor; or a combination comprising a PMCA inhibitor and a SERCA inhibitor.
16. The method as claimed in claim 15, comprising contacting the T cell with the 10 pharmaceutical composition comprising a PMCA inhibitor, as claimed in claim 1 or 2; or a combination comprising a PMCA inhibitor and a SERCA inhibitor.
17. The method as claimed in claim 15, wherein said method comprises contacting the T cell with a therapeutic agent selected from an immune checkpoint inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a PARP 15 inhibitor, a TGF beta inhibitor, a lipid inhibitor, adoptive T cell, or combination thereof.
18. The method as claimed in claim 15, wherein the PMCA inhibitor and the SERCA inhibitor are provided in a single composition or separate composition.
19. The method as claimed in claim 15, wherein the PMCA inhibitor is selected 20 from a peptide inhibitor; a small molecule inhibitor; a nucleic acid inhibitor; or combination thereof.
20. The method as claimed in claim 19, wherein said peptide inhibitor comprises a peptide having an amino acid sequence of at least 90% sequence identity to a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ 49 ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20; or wherein the nucleic acid inhibitor is an shRNA comprising a nucleotide sequence of at least 80% identity to a sequence selected from a group consisting of SEQ ID NO. 5 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 13, or wherein the SERCA inhibitor is selected from thapsigargin, cyclopiazonic acid, DBHQ, Mipsagargin, Casearin J, or a derivative thereof.
21. The method as claimed in claim 17, wherein the immune checkpoint inhibitor 10 is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a CD39 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT inhibitor, a CD36 inhibitor, or combination thereof; wherein the VEGF neutralizing agent is an anti-VEGF antibody or anti-VEGF receptor antibody, wherein the VEGF neutralizing agent is selected from Bevacizumab, 15 Ramucirumab, Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib, or combination thereof; wherein the chemotherapeutic drug is selected from Paclitaxel, Carboplatin, Doxorubicin, Topotecan, Gemcitabine, or combination thereof; wherein the PARP inhibitor is selected from Olaparib, Niraparib, Rucaparib, Talazoparib, or combination thereof; wherein the TGF beta 20 inhibitor is selected from Galunisertib, HYL001, Vactosertib, SB-431542, Fresolimumab, AVID200, LY2109761, Pirfenidone, Losartan, Ker-050, or combination thereof; or wherein the lipid inhibitor is selected from Denifanstat, Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline, 50 Ranolazine, simvastatin, atorvastatin, Edelfosine, Miltefosine, and combination thereof.
22. A method of treating cancer in a subject, comprising administering to the subject a PMCA inhibitor; or a combination comprising a PMCA inhibitor and 5 a SERCA inhibitor.
23. The method as claimed in claim 22, comprising administering to the subject the pharmaceutical composition comprising a PMCA inhibitor, as claimed in claim 1 or 2; or combination comprising a PMCA inhibitor and a SERCA inhibitor.
24. The method as claimed in claim 22, wherein said method further comprises 10 administering to the subject a therapeutic agent selected from an immune checkpoint inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a PARP inhibitor, a TGF beta inhibitor, a lipid inhibitor, adoptive T cell, or combination thereof
25. The method as claimed in claim 22, wherein the PMCA inhibitor and the 15 SERCA inhibitor are administered as a single composition or separate composition.
26. The method as claimed in claim 22, wherein the PMCA inhibitor is peptide inhibitor comprising a peptide having an amino acid sequence of at least 90% sequence identity to a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, 20 SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20, or wherein said PMCA inhibitor is a nucleic acid inhibitor comprising a nucleotide sequence of 51 at least 80% identity to a sequence selected from a group consisting of SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 13.
27. The method as claimed in claim 22, wherein the SERCA inhibitor is selected from thapsigargin, cyclopiazonic acid, DBHQ, Mipsagargin, Casearin J or a derivative 5 thereof.
28. The method as claimed in claim 22, wherein the immune checkpoint inhibitor is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a CD39 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT inhibitor, a CD36 inhibitor, or combination thereof; wherein the anti-VEGF or 10 anti-VEGF receptor antibody is selected from Bevacizumab, Ramucirumab, Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib or combination thereof; wherein the chemotherapeutic drug is selected from Paclitaxel, Carboplatin, Doxorubicin, Topotecan, Gemcitabine or combination thereof; wherein the PARP inhibitor is selected from Olaparib, Niraparib, Rucaparib, 15 Talazoparib or combination thereof; wherein the TGF beta inhibitor is selected from Galunisertib, HYL001, Vactosertib, SB-431542, Fresolimumab, AVID200, LY2109761, Pirfenidone, Losartan, Ker-050 or combination thereof; or wherein the lipid inhibitor is selected from Denifanstat, Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline, Ranolazine, 20 simvastatin, atorvastatin, Edelfosine, Miltefosine and combination thereof.
29. The method as claimed in claim 22, wherein the cancer is selected from the group consisting of ovarian cancer, colorectal cancer, melanoma, breast cancer, lung cancer, pancreatic cancer, prostate cancer, gastric cancer, liver cancer, 52 renal cancer, bladder cancer, head and neck cancer, glioblastoma, esophageal cancer, cervical cancer, endometrial cancer, and hematological malignancies.
30. The method as claimed in claim 22, wherein said administering is performed by intraperitoneal, intratumoral, intravenous, intradermal, intramuscular, subcutaneous and/or oral 5 administration.
31. A process for preparing the pharmaceutical composition as claimed in claim 1, comprising mixing a PMCA inhibitor and a pharmaceutically acceptable carrier; and optionally mixing a SERCA inhibitor, to obtain the pharmaceutical composition. 10 32. A PMCA inhibitor for use in treating cancer in a subject, or for enhancing T cell activity.
33. A combination comprising a PMCA inhibitor and a SERCA inhibitor for treating cancer in a subject, or for enhancing T cell activity.
34. The combination, as claimed in claim 33, further comprising a therapeutic agent 15 selected from an immune checkpoint inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a PARP inhibitor, a TGF beta inhibitor, a lipid inhibitor, adoptive T cell, or combination thereof. 53 ABSTRACT CALCIUM ATPASE MODULATION FOR CANCER IMMUNOTHERAPY, COMPOSITIONS, METHODS AND KITS THEREFOR The present disclosure provides a pharmaceutical composition/combination for treating cancer, comprising a PMCA (plasma membrane Ca2+-ATPase) 5 inhibitor, or PMCA (plasma membrane Ca2+-ATPase) inhibitor and a SERCA (Sarco/Endoplasmic Reticulum Ca2+-ATPase) inhibitor; and a pharmaceutically acceptable carrier. The disclosure also provides a kit for treating cancer comprising a PMCA (plasma membrane Ca2+-ATPase) inhibitor, or PMCA (plasma membrane Ca2+-ATPase) 10 inhibitor and a SERCA (Sarco/Endoplasmic Reticulum Ca2+-ATPase) inhibitor. Methods of enhancing T cell activity, or treating cancer in a subject. 54 , Claims:I/We Claim:
1. A pharmaceutical composition for treating cancer, comprising a PMCA (plasma membrane Ca2+-ATPase) inhibitor and a pharmaceutically acceptable carrier.
2. The pharmaceutical composition as claimed in claim 1, further 5 comprising a SERCA (Sarco/Endoplasmic Reticulum Ca2+-ATPase) inhibitor.
3. The pharmaceutical composition as claimed in claim 1, wherein the PMCA inhibitor inhibits PMCA1, PMCA4, or both, and wherein the PMCA inhibitor is selected from a peptide inhibitor; a small molecule inhibitor; a nucleic acid 10 inhibitor; or a combination thereof.
4. The pharmaceutical composition as claimed in claim 3, wherein the peptide inhibitor comprises a peptide having an amino acid sequence of at least 90% sequence identity to a sequence selected from a group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID 15 NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, and SEQ ID NO. 20; or wherein the nucleic acid inhibitor is an shRNA comprising a nucleotide sequence of at least 80% identity to a sequence selected from a group consisting of SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, ID NO. 12, and 20 SEQ ID NO. 13.
5. The pharmaceutical composition as claimed in claim 1, wherein the SERCA inhibitor is selected from thapsigargin, cyclopiazonic acid, 2,5-di-tertbutylhydroquinone (DBHQ), Mipsagargin, Casearin J, or a derivative thereof. 46
6. The pharmaceutical composition as claimed in claim 1, wherein the pharmaceutically acceptable carrier is selected from aqueous vehicles; sugars or sugar alcohols; starches or cellulose derivatives; proteins or polymers; lipids; surfactants; preservatives; antioxidants; pH adjusting agents; tonicity adjusting agents; chelating agents; viral vectors; non-viral delivery 5 systems, or combination thereof.
7. The pharmaceutical composition as claimed in claim 2, wherein the PMCA inhibitor and the SERCA inhibitor are present at a molar ratio in the range of 500:1 to 10000:1, preferably 5000:1, or wherein the PMCA inhibitor is present 10 at a weight percentage in the range of 0.002% to 0.04% w/w and the SERCA inhibitor is present at a weight percentage in the range of 5 x 10-7 % to 2 x 10-4 % w/w, in respect of the total composition.
8. A kit for treating cancer, said kit comprising a PMCA (plasma membrane Ca2+-ATPase) inhibitor; and optionally, a SERCA (Sarco/Endoplasmic 15 -ATPase) inhibitor.
9. The kit as claimed in claim 8, wherein the PMCA inhibitor and the SERCA inhibitor are present in a single pharmaceutical composition.
10. The kit as claimed in claim 8, wherein the PMCA inhibitor is selected from a peptide inhibitor; a small molecule inhibitor; a nucleic acid inhibitor; or 20 combination thereof.
11. The kit as claimed in claim 8, wherein said peptide inhibitor comprises a peptide having an amino acid sequence of at least 90% sequence identity to a sequence selected from a group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 47 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20 or wherein the nucleic acid inhibitor is an shRNA comprising a nucleotide sequence of at least 80% identity to a sequence selected from a group consisting of SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, 5 and SEQ ID NO. 13.
12. The kit as claimed in claim 8, wherein the PMCA inhibitor and the SERCA inhibitor are present at a molar ratio of 500:1 to 10000:1, preferably 5000:1.
13. The kit as claimed in claim 8, wherein the kit further comprises a therapeutic agent selected from an immune checkpoint inhibitor, vascular endothelial 10 growth factor (VEGF) neutralizing agent, a chemotherapeutic drug, poly ADPribose polymerase (PARP) inhibitor, Transforming growth factor beta (TGF-) inhibitor, lipid inhibitor, adoptive T cell, or a combination thereof.
14. The kit as claimed in claim 13, wherein the immune checkpoint inhibitor is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a CD39 15 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT inhibitor, a CD36 inhibitor, or combination thereof; wherein the VEGF neutralizing agent is an anti-VEGF antibody or anti-VEGF receptor antibody, wherein the VEGF neutralizing agent is selected from Bevacizumab, Ramucirumab, Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib, or 20 combination thereof; wherein the chemotherapeutic drug is selected from Paclitaxel, Carboplatin, Doxorubicin, Topotecan, Gemcitabine, or combination thereof; wherein the PARP inhibitor is selected from Olaparib, Niraparib, Rucaparib, Talazoparib, or combination thereof; wherein the TGF beta inhibitor is selected from Galunisertib, HYL001, Vactosertib, SB-431542, 48 Fresolimumab, AVID200, LY2109761, Pirfenidone, Losartan, Ker-050, or combination thereof; or wherein the lipid inhibitor is selected from Denifanstat, Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline, Ranolazine, simvastatin, atorvastatin, Edelfosine, Miltefosine, and combination 5 thereof.
15. A method of enhancing T cell activity, comprising contacting the T cell with a PMCA inhibitor; or a combination comprising a PMCA inhibitor and a SERCA inhibitor.
16. The method as claimed in claim 15, comprising contacting the T cell with the 10 pharmaceutical composition comprising a PMCA inhibitor, as claimed in claim 1 or 2; or a combination comprising a PMCA inhibitor and a SERCA inhibitor.
17. The method as claimed in claim 15, wherein said method comprises contacting the T cell with a therapeutic agent selected from an immune checkpoint inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a PARP 15 inhibitor, a TGF beta inhibitor, a lipid inhibitor, adoptive T cell, or combination thereof.
18. The method as claimed in claim 15, wherein the PMCA inhibitor and the SERCA inhibitor are provided in a single composition or separate composition.
19. The method as claimed in claim 15, wherein the PMCA inhibitor is selected 20 from a peptide inhibitor; a small molecule inhibitor; a nucleic acid inhibitor; or combination thereof.
20. The method as claimed in claim 19, wherein said peptide inhibitor comprises a peptide having an amino acid sequence of at least 90% sequence identity to a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ 49 ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20; or wherein the nucleic acid inhibitor is an shRNA comprising a nucleotide sequence of at least 80% identity to a sequence selected from a group consisting of SEQ ID NO. 5 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 13, or wherein the SERCA inhibitor is selected from thapsigargin, cyclopiazonic acid, DBHQ, Mipsagargin, Casearin J, or a derivative thereof.
21. The method as claimed in claim 17, wherein the immune checkpoint inhibitor 10 is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a CD39 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT inhibitor, a CD36 inhibitor, or combination thereof; wherein the VEGF neutralizing agent is an anti-VEGF antibody or anti-VEGF receptor antibody, wherein the VEGF neutralizing agent is selected from Bevacizumab, 15 Ramucirumab, Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib, or combination thereof; wherein the chemotherapeutic drug is selected from Paclitaxel, Carboplatin, Doxorubicin, Topotecan, Gemcitabine, or combination thereof; wherein the PARP inhibitor is selected from Olaparib, Niraparib, Rucaparib, Talazoparib, or combination thereof; wherein the TGF beta 20 inhibitor is selected from Galunisertib, HYL001, Vactosertib, SB-431542, Fresolimumab, AVID200, LY2109761, Pirfenidone, Losartan, Ker-050, or combination thereof; or wherein the lipid inhibitor is selected from Denifanstat, Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline, 50 Ranolazine, simvastatin, atorvastatin, Edelfosine, Miltefosine, and combination thereof.
22. A method of treating cancer in a subject, comprising administering to the subject a PMCA inhibitor; or a combination comprising a PMCA inhibitor and 5 a SERCA inhibitor.
23. The method as claimed in claim 22, comprising administering to the subject the pharmaceutical composition comprising a PMCA inhibitor, as claimed in claim 1 or 2; or combination comprising a PMCA inhibitor and a SERCA inhibitor.
24. The method as claimed in claim 22, wherein said method further comprises 10 administering to the subject a therapeutic agent selected from an immune checkpoint inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a PARP inhibitor, a TGF beta inhibitor, a lipid inhibitor, adoptive T cell, or combination thereof
25. The method as claimed in claim 22, wherein the PMCA inhibitor and the 15 SERCA inhibitor are administered as a single composition or separate composition.
26. The method as claimed in claim 22, wherein the PMCA inhibitor is peptide inhibitor comprising a peptide having an amino acid sequence of at least 90% sequence identity to a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, 20 SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20, or wherein said PMCA inhibitor is a nucleic acid inhibitor comprising a nucleotide sequence of 51 at least 80% identity to a sequence selected from a group consisting of SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 13.
27. The method as claimed in claim 22, wherein the SERCA inhibitor is selected from thapsigargin, cyclopiazonic acid, DBHQ, Mipsagargin, Casearin J or a derivative 5 thereof.
28. The method as claimed in claim 22, wherein the immune checkpoint inhibitor is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a CD39 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT inhibitor, a CD36 inhibitor, or combination thereof; wherein the anti-VEGF or 10 anti-VEGF receptor antibody is selected from Bevacizumab, Ramucirumab, Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib or combination thereof; wherein the chemotherapeutic drug is selected from Paclitaxel, Carboplatin, Doxorubicin, Topotecan, Gemcitabine or combination thereof; wherein the PARP inhibitor is selected from Olaparib, Niraparib, Rucaparib, 15 Talazoparib or combination thereof; wherein the TGF beta inhibitor is selected from Galunisertib, HYL001, Vactosertib, SB-431542, Fresolimumab, AVID200, LY2109761, Pirfenidone, Losartan, Ker-050 or combination thereof; or wherein the lipid inhibitor is selected from Denifanstat, Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline, Ranolazine, 20 simvastatin, atorvastatin, Edelfosine, Miltefosine and combination thereof.
29. The method as claimed in claim 22, wherein the cancer is selected from the group consisting of ovarian cancer, colorectal cancer, melanoma, breast cancer, lung cancer, pancreatic cancer, prostate cancer, gastric cancer, liver cancer, 52 renal cancer, bladder cancer, head and neck cancer, glioblastoma, esophageal cancer, cervical cancer, endometrial cancer, and hematological malignancies.
30. The method as claimed in claim 22, wherein said administering is performed by intraperitoneal, intratumoral, intravenous, intradermal, intramuscular, subcutaneous and/or oral 5 administration.
31. A process for preparing the pharmaceutical composition as claimed in claim 1, comprising mixing a PMCA inhibitor and a pharmaceutically acceptable carrier; and optionally mixing a SERCA inhibitor, to obtain the pharmaceutical composition. 10 32. A PMCA inhibitor for use in treating cancer in a subject, or for enhancing T cell activity.
33. A combination comprising a PMCA inhibitor and a SERCA inhibitor for treating cancer in a subject, or for enhancing T cell activity.
34. The combination, as claimed in claim 33, further comprising a therapeutic agent 15 selected from an immune checkpoint inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a PARP inhibitor, a TGF beta inhibitor, a lipid inhibitor, adoptive T cell, or combination thereof. 53
Description:FIELD OF INVENTION
[0001] The present disclosure relates to cancer immunotherapy and T-cell
activation, and more particularly to calcium ATPase modulation for cancer
immunotherapy and T-cell activation. The present disclosure relates to compositions,
methods, and kits for Ca2+-5 ATPase modulation.
BACKGROUND OF THE INVENTION
[0002] Over the past decade, it has become increasingly clear that cancer is not
just a genetic disease but also an immunological one, and immune dysfunction plays a
fundamental role in driving cancer development and progression. In healthy
10 individuals, the immune cells recognize and eliminate cancer cells by mounting an
anti-tumor immune response, however in cancer patients this function goes awry.
[0003] Bolstering the anti-cancer function of immune cells forms the foundation
of cancer immunotherapies, which harness the body's immune system to recognize and
destroy cancer cells and offer more targeted and durable responses compared to
15 chemotherapy. This is especially true for checkpoint therapies that, unlike the CAR-T
offer a potentially cheaper alternative to CAR-T (Jiang et al., 2015; Philip et al., 2017).
While immunotherapies to restore T cell functions have offered hope in cancers like
melanoma or colon carcinoma, most patients with gynecological cancers, particularly
20 those with ovarian cancer still see no benefit, and the impact of any of the current
immunotherapies has been disappointingly limited (Ghisoni et al., 2024; Guo et al.,
2020; Kumar et al., 2023).
[0004] Ovarian cancer remains one of the most lethal gynaecological
malignancies, largely due to its late-stage diagnosis and high rate of relapse. Despite
25 aggressive treatments typically involving surgical debulking followed by
chemotherapy, patient survival beyond five years remains dismally low, below 40%.
2
urgent need for more effective and durable therapeutic strategies (Kim et al., 2018;
Wang et al., 2024). Most patients who initially respond to immunotherapies show rapid
relapse and eventually succumb to the disease. This warrants the immediate need to
look into potential targets and devise more effective therapies to tackle ovarian cancer
and improve 5 patient survival.
SUMMARY OF THE INVENTION
[0005] In an aspect of the present disclosure, there is provided a pharmaceutical
composition for treating cancer, wherein the pharmaceutical composition comprises a
PMCA (plasma membrane Ca2+-ATPase) inhibitor and a pharmaceutically acceptable
10 carrier.
[0006] In an aspect of the present disclosure, there is provided a kit for treating
cancer, said kit comprising at least one PMCA (plasma membrane Ca2+-ATPase)
inhibitor, and optionally, a SERCA (Sarco/Endoplasmic Reticulum Ca2+-ATPase)
inhibitor.
15 [0007] In another aspect of the present disclosure, there is provided a method of
enhancing T cell activity, said method comprising contacting the T cell with the
pharmaceutical composition as disclosed herein; or a combination of a PMCA inhibitor
and a SERCA inhibitor.
[0008] In another aspect of the present disclosure, there is provided a method of
20 treating cancer in a subject, said method comprising administering to the subject the
pharmaceutical composition comprising a PMCA inhibitor, as disclosed herein; or a
combination of a PMCA inhibitor and a SERCA inhibitor.
[0009] In another aspect of the present disclosure, there is provided a process for
preparing the pharmaceutical composition as disclosed herein, comprising mixing a
25 PMCA inhibitor and a pharmaceutically acceptable carrier, to obtain the
pharmaceutical composition.
3
[0010] In an aspect of the present disclosure, there is provided a PMCA inhibitor
for use in treating cancer in a subject.
[0011] In yet another aspect of the present disclosure, there is provided a PMCA
inhibitor for use in enhancing T cell activity.
[0012] In another aspect of the present disclosure, there is provided 5 a combination
of PMCA inhibitor and SERCA inhibitor for treating cancer in a subject.
[0013] In yet another aspect of the present disclosure, there is provided a
combination of PMCA inhibitor and SERCA inhibitor for enhancing T cell activity.
[0014] These and other features, aspects, and advantages of the present subject
10 matter will be better understood with reference to the following description. This
summary is provided to introduce a selection of concepts in a simplified form. This
summary is not intended to identify key features or essential features of the claimed
subject matter, nor is it intended to be used to limit the scope of the claimed subject
matter.
15 BRIEF DESCRIPTION OF THE DRAWINGS
[0015] The following drawings form a part of the present specification and are
included to further illustrate aspects of the present disclosure. The disclosure may be
better understood by reference to the drawings in combination with the detailed
description of the specific embodiments presented herein.
20 [0016] FIG. 1 shows that CAMPI restores T cell signaling, wherein (a) depicts the
ascites-exposed T cells treated with CAMPI which show partially restored cytosolic
calcium levels, (b) depicts effects of caloxin and thapsigargin when used separately
on calcium levels in the ascites-exposed T cells using Fluo4 staining, (c) depicts the
effect of CAMPI on Jurkat T cells which show restoration of NFAT and AP1 levels
25 over a span of 8 hours of incubation, (d) shows the calcium flux in murine T cells at
different caloxin concentrations, keeping the thapsigargin constant, (e) depicts the
NFAT and AP1 levels at different caloxin concentrations, keeping the thapsigargin
constant, (f) illustrates the Western blot done to validate the knockdown of pumps in
4
Jurkat T cells along with graphs quantifying the increase in NFAT and AP1
fluorescence in PMCA-deficient cells, as well as elevated cytosolic content in the
Jurkat T cells transduced with PMCA shRNAs, and (g) illustrates NFAT and AP1
levels in Jurkat TPR cells where shRNA-mediated knockdown is done along with
thapsigargin treatment, in accordance with the embodiments 5 herein.
[0017] FIG. 2 illustrates restoration of effector functions of T cells by CAMPI,
wherein (a) depicts the restoration of calcium in Murine T cells treated with CAMPI,
(b) depicts the rescue of proliferation in Murine T cells treated with CAMPI. Further
(c), (d) and (e) depict the activation status of the ascites treated cells, as marked by
10 CD69, IFN- , (f) shows CAMPI treatment abolishes the adherent properties
of ID8 ovarian cancer cells, (g) depicts that CAMPI treatment strongly increases the
viability of murine T cells over 48 hours in presence of malignant ascites, in
accordance with the embodiments herein.
[0018] FIG. 3 depicts the induction of anti-tumor immunity by CAMPI
15 monotherapy, wherein (a) represents a schematic diagram showing administration of
ID8-Luciferase ovarian cancer cells in C57Bl/6 mice (5 mice per group), (b) shows
representative images showing the luciferase expression in peritoneum across mock
and CAMPI-administered mice, (c) represents weight (in grams) in mock v/s CAMPItreated
mice, depicts quantification of luciferase expression in peritoneum, measured
20 as total flux (photons per second) and depicts a graph representing area of luciferase
signal, (d) shows the Kaplan-Meier survival curve in mock v/s CAMPI-treated mice
and (e) depicts the quantification of the volume of peritoneal ascites, the luciferase
expression from peritoneal cellular fraction (expressed as relative light unit) and the
total number of cells from the peritoneal fraction collected from mock v/s CAMPI25
treated, in accordance with the embodiments herein.
[0019] FIG. 4 illustrates the induction of anti-tumor immunity against immune
checkpoint-resistant ovarian cancer by CAMPI along with anti-PD1 treatment,
wherein (a) presents a schematic diagram showing administration of ID8-luciferase
5
ovarian cancer cells in C57Bl/6 mice (5 mice per group), (b) depicts representative
images showing the luciferase expression in peritoneum across mock and CAMPIadministered
C57Bl/6 mice (5 mice per group), (c) shows the quantification of
luciferase expression in peritoneum, measured as total flux (photons per second), (d)
depicts a graph showing area of luciferase signal, (e) represents weight 5 of the animals
across days and (f) depicts a Kaplan Meier plot showing the probability of survival
across the three groups, in accordance with the embodiments herein.
[0020] FIG. 5 illustrates the representative images, wherein (a) shows the
luciferase expression in peritoneum across mock, Olaparib and olaparib along with
10 CAMPI - administered to mice and (b) depicts the quantification of luciferase
expression in peritoneum, measured as total flux (photons per second), in accordance
with the embodiments herein.
[0021] FIG. 6 shows the reduction of tumor burden by CAMPI in two different
tumor models, wherein (a) illustrates the schematic representation of the experimental
15 design in MC38 colon carcinoma model along with graphs showing the quantification
of tumor volume, represented as 0.5 x longest diameter x (shortest diameter)2, that were
measured using vernier calipers, and the weight of the animals, (b) illustrates the
schematic representation of the experimental design in B16F10 melanoma model along
with graphs showing the quantification of tumor volume, represented as 0.5 x longest
20 diameter x (shortest diameter)2, that were measured using vernier calipers, and the
weight of the animals, in accordance with the embodiments herein.
[0022] FIG. 7 represents reduction in tumor burden, when administered
subcutaneously (a) illustrates the schematic representation of the experimental design
in MC38 colon carcinoma model and (b) depicts a graph showing quantification of
25 tumor volume when administration of CAMPI occurs subcutaneously rather than
intratumorally, in accordance with the embodiments herein.
[0023] FIG. 8 illustrates that CAMPI monotherapy mobilizes adoptively
transferred CTLs (cytotoxic T lymphocytes) in MC38-ova model of colorectal cancer,
6
wherein (a) presents the schematic diagram showing the experimental design, (b)
depicts a graph showing the weight of the animals post tumor injection, (c) depicts a
graph showing quantification of tumor volume, represented as 0.5 x longest diameter
x (shortest diameter)2, that were measured using vernier calipers and (d) depicts the
percentage of CD3+CD8+ population, for both untreated and CAMPI 5 treated groups,
wherein significant elevation is seen in CAMPI treated group, in accordance with the
embodiments herein.
[0024] FIG. 9 depicts the effect of CAMPI in comparison with thapsigargin with
either of the two peptides, viz. P1 (SEQ ID NO. 8) or P2 (SEQ ID NO. 15), on
10 malignant ascites, which show restoration of NFAT levels, in accordance with the
embodiments herein.
DETAILED DESCRIPTION OF THE INVENTION
[0025] The following description sets forth exemplary aspects of the present
15 disclosure. It should be recognized, however, that such description is not intended as a
limitation on the scope of the present disclosure. Rather, the description also
encompasses combinations and modifications to those exemplary aspects described
herein.
[0026] Those skilled in the art will be aware that the present disclosure is subject
20 to variations and modifications other than those specifically described. It is to be
understood that the present disclosure includes all such variations and modifications.
The disclosure also includes all such steps, features, compositions, and compounds
referred to or indicated in this specification, individually or collectively, and any and
all combinations of any or more of such steps or features.
25 Definitions
[0027] For convenience, before further description of the present disclosure,
certain terms employed in the specification, and examples are delineated here. These
7
definitions should be read in the light of the remainder of the disclosure and understood
as by a person of skill in the art. The terms used herein have the meanings recognized
and known to those of skill in the art, however, for convenience and completeness,
particular terms and their meanings are set forth below.
[0028] 5
(i.e., to at least one) of the grammatical object of the article.
[0029]
sense, meaning that additional elements may be included. It is not intended to be
10 [0030] Throughout this specification, unless the context requires otherwise the
understood to imply the inclusion of a stated element or step or group of elements or
steps but not the exclusion of any other element or step or group of elements or steps.
[0031] As previously described hereinabove, improper function of immune cells,
15 particularly T cells, is one of the primary causes of cancer progression. Indeed,
therapies that restore and boost T cell function in cancer (cancer immunotherapies)
have gained immense popularity in clinics. All immunotherapies rely on alleviating
inhibition of immune cells such as T cells in cancer. Unfortunately, the existing
immunotherapies are far from perfect and provide only a limited benefit in a limited
20 number of patients. Hence, there is a quest to find novel pathways that can be targeted
for more effective immunotherapies.
[0032] The present inventors have identified a novel checkpoint target on T cells.
Embodiments herein provide compositions, kits, combinations, and methods to
modulate this novel checkpoint target on T cells to improve, restore, or enhance T cell
25 activity and treat cancer. The , as used herein, with respect to T cell
function refers to improving, increasing, restoring, or potentiating one or more
functional activities of T cells, including but not limited to T cell activation,
proliferation, cytokine production, cytotoxicity, persistence, and survival.
8
Accordingly, in some instances, the expression enhancing T cell activity may refer to
reversing, alleviating, or overcoming T cell dysfunction induced by an
immunosuppressive tumor microenvironment, thereby restoring or improving the
ability of T cells to mount an effective anti-tumor immune response.
[0033] In some aspects, embodiments herein achieve enhancement 5 in T cell
activity, which includes any improvement in T cell activity, including but not limited
to: (a) restoring or increasing cytosolic calcium levels in T cells; (b) increasing activity
of calcium-dependent transcription factors such as Nuclear Factor of Activated T cells
(NFAT) and Activator Protein 1 (AP1); (c) restoring or increasing T cell proliferation
10 capacity; (d) increasing expression of activation markers such as CD69; (e) increasing
production of effector cytokines such as IFN-
markers such as CD44; (g) improving T cell viability; (h) reversing T cell dysfunction
or exhaustion induced by an immunosuppressive tumor microenvironment; and/or (i)
increasing the persistence and/or activity of adoptively transferred T cells.
15 Pharmaceutical compositions and combinations
[0034] Embodiments herein achieve pharmaceutical compositions and
combinations. The pharmaceutical compositions and/or combinations, according to
embodiments herein comprise at least one PMCA inhibitor. The term "PMCA", as used
herein, refers to plasma membrane calcium () ATPase, a family of calcium pumps
20 located on the plasma membrane of cells that regulate calcium efflux from the
cytoplasm to the extracellular space. PMCA plays a critical role in maintaining
intracellular calcium homeostasis. There are four PMCA isoforms (PMCA1, PMCA2,
PMCA3, and PMCA4) encoded by four genes (ATP2B1, ATP2B2, ATP2B3, and
ATP2B4, respectively). As used herein, "PMCA1/4" refers to PMCA1 and/or PMCA4,
25 which are encoded by the ATP2B1 and ATP2B4 genes, respectively. PMCA1 and
PMCA4 are the predominant isoforms expressed in T cells and have been identified as
novel immune checkpoint targets by the present inventors.
9
[0035] The term "PMCA inhibitor", as used herein, refers to any agent that
inhibits, blocks, reduces, knocksdown, or suppresses the activity or expression of
PMCA, including PMCA1, PMCA4, or both PMCA1 and PMCA4. Examples of
PMCA inhibitors include, but are not limited to: (a) peptide inhibitors, for eg: caloxin
and derivatives thereof, which bind to extracellular domains of PMCA 5 and inhibit its
calcium efflux activity; (b) small molecule inhibitors that directly inhibit PMCA
enzymatic activity; (c) nucleic acid inhibitors, such as shRNA, siRNA, antisense
oligonucleotides, and miRNA, that reduce or suppress expression of PMCA; and (e)
combinations thereof.
10 [0036] A PMCA inhibitor, according to embodiments herein, by inhibiting
calcium efflux from T cells, increases or restores cytosolic calcium levels, thereby
enhancing T cell activation and function in the immunosuppressive tumor
microenvironment. The present inventors have observed that inhibition of PMCA
restores calcium signaling and T cell effector functions in the immunosuppressive
15 tumor microenvironment. Specifically, the present inventors have found that: (a)
elevated expression of PMCA1/4 (ATP2B1/4) correlates with poor survival outcomes
in cancer patients across multiple cancer types, including ovarian cancer, colorectal
cancer, and melanoma; (b) peritoneal CD8+ T cells from mice bearing advanced
tumors show significantly increased expression of PMCA1/4 compared to controls,
20 similar to increased expression of other checkpoint markers PD1 and CD39; (c)
pharmacological inhibition of PMCA1/4 restores cytosolic calcium levels in T cells
exposed to malignant ascites; (d) PMCA1/4 inhibition restores the activity of calciumdependent
transcription factors NFAT (Nuclear Factor of Activated T cells) and AP1
(Activator Protein 1) in T cells; (e) PMCA1/4 inhibition rescues T cell proliferation,
25 restores expression of the activation marker CD69, rescues production of the effector
cytokine IFN- (f) genetic
knockdown of PMCA1/4 using shRNA results in higher intracellular calcium and
elevated NFAT and AP1 activity, confirming the role of PMCA pumps in regulating T
10
cell signaling; and/or (i) PMCA1/4 inhibition enhances the efficacy and persistence of
adoptively transferred antigen-specific CD8+ T cells; among others.
[0037] Accordingly, in an embodiment, there is provided a pharmaceutical
composition or combination comprising a PMCA inhibitor. The PMCA inhibitor may
be an inhibitor of PMCA1, PMCA4, or both 5 PMCA1 and PMCA4.
[0038] The pharmaceutical composition or combination, according to
embodiments herein, may further comprise one or more SERCA (Sarco/Endoplasmic
Reticulum Ca2+-ATPase) inhibitors. Accordingly, in an embodiment, the
pharmaceutical composition or combination comprises a PMCA inhibitor and a
10 SERCA inhibitor.
[0039] The term "SERCA inhibitor", as used herein, refers to an agent that
inhibits, blocks, reduces, knockdown, or suppresses the activity of sarco/endoplasmic
reticulum Ca2+-ATPase (SERCA), a calcium pump that transports calcium ions from
the cytoplasm into the lumen of the endoplasmic reticulum (ER) or sarcoplasmic
15 reticulum (SR). SERCA plays a critical role in maintaining intracellular calcium
homeostasis by sequestering calcium into the ER, thereby lowering cytosolic calcium
levels. By inhibiting SERCA, a SERCA inhibitor prevents calcium sequestration into
the ER.
[0040] According to the present disclosure, SERCA inhibitors are used in
20 combination with PMCA inhibitors to restore cytosolic calcium levels in T cells, for
eg: in T cells exposed to an immunosuppressive tumor microenvironment. While
PMCA inhibitors block calcium efflux from the cell, SERCA inhibitors prevent
calcium sequestration into the ER. This dual-target approach normalizes aberrant
calcium signaling in T cells, thereby enhancing T cell activation/activity and anti25
tumor immunity.
[0041] The PMCA inhibitor and/ or SERCA inhibitors may be selected from (a) a
peptide inhibitor; (b) a small molecule inhibitor; (c) a nucleic acid inhibitor; and (d) a
combination thereof. In certain embodiments, the PMCA inhibitor is selected from: (a)
11
a peptide inhibitor; (b) a small molecule inhibitor; (c) a nucleic acid inhibitor; or (d) a
combination thereof.
[0042] In other embodiments, the SERCA inhibitor is selected from: (a) a peptide
inhibitor; (b) a small molecule inhibitor; (c) a nucleic acid inhibitor; or (d) a
combination 5 thereof.
[0043] , as used herein, refers to a peptide or
polypeptide that inhibits, blocks, reduces, knockdown, or suppresses the activity of a
target protein. For example, in the context of PMCA inhibition, a peptide inhibitor may
be a peptide or polypeptide that may bind to PMCA, for eg: an extracellular domain of
10 PMCA, and inhibits its calcium efflux activity. In an example, the peptide inhibitors
of PMCA include, but are not limited to, caloxins or variants thereof which are peptides
that bind to PMCA and block calcium transport. Exemplary caloxins include caloxin
1c2, caloxin 1c1, caloxin 1c3, caloxin 1b1, caloxin 1b3, caloxin 2a1, and caloxin 3a1,
or variants thereof.
15 [0044] The term "small molecule inhibitor", as used herein, refers to a low
molecular weight organic compound, typically having a molecular weight of less than
about 1000 Daltons, preferably less than about 500 Daltons, that inhibits, blocks,
reduces, knockdown, or suppresses the activity of a target protein. Small molecule
inhibitors typically bind to the target protein and interfere with its enzymatic activity
20 or function. For example, in the context of PMCA inhibition, a small molecule inhibitor
may be a compound that inhibits the calcium efflux activity of PMCA1, PMCA4, or
both. In an example, in the context of SERCA inhibition, small molecule inhibitors
include, but are not limited to, thapsigargin (CAS:67526-95-8), cyclopiazonic acid
(CAS:18172-33-3), 2,5-di-tert-butylhydroquinone (DBHQ) (CAS: 88-58-4),
25 Mipsagargin (CAS: 1245732-48-2), and Casearin J (CAS:134955-65-0).
[0045] The term "nucleic acid inhibitor", as used herein, refers to a nucleic acid
molecule that inhibits, blocks, reduces, knockdown, or suppresses the expression of a
target gene or the activity of its encoded protein. Examples of nucleic acid inhibitors
12
include but are not limited to: (a) short hairpin RNA (shRNA); (b) small interfering
RNA (siRNA); (c) antisense oligonucleotides (ASOs); (d) microRNA (miRNA); and
(e) guide RNA (gRNA) for use with CRISPR-based gene editing systems to knockout
or knockdown target gene expression.
[0046] For example, in the context of PMCA inhibition, nucleic 5 acid inhibitors
may include shRNA and siRNA molecules that target PMCA, thereby reducing or
suppressing expression of the calcium pumps. Nucleic acid inhibitors may be delivered
using viral vectors, such as lentiviral vectors, retroviral vectors, or adenoviral vectors;
or non-viral delivery systems, such as lipid nanoparticles or polymer-based carriers.
10 Exemplary shRNA sequences for PMCA inhibition include sequences having at least
80% identity to SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or
SEQ ID NO: 13. The shRNA, according to embodiments herein, may be suitable for
delivery via viral or non-viral delivery systems.
[0047] Accordingly, in some embodiments, the PMCA inhibitor is a peptide
15 inhibitor, wherein the peptide inhibitor is caloxin selected from caloxin 1c2, caloxin
1c1, caloxin 1c3, caloxin 1b1, caloxin 1b3, caloxin 2a1, caloxin 3a1, or variants
thereof. In a preferred embodiment¸ the PMCA inhibitor is caloxin, preferably caloxin
1c2 or a variant thereof.
[0048] In some embodiments, the peptide inhibitor comprises a peptide having an
20 amino acid sequence of at least 90% sequence identity to a sequence selected from the
group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ
ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, and
SEQ ID NO. 20. In certain embodiments, the peptide inhibitor comprises a peptide
25 having an amino acid sequence of at least 92%, at least 94%, at least 96%, at least 98%,
or at least 99% sequence identity to any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ
ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID
NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID
13
NO. 18, SEQ ID NO. 19, and SEQ ID NO. 20. In certain embodiments, the peptide
inhibitor comprises a peptide having an amino acid sequence as set forth in any one of
SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ
ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID
NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, 5 and SEQ ID NO. 20.
[0049] In some embodiments, the PMCA inhibitor is a nucleic acid inhibitor
selected from the group consisting of shRNA, siRNA, antisense oligonucleotide, and
miRNA. In certain embodiments, the nucleic acid inhibitor is an shRNA targeting
PMCA1, PMCA4, or both.
10 [0050] In an embodiment, the nucleic acid inhibitor is an shRNA comprising a
nucleotide sequence of at least 80% identity to a sequence selected from the group
consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and
SEQ ID NO: 13. In certain embodiments, the shRNA has a nucleotide sequence of at
least 92%, at least 94%, at least 96%, at least 98%, or at least 99% identity to a
15 sequence selected from SEQ ID NOs: 9-13. In certain embodiments, the shRNA has a
nucleotide sequence selected from SEQ ID NOs: 9-13. In an embodiment, the shRNA
may be encapsulated in a lentiviral particle. In another embodiment, the shRNA may
be encapsulated in a liposome or a lipid nanoparticle. Various viral systems and nonviral
systems for nucleic acid delivery are known and maybe used to deliver the
20 shRNA. In an embodiment, the pharmaceutical compositions and/or combinations
comprises a PMCA inhibitor, wherein the PMCA inhibitor is an shRNA encapsulated
in a viral or non-viral particle. In an example, the viral particle is selected from
lentiviral particle, retroviral particle, or adenoviral particle. Examples of lipid
nanoparticles include, but are not limited to, pLKO.1-puro (TRC1.5 vector) or TRC2-
25 pLKO-puro(TRC2 vector). In another example, the viral particle is retroviral particle
such as Ad19a/64; or adenoviral particle such as pSuper.retro.puro. In yet another
example, the non-viral particle is selected from lipid nanoparticle, liposomes, or
micelles. Examples of lipid nanoparticles include, but are not limited to, nanoparticles
14
having DSPE-PEG-2000, DMG-PEG-2000, DSPC phospholipids, cholesterol and/or
ionizable lipids (ALC-0315, SM-102).
[0051] In some embodiments, the pharmaceutical composition or combination
further comprises a SERCA inhibitor. In certain embodiments, the SERCA inhibitor is
selected from thapsigargin, cyclopiazonic acid, 2,5-di-tert-5 butylhydroquinone
(DBHQ), Mipsagargin, Casearin J, or derivatives thereof. In a preferred embodiment,
the SERCA inhibitor is thapsigargin (for example: refer CAS 67526-95-8).
[0052] The PMCA inhibitor and SERCA inhibitor, according to the present
disclosure, may be provided in a single composition or in separate compositions.
10 Accordingly, in certain embodiments, the PMCA inhibitor and the SERCA inhibitor
are present in a single pharmaceutical composition. In certain embodiments, the PMCA
inhibitor and the SERCA inhibitor are present in separate pharmaceutical
compositions, for simultaneous, sequential, or separate administration. Accordingly,
there is provided a pharmaceutical composition comprising a PMCA inhibitor and a
15 SERCA inhibitor. The pharmaceutical composition, according to embodiments herein,
may further comprise at least one pharmaceutically acceptable carriers including
excipients, diluents, or adjuvants. The pharmaceutical composition may be in any
suitable form for administration to a subject. Examples of suitable form include, but
not limited to, liquid, solid, semi-solid, gel, suspension, emulsion, solution, powder,
20 granule, tablet, capsule, or injectable forms. In some aspects, the pharmaceutical
composition refers to a composition suitable for administration to a subject. In some
embodiments, the pharmaceutical composition comprises a PMCA inhibitor and a
pharmaceutically acceptable carrier. In other embodiments, a pharmaceutical
composition comprises a PMCA inhibitor, a SERCA inhibitor, and a pharmaceutically
25 acceptable carrier.
[0053] In an embodiment, the pharmaceutical composition comprises a PMCA
inhibitor, a SERCA inhibitor, and a pharmaceutically acceptable carrier, wherein the
PMCA inhibitor is a peptide inhibitor (for eg: caloxin or a variant thereof), and the
15
SERCA inhibitor is thapsigargin. In an example, a composition comprising caloxin,
particularly caloxin 1c2, and thapsigargin, is referred to herein as CAMPI (Calcium
Modulation using Pump Inhibition).
[0054] The combination or pharmaceutical combination, according to
embodiments herein, comprising the PMCA inhibitor and the SERCA 5 inhibitor may
be formulated together in a single composition or provided as separate compositions
for administration to a subject. The combination may be administered simultaneously,
sequentially, or separately. In an example, when administered simultaneously, the
active agents (for eg: the PMCA inhibitor and the SERCA inhibitor) may be formulated
10 together in a single composition or provided as separate compositions to be
administered at the same time. In an example, when administered sequentially, the
active agents may be administered one after the other, with or without a time interval
between administrations. In another example, when administered separately, the active
agents may be administered at different times, which may be on the same day or on
15 different days.
[0055] Accordingly, in certain embodiments, a pharmaceutical combination
comprises a PMCA inhibitor and a SERCA inhibitor. In certain embodiments, the
PMCA inhibitor and the SERCA inhibitor are present in a single pharmaceutical
composition. In certain embodiments, the PMCA inhibitor and the SERCA inhibitor
20 are present in separate pharmaceutical compositions for simultaneous, sequential, or
separate administration.
[0056] Embodiments of the pharmaceutical composition or combination, as
disclosed herein, may further include one or more therapeutic agent selected from an
immune checkpoint inhibitor, a vascular endothelial growth factor (VEGF)
25 neutralizing agent, a chemotherapeutic drug, a poly ADP-ribose polymerase (PARP)
inhibitor, a transforming growth factor beta (TGF-
combination thereof.
16
[0057] In certain embodiments, a pharmaceutical composition or combination
comprises a PMCA inhibitor, a SERCA inhibitor, and at least one therapeutic agent.
In certain embodiments, a pharmaceutical composition or combination comprises a
PMCA inhibitor, a SERCA inhibitor, and an immune checkpoint inhibitor. In certain
embodiments, the immune checkpoint inhibitor is present in a separate 5 pharmaceutical
composition from the PMCA inhibitor and the SERCA inhibitor.
[0058] In certain embodiments, there is provided a pharmaceutical composition or
combination, wherein the PMCA inhibitor to SERCA inhibitor is at a molar ratio in
the range of 500:1 to 10000:5. In certain embodiments, the PMCA inhibitor and the
10 SERCA inhibitor are present at a molar ratio selected from the group consisting of
5000:5, 10000:1, 10000:5, and 5000:1. In certain embodiments, the caloxin or a
variant thereof and thapsigargin are present at a molar ratio in the range of 500:1 to
10000:5. In certain embodiments, the caloxin or a variant thereof and thapsigargin are
present at a molar ratio selected from the group consisting of 5000:5, 10000:1, 10000:5,
15 and 5000:1.
[0059] In certain embodiments, there is provided a pharmaceutical composition,
wherein the PMCA inhibitor is present in a weight range of 0.002% to 0.04% w/w,
preferably 0.0037% to 0.0368% w/w, and SERCA inhibitor is present in a weight
range of 5 x 10-7 % to 2 x 10-4 % w/w, preferably 6.5 x 10-7 % to 1.3 x 10-4 % w/w, in
20 respect of the total composition.
[0060] The PMCA inhibitor and the SERCA inhibitor, according to embodiments
herein, may also be administered in combination with or subsequent to adoptively
transferred T cell therapy. Accordingly, in some embodiments, there is provided a
combination comprising the PMCA inhibitor and the SERCA, and at least one
25 therapeutic agent, wherein the therapeutic agent is adoptively transferred T cells. The
term adoptive T cell or adoptively transferred T cell, used interchangeably herein,
refers to immune cells, specifically T lymphocytes, that are isolated from a donor or a
17
patient, expanded or genetically modified in a laboratory setting, and then infused back
into the patient to fight diseases like cancer.
[0061] The therapeutic agent, according to embodiments herein, may be present
in a single composition along with the PMCA inhibitor and the SERCA inhibitor, or
each of the therapeutic agent, PMCA inhibitor, and the SERCA 5 may be in separate
pharmaceutical compositions. In certain embodiments, the therapeutic agent is present
in a separate pharmaceutical composition from the PMCA inhibitor and the SERCA
inhibitor.
[0062] The term "immune checkpoint inhibitor", as used herein, refers to an agent
10 that blocks, inhibits, or neutralizes one or more immune checkpoint proteins, thereby
enhancing or restoring anti-tumor immune responses. Immune checkpoints are
regulatory molecules expressed on immune cells, particularly T cells, that normally
function to prevent excessive immune activation and maintain self-tolerance.
However, in the tumor microenvironment, cancer cells exploit these checkpoint
15 pathways to evade immune surveillance and suppress T cell-mediated anti-tumor
immunity. In an embodiment, immune checkpoint inhibitor may be an agent that
blocks inhibitory signals in the immune system, thereby allowing immune cells
particularly T cells to remain active against target cells.
[0063] The immune checkpoint inhibitor may be an antibody or antigen-binding
20 fragment thereof, small molecule, or fusion protein.
[0064] In certain embodiments, the immune checkpoint inhibitor is selected from
the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a
LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT inhibitor, a CD39 inhibitor, a CD73
inhibitor, and a CD36 inhibitor.
25 [0065] The term "PD-1 inhibitor", as used herein, refers to an agent that blocks or
inhibits Programmed Cell Death Protein 1 (PD-1), a receptor expressed on T cells that,
upon binding to its ligands PD-L1 or PD-L2, suppresses T cell activation and promotes
T cell exhaustion. In certain embodiments, the immune checkpoint inhibitor is a PD-1
18
inhibitor. In certain embodiments, the PD-1 inhibitor is an anti-PD1 antibody. In an
embodiment, the anti-PD1 antibody is selected from pembrolizumab, nivolumab,
cemiplimab, dostarlimab, retifanlimab, or combination thereof.
[0066] The term "PD-L1 inhibitor", as used herein, refers to an agent that blocks
or inhibits Programmed Death-Ligand 1 (PD-L1), a ligand expressed 5 on tumor cells
and antigen-presenting cells that binds to PD-1 on T cells to suppress anti-tumor
immunity. In certain embodiments, the immune checkpoint inhibitor is a PD-L1
inhibitor. In certain embodiments, the PD-L1 inhibitor is an anti-PD-L1 antibody. In
an embodiment, the anti-PD-L1 antibody is selected from atezolizumab, durvalumab,
10 avelumab, or combination thereof.
[0067] The term "CTLA-4 inhibitor", as used herein, refers to an agent that blocks
or inhibits Cytotoxic T-Lymphocyte-Associated Protein 4 (CTLA-4), a receptor
expressed on T cells that competes with the co-stimulatory receptor CD28 for binding
to CD80 and CD86 on antigen-presenting cells, thereby suppressing T cell activation.
15 In certain embodiments, the immune checkpoint inhibitor is a CTLA-4 inhibitor. In
some embodiment, the CTLA-4 inhibitor is an anti-CTLA-4 antibody. In an
embodiment, the anti-CTLA-4 antibody is selected from ipilimumab, tremelimumab,
or combination thereof.
[0068] The term "LAG-3 inhibitor", as used herein, refers to an agent that blocks
20 or inhibits Lymphocyte-Activation Gene 3 (LAG-3), a receptor expressed on activated
T cells that binds to MHC class II molecules and negatively regulates T cell
proliferation and function. In certain embodiments, the immune checkpoint inhibitor
is a LAG-3 inhibitor. In an embodiment, the LAG-3 inhibitor is relatlimab.
[0069] In a preferred embodiment, the immune checkpoint inhibitor is an anti-
25 PD1 antibody. The present inventors have demonstrated that CAMPI synergizes with
anti-PD1 antibody to augment anti-tumor immunity in checkpoint-resistant cancer
models, such as the ID8 ovarian cancer model, which is highly resistant to conventional
checkpoint blockade including PD-1 and CTLA-4 inhibitors.
19
[0070] VEGF neutralizing agent", as used herein, refers to an agent that
blocks, inhibits, or neutralizes vascular endothelial growth factor (VEGF) or its
receptors, thereby inhibiting tumor angiogenesis and blood vessel formation. In
certain embodiments, the VEGF neutralizing agent is an anti-VEGF antibody or anti-
VEGF receptor antibody. In certain embodiments, the VEGF neutralizing 5 agent is
selected from bevacizumab, ramucirumab, aflibercept, sunitinib, sorafenib, pazopanib,
nintedanib, and combinations thereof.
[0071] The term "chemotherapeutic drug", as used herein, refers to a cytotoxic
agent that kills or inhibits the growth of cancer cells by interfering with cell division,
10 DNA synthesis, or other essential cellular processes. In certain embodiments, the
chemotherapeutic drug is selected from paclitaxel, carboplatin, doxorubicin,
topotecan, gemcitabine, and combinations thereof.
[0072] In some embodiments, a pharmaceutical composition or combination
comprises a PMCA inhibitor, a SERCA inhibitor, and a PARP inhibitor. The term
15 "PARP inhibitor", as used herein, refers to an agent that blocks or inhibits poly ADPribose
polymerase (PARP), an enzyme involved in DNA repair. In certain
embodiments, the PARP inhibitor is selected from olaparib, niraparib, rucaparib,
talazoparib, or combinations thereof. Each of the PMCA inhibitor, SERCA inhibitor,
and PARP inhibitor, may be present in a single pharmaceutical composition or separate
20 pharmaceutical composition. In an embodiment the PMCA inhibitor and SERCA
inhibitor are administered in a single pharmaceutical composition, and the PARP
inhibitor is administered as a separate composition. In an embodiment, the PMCA
inhibitor is olaparib (CAS: 763113-22-0).
[0073] The term "TGF- , as used herein, refers to an agent that blocks
25 or inhibits transforming growth factor beta (TGF- In certain
embodiments, the TGF- galunisertib, HYL001, vactosertib,
SB-431542, fresolimumab, AVID200, LY2109761, pirfenidone, losartan, Ker-050, or
combinations thereof.
20
[0074] The term "lipid inhibitor", as used herein, refers to an agent that blocks or
inhibits lipid metabolism, synthesis, or uptake in cells. In certain embodiments, the
lipid inhibitor is selected from denifanstat, orlistat, cerlenin, C75, A939572,
CAY10566, etomoxir, perhexiline, ranolazine, simvastatin, atorvastatin, edelfosine,
miltefosine, or combinations 5 thereof.
[0075] The term "pharmaceutically acceptable carrier", as used herein, refers to a
substance that is suitable for use in administering active agent(s) to a subject without
causing adverse effects in the subject. A pharmaceutically acceptable carrier is a nontoxic,
inert substance that serves as a vehicle, diluent, excipient, or adjuvant for the
10 active agent(s) in a pharmaceutical composition. Pharmaceutically acceptable carriers
may facilitate formulation, stability, delivery, and/or absorption of the active agent(s)
and may be in suitable forms such as solid, semi-solid, or liquid form.
[0076] Pharmaceutically acceptable carriers include, but are not limited to:
aqueous vehicles and buffers, including phosphate buffer saline (PBS), water for
15 injection, saline, and Ringer's solution; sugars and sugar alcohols, including lactose,
glucose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, and maltitol; starches
and cellulose derivatives, including microcrystalline cellulose, hydroxypropyl
methylcellulose, carboxymethyl cellulose, and starch; proteins and polymers,
including gelatin, albumin, polyethylene glycol, and polylactic-co-glycolic acid
20 (PLGA); lipids and surfactants, including phospholipids, lecithin, polysorbates, and
polyoxyethylene sorbitan fatty acid esters; preservatives, including benzyl alcohol,
parabens, and phenol; antioxidants, including ascorbic acid, tocopherol, and butylated
hydroxytoluene; pH adjusting agents, including hydrochloric acid, sodium hydroxide,
citric acid, and phosphoric acid; tonicity adjusting agents, including sodium chloride,
25 dextrose, and glycerin; chelating agents, including ethylenediaminetetraacetic acid
(EDTA); viral vectors, including lentiviral vectors, retroviral vectors, or adenoviral
vectors; non-viral delivery systems, including lipid nanoparticles, or polymer-based
carriers; or combinations thereof.
21
[0077] In certain embodiments, the pharmaceutically acceptable carrier is selected
from aqueous vehicles; sugars or sugar alcohols; starches or cellulose derivatives;
proteins or polymers; lipids; surfactants; preservatives; antioxidants; pH adjusting
agents; tonicity adjusting agents; chelating agents; viral vectors; non-viral delivery
systems, or combination 5 thereof.
[0078] In certain embodiments, the pharmaceutically acceptable carrier is selected
from aqueous vehicles including phosphate buffer saline (PBS), water for injection,
saline, and Ringer's solution; sugars or sugar alcohols, including lactose, glucose,
dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, and maltitol; starches or
10 cellulose derivatives, including microcrystalline cellulose, hydroxypropyl
methylcellulose, carboxymethyl cellulose, and starch; proteins or polymers, including
gelatin, albumin, polyethylene glycol, and polylactic-co-glycolic acid (PLGA); lipids
or surfactants, including phospholipids, lecithin, polysorbates, and polyoxyethylene
sorbitan fatty acid esters; preservatives, including benzyl alcohol, parabens, and
15 phenol; antioxidants, including ascorbic acid, tocopherol, and butylated
hydroxytoluene; pH adjusting agents, including hydrochloric acid, sodium hydroxide,
citric acid, and phosphoric acid; tonicity adjusting agents, including sodium chloride,
dextrose, and glycerin; chelating agents, including ethylenediaminetetraacetic acid
(EDTA); viral vectors, including lentiviral vectors, retroviral vectors, or adenoviral
20 vectors; non-viral delivery systems, including lipid nanoparticles or polymer-based
carriers, or combination thereof.
[0079] In certain embodiments, the pharmaceutically acceptable carrier is selected
from phosphate buffer saline (PBS), lactose, glucose, dextrose, sucrose, sorbitol,
mannitol, xylitol, erythritol, maltitol, liposomes, viral vectors, or combinations thereof.
25 The choice of pharmaceutically acceptable carrier may depend on the route of
administration, the active agent(s), and the desired characteristics of the final
pharmaceutical composition, such as dosage form, stability, solubility, and release
profile.
22
Kits
[0080] Embodiments herein provide a kit. The kit, according to embodiments
herein, may be for inhibiting PMCA, enhancing T cell activity, and/or treating cancer.
The kit may comprise one or more compositions comprising 5 active agents, and
optionally instructions for use.
[0081] In an embodiment, there is provided a kit comprising PMCA inhibitor; and
optionally, a SERCA inhibitor.
[0082] In an embodiment, the PMCA inhibitor and the SERCA inhibitor are
10 present in a single pharmaceutical composition. Accordingly, in certain embodiments,
the kit comprises a pharmaceutical composition comprising a PMCA inhibitor and a
SERCA inhibitor.
[0083] In another embodiment, the PMCA inhibitor and the SERCA inhibitor are
present in separate pharmaceutical compositions. Accordingly, in an embodiment, the
15 kit comprises: (a) a first composition comprising a PMCA inhibitor; (b) a second
composition comprising a SERCA inhibitor; and (c) instructions for administering the
first and second compositions.
[0084] In certain embodiments, the PMCA inhibitor in the kit is a peptide
inhibitor, for eg: caloxin or a variant thereof. In certain embodiments, the SERCA
20 inhibitor in the kit is thapsigargin. In certain embodiments, the kit comprises peptide
inhibitor, for eg: caloxin and thapsigargin. In certain embodiments, the kit comprises
peptide inhibitor, for eg: a peptide having a sequence selected from SEQ ID NOs. 1-8,
or 14-20, and thapsigargin.
[0085] In certain embodiments, the kit further comprises a third composition
25 comprising at least one therapeutic agent selected from an immune checkpoint
inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a PARP inhibitor, a
TGF- adoptive T cell, or a combination thereof.
23
[0086] In an embodiment, the kit further comprises a third composition
comprising an immune checkpoint inhibitor. In certain embodiments, the immune
checkpoint inhibitor is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4
inhibitor, a CD39 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a
TIGIT inhibitor, a CD36 inhibitor, or combination thereof. In certain 5 embodiments,
the immune checkpoint inhibitor is an anti-PD1 antibody.
[0087] In certain embodiments, the kit comprises: (a) a first composition
comprising a PMCA inhibitor and a SERCA inhibitor; and (b) a third composition
comprising therapeutic agent for eg: an immune checkpoint inhibitor, or a PARP
10 inhibitor or a combination thereof.
[0088] In certain embodiments, the kit comprises: (a) a first composition
comprising a PMCA inhibitor and a SERCA inhibitor; (b) optionally, a third
composition comprising a therapeutic agent, wherein the therapeutic agent selected is
from an immune check point inhibitor, a VEGF neutralizing agent, a chemotherapeutic
15 drug, a PARP inhibitor, a TGF- adoptive T cell, or a
combination thereof.
[0089] Accordingly, in certain embodiments, the kit comprises: (a) a PMCA
inhibitor; (b) a SERCA inhibitor; and (d) optionally, a therapeutic agent.
[0090] Each of the first composition, second composition, and/or third
20 composition may further comprise a pharmaceutically acceptable carrier. The
pharmaceutically acceptable carrier may be as described as herein above. In an
embodiment, each of the first composition, second composition, and/or third
composition may comprise a pharmaceutically acceptable carrier selected from
phosphate buffer saline (PBS), lactose, glucose, dextrose, sucrose, sorbitol, mannitol,
25 xylitol, erythritol, maltitol, or combinations thereof. Various pharmaceutically
acceptable carrier are known and described herein above, which ,ay be used in
embodiments herein.
24
[0091] In certain embodiments, the pharmaceutically acceptable carrier in the
second composition and/or third composition is selected from the group consisting of
phosphate buffer saline (PBS), lactose, glucose, dextrose, sucrose, sorbitol, mannitol,
xylitol, erythritol, maltitol, and combinations thereof.
[0092] In certain embodiments, the pharmaceutically acceptable 5 carrier is PBS. In
certain embodiments, the pharmaceutically acceptable carrier is a sugar selected from
lactose, glucose, dextrose, and sucrose. In certain embodiments, the pharmaceutically
acceptable carrier is a sugar alcohol selected from sorbitol, mannitol, xylitol, erythritol,
and maltitol.
10 [0093] In certain embodiments, the kit comprises a PMCA inhibitor selected from
a peptide inhibitor, a nucleic acid inhibitor, or a combination thereof.
[0094] In certain embodiments, the PMCA inhibitor in the kit is selected from
peptide inhibitor, for eg: caloxin, or shRNA. In an embodiment, there is provided a kit
comprising a PMCA inhibitor, wherein the PMCA inhibitor is a peptide inhibitor,
15 wherein the peptide inhibitor comprises a peptide having an amino acid sequence of
at least 90% sequence identity to a sequence selected from the group consisting of SEQ
ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID
NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO.
16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20.
20 [0095] In another embodiment, there is provided a kit comprising a PMCA
inhibitor, wherein the PMCA inhibitor is shRNA comprising a nucleotide sequence of
at least 80% identity to a sequence selected from the group consisting of SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13.
[0096] In another embodiment, there is provided a kit comprising a PMCA
25 inhibitor and SERCA inhibitor, wherein the PMCA inhibitor is a peptide inhibitor,
preferably having an amino acid sequence of at least 90% sequence identity to a
sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ
ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID
25
NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID
NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20, or the PMCA inhibitor is shRNA
comprising a nucleotide sequence of at least 80% identity to a sequence selected from
the group consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, and SEQ ID NO: 13, wherein the SERCA inhibitor 5 is thapsigargin.
[0097] In another embodiment, there is provided a kit comprising a PMCA
inhibitor, wherein the PMCA inhibitor is shRNA comprising a nucleotide sequence of
at least 80% identity to a sequence selected from the group consisting of SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 13.
10 [0098] In some embodiments, there is provided a kit comprising a PMCA inhibitor
and a SERCA inhibitor, wherein the PMCA inhibitor and SERCA inhibitor are at a
molar ratio in the range of 500:1 to 10000:5.
[0099] In certain embodiments, the kit comprises a therapeutic agent selected from
an immune checkpoint inhibitor, a vascular endothelial growth factor (VEGF)
15 neutralizing agent, a chemotherapeutic drug, a poly ADP-ribose polymerase (PARP)
inhibitor, a transforming growth factor beta (TGF-
adoptive T cell, or a combination thereof.
[0100] In certain embodiments, the kit comprises an immune checkpoint inhibitor.
In certain embodiments, the kit further comprises a VEGF neutralizing agent. In certain
20 embodiments, the kit further comprises a chemotherapeutic drug. In certain
embodiments, the kit further comprises a PARP inhibitor. In an embodiment, the PARP
inhibitor is olaparib. In certain embodiments, the kit further comprises a TGF-
inhibitor. In certain embodiments, the kit further comprises a lipid inhibitor. In certain
embodiments, the kit further comprises a combination of two or more of an immune
25 checkpoint inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a PARP
inhibitor, a TGF- The immune checkpoint inhibitor, a
vascular endothelial growth factor (VEGF) neutralizing agent, a chemotherapeutic
26
drug, a poly ADP-ribose polymerase (PARP) inhibitor, a transforming growth factor
beta (TGF- and a lipid inhibitor may be as described previously herein.
[0101] The PMCA inhibitor, SERCA inhibitor, and/or therapeutic agents in the
kit, according to the present disclosure, may be in suitable containers such as vials,
ampoules, syringes, or bottles. The containers may be single-dose containers 5 or multidose
containers.
Method
[0102] Embodiments herein provide a method for inhibiting PMCA, enhancing T
10 cell activity, and/or treating cancer. The embodiments, as disclosed in the present
disclosure, achieve improvement in T cell activity, including but not limited to: (a)
restoring or increasing cytosolic calcium levels in T cells; (b) increasing activity of
calcium-dependent transcription factors such as Nuclear Factor of Activated T cells
(NFAT) and Activator Protein 1 (AP1); (c) restoring or increasing T cell proliferation
15 capacity; (d) increasing expression of activation markers such as CD69; (e) increasing
production of effector cytokines such as IFN-
markers such as CD44; (g) improving T cell viability; (h) reversing T cell dysfunction
or exhaustion induced by an immunosuppressive tumor microenvironment; and (i)
increasing the persistence and/or activity of adoptively transferred T cells.
20 Accordingly, the present disclosure provides a method for restoring or increasing
cytosolic calcium levels in T cells, a method for increasing activity of calciumdependent
transcription factors such as Nuclear Factor of Activated T cells (NFAT)
and Activator Protein 1 (AP1); a method for restoring or increasing T cell proliferation
capacity; a method for increasing expression of activation markers such as CD69;
25 increasing production of effector cytokines such as IFN-
expression of memory markers such as CD44; a method for improving T cell viability;
a method for reversing T cell dysfunction or exhaustion induced by an
immunosuppressive tumor microenvironment; and/or a method for increasing the
27
efficacy, persistence and/or activity of adoptively transferred T cell. In some
embodiments, there is provided a method of immunotherapy or a method for treating
cancer in a subject.
[0103] Embodiments herein provide a method for enhancing T cell function or T
cell activity. The methods, as disclosed herein, may be used to restore 5 function of a
dysfunctional T cell. The method, as disclosed herein, may be used to restore function
of a dysfunctional T cell, wherein the T cell dysfunction is induced by a tumor
microenvironment. Accordingly, in an embodiment, there is provided a method for
enhancing T cell activity, comprising contacting the T cell with: a PMCA inhibitor, as
10 disclosed herein; a pharmaceutical composition or combination comprising a PMCA
inhibitor and a SERCA inhibitor; a pharmaceutical composition or combination
comprising a PMCA inhibitor, a SERCA inhibitor; or a therapeutic agent. In another
embodiment, there is provided a method for restoring T cell function, comprising
contacting the T cell with: a PMCA inhibitor, as disclosed herein; a pharmaceutical
15 composition or combination comprising a PMCA inhibitor and a SERCA inhibitor; or
a pharmaceutical composition or combination comprising a PMCA inhibitor, a SERCA
inhibitor, and a therapeutic agent.
[0104] In certain embodiments, enhancing T cell function comprises one or more
of: (a) restoring cytosolic calcium levels in T cells; (b) increasing NFAT (Nuclear
20 Factor of Activated T cells) activity in T cells; (c) increasing AP1 (Activator Protein
1) activity in T cells; (d) restoring T cell proliferation; (e) increasing CD69 expression
on T cells; (f) increasing IFN-
expression on T cells.
[0105] In certain embodiments, the T cells are exposed to an immunosuppressive
25 tumor microenvironment. In certain embodiments, the immunosuppressive tumor
microenvironment comprises malignant ascites.
[0106] In another embodiment, there is provided a method, comprising contacting
a T cell with the pharmaceutical composition comprising a PMCA inhibitor, as
28
disclosed herein; or the pharmaceutical composition or combination comprising a
PMCA inhibitor, as disclosed herein, and a SERCA inhibitor; or the pharmaceutical
composition or combination comprising PMCA inhibitor, a SERCA inhibitor, and a
therapeutic agent. In another embodiment, there is provided a method, comprising
contacting a T cell with the pharmaceutical composition comprising 5 a PMCA inhibitor,
as disclosed herein; or the pharmaceutical composition or combination comprising a
PMCA inhibitor, as disclosed herein, and a SERCA inhibitor; or the pharmaceutical
composition or combination comprising a PMCA inhibitor, a SERCA inhibitor, and a
therapeutic agent, wherein the T cell is a dysfunctional T cell.
10 [0107] used herein refers to a T cell in which
normal T cell function is impaired. Dysfunctional T cells include a T cell with a
compromised ability to eliminate pathogens or cancer, resulting in reduced
proliferation and diminished effector functions like cytotoxicity. In an embodiment, a
dysfunctional T cell is a T cell in a tumor microenvironment. Accordingly,
15 embodiments herein provide a method for restoring or treating T cell exhaustion. In an
embodiment, there is provided a method for restoring or treating T cell exhaustion in
a tumor microenvironment.
[0108] a human or non-human
mammal. It refers to a mammal in need of treatment for cancer. In certain
20 embodiments, the subject is a human. In certain embodiments, the subject is a patient
diagnosed with cancer. In other embodiments, the subject is a non-human mammal,
such as a mouse, rat, rabbit, dog, cat, pig, or non-human primate. In certain
embodiments, the subject is in need of treatment for a cancer selected from the group
consisting of ovarian cancer, colorectal cancer, melanoma, breast cancer, lung cancer,
25 pancreatic cancer, prostate cancer, gastric cancer, liver cancer, renal cancer, bladder
cancer, head and neck cancer, esophageal cancer, cervical cancer, endometrial cancer,
and hematological malignancies. In certain embodiments, the subject has cancer that
is resistant to immune checkpoint blockade therapy. In certain embodiments, the
29
subject has cancer that is resistant to chemotherapy. In certain embodiments, the
subject has previously received one or more cancer treatments, immune checkpoint
blockade therapy, adoptive cell therapy (or adoptive T cell therapy), or chemotherapy.
In certain embodiments, the subject is treatment-naive.
[0109] In some embodiments, there is provided a 5 method, comprising
administering to a subject a therapeutically effective amount of a PMCA inhibitor. In
another embodiments, there is provided a method, comprising administering to a
subject a therapeutically effective amount of a pharmaceutical composition or
combination comprising a PMCA inhibitor and a SERCA inhibitor; or a
10 pharmaceutical composition or combination comprising a PMCA inhibitor, a SERCA
inhibitor, and a therapeutic agent.
[0110] In certain embodiments, there is provided a method, comprising
administering to the subject the pharmaceutical composition comprising a PMCA
inhibitor, as disclosed herein; the pharmaceutical composition or combination
15 comprising a PMCA inhibitor, as disclosed herein, and a SERCA inhibitor ; or the
pharmaceutical composition or combination comprising PMCA inhibitor, a SERCA
inhibitor, and a therapeutic agent.
[0111] In some embodiments, there is provided a method, wherein the therapeutic
agent is selected from an immune checkpoint inhibitor, a VEGF neutralizing agent, a
20 chemotherapeutic drug, a PARP inhibitor, a TGF beta inhibitor, a lipid inhibitor,
adoptive T cell, or combination thereof.
[0112] The PMCA inhibitor and the SERCA inhibitor, may also be administered
in combination with adoptively transferred T cells. Accordingly, in some
embodiments, there is provided a method, wherein said method comprises
25 administering to the subject a therapeutic agent, wherein the therapeutic agent is
adoptively transferred T cells.
[0113] In some embodiments, the PMCA inhibitor and the SERCA inhibitor are
administered as a single composition or separate compositions.
30
[0114] In some embodiments, there is provided a method, wherein the PMCA
inhibitor is selected from a peptide inhibitor; a small molecule inhibitor; a nucleic acid
inhibitor; or combination thereof. In an embodiment, there is provided a method,
wherein the PMCA inhibitor is selected from peptide inhibitor, for eg: caloxin, or
5 shRNA.
[0115] In some embodiments, there is provided a method, wherein said peptide
inhibitor comprises a peptide having an amino acid sequence of at least 90% sequence
identity to a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3,
SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ
10 ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ
ID NO. 19 and SEQ ID NO. 20, or wherein the nucleic acid inhibitor is a shRNA
comprising a nucleotide sequence of at least 80% identity to a sequence selected from
a group consisting of SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO.
12, and SEQ ID NO. 13.
15 [0116] In an embodiment, there is provided a method, wherein the SERCA
inhibitor is selected from thapsigargin, cyclopiazonic acid, DBHQ, Mipsagargin,
Casearin J, or a derivative thereof.
[0117] In an embodiment, there is provided a method, wherein the immune
checkpoint inhibitor is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4
20 inhibitor, a CD39 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a
TIGIT inhibitor, a CD36 inhibitor, or combination thereof; wherein the anti-VEGF or
anti-VEGF receptor antibody is selected from Bevacizumab, Ramucirumab,
Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib or combination thereof;
wherein the chemotherapeutic drug is selected from Paclitaxel, Carboplatin,
25 Doxorubicin, Topotecan, Gemcitabine or combination thereof; wherein the PARP
inhibitor is selected from Olaparib, Niraparib, Rucaparib, Talazoparib or combination
thereof; wherein the TGF beta inhibitor is selected from Galunisertib, HYL001,
Vactosertib, SB-431542, Fresolimumab, AVID200, LY2109761, Pirfenidone,
31
Losartan, Ker-050 or combination thereof; or wherein the lipid inhibitor is selected
from Denifanstat, Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir,
Perhexiline, Ranolazine, simvastatin, atorvastatin, Edelfosine, Miltefosine and
combination thereof.
[0118] The method, according to embodiments herein, may 5 be used to treat
various cancers including, but not limited to, ovarian cancer, colorectal cancer,
melanoma, breast cancer, lung cancer, pancreatic cancer, prostate cancer, gastric
cancer, liver cancer, renal cancer, bladder cancer, head and neck cancer, esophageal
cancer, cervical cancer, endometrial cancer, and hematological malignancies.
10 Accordingly, in an embodiment, there is provided a method comprising administering
to a subject a therapeutically effective amount of a PMCA inhibitor, wherein the cancer
is selected from the group consisting of ovarian cancer, colorectal cancer, melanoma,
breast cancer, lung cancer, pancreatic cancer, prostate cancer, gastric cancer, liver
cancer, renal cancer, bladder cancer, head and neck cancer, glioblastoma, esophageal
15 cancer, cervical cancer, endometrial cancer, and hematological malignancies. In
another embodiment, there is provided a method comprising administering to a subject
a therapeutically effective amount of a combination comprising a PMCA inhibitor and
a SERCA inhibitor, wherein the cancer is selected from the group consisting of ovarian
cancer, colorectal cancer, melanoma, breast cancer, lung cancer, pancreatic cancer,
20 prostate cancer, gastric cancer, liver cancer, renal cancer, bladder cancer, head and
neck cancer, glioblastoma, esophageal cancer, cervical cancer, endometrial cancer, and
hematological malignancies. In another embodiment, there is provided a method
comprising administering to a subject a therapeutically effective amount of a PMCA
inhibitor, a SERCA inhibitor, and a therapeutic agent, wherein the cancer is selected
25 from the group consisting of ovarian cancer, colorectal cancer, melanoma, breast
cancer, lung cancer, pancreatic cancer, prostate cancer, gastric cancer, liver cancer,
renal cancer, bladder cancer, head and neck cancer, glioblastoma, esophageal cancer,
cervical cancer, endometrial cancer, and hematological malignancies.
32
[0119] In another embodiment, said administering is performed by intraperitoneal,
intratumoral, intravenous, intradermal, intramuscular, subcutaneous and/or oral
administration.
[0120] In certain embodiments, the PMCA inhibitor and the SERCA inhibitor are
administered as a single composition. In certain embodiments, the 5 PMCA inhibitor and
the SERCA inhibitor are administered separately.
[0121] Embodiments as disclosed herein may be used to enhance endogenous
anti-tumor immune responses across diverse cancer types. Further, the combination
comprising PMCA inhibitor and SERCA inhibitor, as disclosed herein, may also be
10 used to improve the activity of adoptively transferred immune cells (can be extended
to TCR-engineered T cells, CAR-T cells or tumor-infiltrating lymphocytes). It has
been observed by the present inventors that a combination of PMCA inhibitors and
SERCA inhibitors, achieves restoration of anti-tumor immunity in the context of
multiple cancer types. This combination shows potent anti-tumor activity as
15 monotherapy and improves survival when used in combination with existing immune
checkpoint inhibitors like anti-PD1. Their efficacy extends to both checkpoint-resistant
tumors (e.g. ID8 ovarian cancer) and checkpoint-responsive tumors (e.g. MC38
colorectal cancer), thus underscoring their broad therapeutic relevance. Furthermore,
they boost both endogenous immune responses and adoptively transferred immune
20 cells, thus offering a versatile immune-boosting platform applicable across multiple
malignancies and also a strategy for adoptive therapies such as CAR-T cell boosting.
Accordingly, in an embodiment, there is provided a method for improving the activity
of adoptively transferred immune cells in a subject, comprising administering to the
subject the pharmaceutical composition comprising a PMCA inhibitor, as disclosed
25 herein; or the pharmaceutical composition or combination comprising a PMCA
inhibitor, as disclosed herein, and a SERCA inhibitor; or a pharmaceutical composition
or combination comprising a PMCA inhibitor, as disclosed herein, and a SERCA
inhibitor, and a therapeutic agent.
33
[0122] Embodiments herein provide a method for preparing a pharmaceutical
composition as disclosed herein. In an embodiment, there is provided a process for
preparing the pharmaceutical composition as disclosed herein, comprising mixing a
PMCA inhibitor and a pharmaceutically acceptable carrier, to obtain the
pharmaceutical composition. Various pharmaceutically acceptable 5 carriers are known
and may be used in embodiments herein. In an embodiment, there is provided a
process, wherein the pharmaceutically acceptable carrier is selected from phosphate
buffer saline (PBS), lactose, glucose, dextrose, sucrose, sorbitol, mannitol, xylitol,
erythritol, maltitol, or combination thereof. In an embodiment, there is provided a
10 process, wherein the process further comprises mixing a SERCA inhibitor.
[0123] Embodiments herein provide a PMCA inhibitor for use in treating cancer
in a subject. In an embodiment, there is provided a PMCA inhibitor for use in treating
cancer in a subject. In an embodiment, there is provided a PMCA inhibitor for use in
enhancing T cell activity. In an embodiment, there is provided a PMCA inhibitor for
15 use in enhancing T cell activity.
[0124] Embodiments herein provide a combination of a PMCA inhibitor and a
SERCA inhibitor for treating cancer in a subject. In an embodiment, there is provided
a combination of PMCA inhibitor and a SERCA inhibitor for treating cancer in a
subject. In an embodiment, there is provided a combination of a PMCA inhibitor, a
20 SERCA inhibitor, and therapeutic agent, for treating cancer in a subject. In an
embodiment, there is provided a combination of PMCA inhibitor and a SERCA
inhibitor for enhancing T cell activity in a subject. In an embodiment, there is provided
a combination of a PMCA inhibitor, a SERCA inhibitor, and therapeutic agent, for
enhancing T cell activity.
25 [0125] Table 1 depicts the list of nucleotide and peptide sequences according to
the present disclosure.
34
Table 1:
Sequence ID Description Type Sequence
SEQ ID NO. 1 caloxin 1c2 amino acid TAWSEVLDLLRRGGGSK
SEQ ID NO. 2 caloxin 1c1 amino acid TTWSEVVHRLSRGGGSK
SEQ ID NO. 3 caloxin 1c3 amino acid ASWSEVLHLLSRGGGSK
SEQ ID NO. 4 caloxin 1b1 amino acid TAWSEVLHLLSRGGG
SEQ ID NO. 5 caloxin 1b3 amino acid TIPKWISIIQALRGGGSK
SEQ ID NO. 6 caloxin 2a1 amino acid VSNSNWPSFPSSGGG
SEQ ID NO. 7 caloxin 3a1 amino acid WSSTSSVSAPLEFGGGGSAK
SEQ ID NO. 8 P1 peptide amino acid MRMKRADDFIREHGGRR
SEQ ID NO. 9 shRNA
against
PMCA1-1
nucleotide CCGGGCCTACAATTTACCTTGT
TAACTCGAGTTAACAAGGTAA
ATTGTAGGCTTTTTG
SEQ ID NO. 10 shRNA
against
PMCA1-2
nucleotide CCGGCCAGAGAAAGAGGGTGG
ATTACTCGAGTAATCCACCCTC
TTTCTCTGGTTTTTG
SEQ ID NO. 11 shRNA
against
PMCA4-1
nucleotide CCGGGATGCACTGACCCAGAT
TAATCTCGAGATTAATCTGGGT
CAGTGCATCTTTTTG
SEQ ID NO. 12 shRNA
against
PMCA4-2
nucleotide CCGGGGGCATCCATTACCGTCA
AATCTCGAGATTTGACGGTAAT
GGATGCCCTTTTTG
SEQ ID NO. 13 shRNA
against
PMCA4-3
nucleotide CCGGCCCTTGATTTAGTTCCAG
AATCTCGAGATTCTGGAACTAA
ATCAAGGGTTTTTG
SEQ ID NO. 14 P3 peptide amino acid TAWSEVLDLLRR
SEQ ID NO. 15 P2 peptide amino acid TTWSEVVHRLSR
SEQ ID NO. 16 P4 peptide amino acid ASWSEVLHLLSR
SEQ ID NO. 17 P5 peptide amino acid TAWSEVLHLLSR
SEQ ID NO. 18 P6 peptide amino acid TIPKWISIIQALR
SEQ ID NO. 19 P7 peptide amino acid VSNSNWPSFPSS
SEQ ID NO. 20 P8 peptide amino acid WSSTSSVSAPLEF
35
[0126] A number of implementations have been described. Nevertheless, it will be
understood that although the subject matter has been described with reference to
specific embodiments, this description is not meant to be construed in a limiting sense.
Various modifications of the disclosed embodiments, as well as alternate embodiments
of the subject matter, will become apparent to persons skilled in the 5 art upon reference
to the description of the subject matter. It is therefore contemplated that such
modifications can be made without departing from the spirit or scope of the present
subject matter as defined.
EXAMPLES
10 [0127] The disclosure will now be illustrated with following examples, which
is intended to illustrate the working of disclosure and not intended to take
restrictively to imply any limitations on the scope of the present disclosure. Unless
defined otherwise, all technical and scientific terms used herein have the same
meaning as commonly understood to one of ordinary skill in the art to which this
15 disclosure belongs. Although methods and materials similar or equivalent to those
described herein can be used in the practice of the disclosed methods and
compositions, the exemplary methods, devices and materials are described herein.
It is to be understood that this disclosure is not limited to particular methods, and
experimental conditions described, as such methods and conditions may vary.
20
Materials and Methods
[0128] Caloxin 1c2 (molecular weight 1844g/mol) (from Genscript) (SEQ ID NO.
1), and Thapsigargin (molecular weight 650.72 g/mol) (from Invitrogen (T7458)).
25 Example 1: Preparation of pharmaceutical composition.
36
[0129] The lyophilized caloxin 1c2 was reconstituted in dimethyl sulfoxide
(DMSO) to prepare 10mM stock solution. The stock solution was vortexed gently until
complete dissolution was visually confirmed.
[0130] The lyophilized thapsigargin was reconstituted in dimethyl sulfoxide
(DMSO) to prepare 1 stock solution. The stock solution was vortexed 5 gently until
complete dissolution was visually confirmed.
[0131] For preparing a pharmaceutical composition having a combination of
caloxin 1c2 and thapsigargin. The caloxin 1c2 and thapsigargin stock solutions were
10 composition. This working composition is termed as CAMPI (Calcium Modulation
using Pump Inhibition). The resulting mixture contained caloxin 1c2 at a final
Nm (also
represented as C50T10).
[0132] Similarly, compositions having concentration of 100 of caloxin 1c2
15 and 10 nM of thapsigargin (C100T10), 50 of caloxin 1c2 and 10 nM of thapsigargin
(C100T10), and 50 of caloxin 1c2 and 50 nM of thapsigargin (C50T50), etc were
prepared and evaluated.
[0133] For in vivo
composition via the designated injection route. All animals received an identical final
20 c
volume.
[0134] The working concentrations of c or 0.0092% w/w) and
thapsigargin (10 nM or 6.5 x 10-7 % w/w) were also used for ex vivo rescue assays
unless otherwise specified.
25
Example 2: PMCA and SERCA inhibition using different CAMPI concentrations
(ex-vivo).
37
[0135] To assess the role of PMCA pumps in T cell dysfunction, the prepared
composition (CAMPI, refer Example 1) was used to boost the calcium content and
downstream nuclear mobilization of calcium-dependent transcription factors. CAMPI
treatment partially restored cytosolic calcium in ascites-exposed T cells, highlighting
the importance of PMCA as depicted in (a) of FIG. 1. Further calcium 5 level is not
sustained when caloxin and thapsigargin (50 uM and 10 nM respectively) are used
alone as depicted in (b) of FIG. 1, as opposed to the combination.
[0136] Further, different ratios of the individual components of CAMPI, (i.e.
thapsigargin and caloxin) were used, to determine the extent of rescue in ascites-treated
10 murine T cells. The CAMPI cocktail indeed restored the NFAT and AP1 levels in the
Jurkat T cells over 8 hours of incubation at varying component ratios as shown in (c)
of FIG. 1. T10 and T50 denote 10 nM and 50 nM of thapsigargin, and C50 and C100
denote 50 uM and 100 uM of caloxin. A combination of caloxin and thapsigargin
achieved restoration of the transcription factor levels.
15 [0137] Additionally, calcium flux in murine T cells was tested at different caloxin
concentrations, keeping the thapsigargin constant as depicted in (d) of FIG. 1.
Furthermore, restoration of NFAT and AP1 levels at different caloxin concentrations,
keeping the thapsigargin constant was also evaluated as shown in (e) of FIG. 1.
20 Example 3: Preparation of Lentiviral particles carrying shRNA against PMCA1/4
[0138] Procedure:
lentiviral production. These cells were transfected with a transfer plasmid vector such
(SEQ ID NO. 9 and
13) against the target gene, along with the packaging and envelope plasmids, using a
25
[0139] Viral supernatant was collected at 48 and 72 hours after transfection, then
clarified through a 0.45-micron filter and concentrated by centrifugation at 4000 rf and
4°C.
38
the concentrated lentivirus by spinoculation at 2000rcf and 32°C in a 6 well plate. After
48 hours, puromycin selection was applied with two rounds of selection to obtain
successfully transduced cells which were then used for functional validation. shRNAmediated
knockdown/inhibition of PMCA1/4 was also evaluated, along with
thapsigargin, wherein thapsigargin was used at a concentration of 10 5 nM or 6.5 x 10-7
% w/w in PBS.
Example 4: Evaluating Lentiviral particles carrying shRNA.
[0140] To establish the functional specificity of PMCA in inhibiting T cells
10 further, shRNA-mediated knockdown of the PMCA pumps in cells was performed.
This was done using lentiviral transduction of shRNAs (SEQ ID NO. 9 and 13) into T
cells. The lentiviral particles were prepared in accordance with Example 3. Western
blot was done to validate the knockdown of pumps in Jurkat T cells. PMCA-silenced
cells also showed higher intracellular calcium and elevated NFAT and AP1 activity
15 compared to controls, regardless of the T cell activation method, further confirming
the role of PMCA pumps in regulating T cell signaling in presence of tumor
microenvironment as illustrated in (f) of FIG. 1. Further, for the NFAT and AP1
activity, X axis represents treatment conditions, Y axis represents the percentage of
cells showing fluorescence. For intracellular calcium, X axis shows elapsed time and
20 Y axis represents median fluorescent intensity of the Fluo4-AM dye.
[0141] NFAT and AP1 levels in Jurkat TPR cells are illustrated in (g) of FIG. 1,
where shRNA-mediated knockdown of PMCA1/4 has been done, along with
thapsigargin treatment.
25 Example 5: Restoration of effector functions of T cells using CAMPI (ex-vivo).
[0142] To further assess the efficacy of CAMPI, its effects on murine primary
CD8+ T cells (obtained from healthy C57Bl6 female mice ) were tested in the context
of malignant ascites from advanced ovarian cancer-bearing mice.
39
[0143] Procedure: The proliferation assay was carried out using cells that were
labelled with CFSE proliferation marker. As the cell divided, the CFSE signal
diminished and gave rise to distinct peaks. These peaks correspond to the number of
divisions the cells underwent. The CAMPI used here contained 50 uM caloxin and 10
5 nM thapsigargin.
[0144] CAMPI significantly rescued the calcium levels as depicted in (a) of FIG.
2, and the proliferation capacity of ascites-treated CD8+ T cells, indicating its potential
to sustain long-term T cell function as depicted in (b) of FIG. 2.
[0145] CAMPI also effectively reinstated expression of the activation marker
10 CD69 (as depicted in (c) of FIG. 2), and both the components of CAMPI together
rescued the effector cytokine IFN- 2), and the memory
marker CD44 (as shown in (e) of FIG. 2), highlighting their role in reactivating both
effector and memory T cell responses.
[0146]
15
proliferation and adherence of ovarian cancer cells as shown in (f) of FIG. 2, while
in (g) of FIG. 2.
20 Example 6: Induction of anti-tumor immunity by CAMPI monotherapy in preclinical
murine model of ovarian cancer (in-vivo).
[0147] The efficacy of CAMPI was evaluated in-vivo using a preclinical model of
ovarian cancer which involves ID8 ovarian cancer cells tagged with luciferase.
Luciferase expression allowed the real time monitoring of tumor burden in live animals
25 thus helping in evaluating the efficacy of CAMPI administration.
[0148] Procedure: CAMPI (10nM final concentration of thapsigargin and 50 uM
caloxin, per 100 ul of PBS) was administered 3 times a week and bioluminescence
imaging (BLI) was performed to quantify the tumor burden as represented in (a) of
40
FIG. 3. The quantification was done by checking for luciferase signal using IVIS (In
vivo imaging system) by capturing the bioluminescent light after injection of Dluciferin
substrate into the animal. The emitted light intensity co-relates with the cell
number and hence the tumor burden since the tumor cells were tagged with luciferase.
[0149] Whole-body bioluminescent imaging revealed a noticeable 5 reduction in
tumor burden in therapy-treated mice compared to vehicle controls (as depicted in (b)
and (c) of FIG. 3). CAMPI treatment also limited the extent of metastatic spread, as
indicated by reduced luciferase signal area, and mitigated ascites accumulation, as
evidenced by reduced weight gain relative to controls (DMSO in PBS) shown in (c) of
10 FIG. 3.
[0150] Further, CAMPI monotherapy significantly improved overall survival of
tumor-bearing mice as illustrated in (d) of FIG. 3. However, since mice were allowed
to survive until reaching a moribund state, no significant differences were observed
between treated and control groups in the final volume of ascites collected, luciferase
15 expression normalized per million cells, or total peritoneal cell counts as shown in (e)
of FIG. 3.
Example 7: Efficacy of CAMPI along with anti-PD1 treatment against immune
checkpoint inhibitor tumor model (in-vivo).
20 [0151] To evaluate the efficacy of CAMPI along with already existing checkpoint
inhibitor anti-PD1, in a checkpoint-resistant model, the luciferase tagged ID8 ovarian
cancer cells were used, which are highly resistant to conventional checkpoint blockade.
[0152] Procedure: ID8 cells, spontaneously transformed ovarian surface epithelial
cancer cell line, obtained from C57Bl/6 mice were implanted intraperitoneally in
25 C57bl/6 mice and evaluated if CAMPI could potentiate the therapeutic response when
combined with anti-PD1. Mice were either left untreated i.e. vehicle control/mock
(DMSO in PBS) or treated with 200 ug of anti-PD1 twice a week, in combination with
41
CAMPI (10nM final concentration of thapsigargin and 50 uM caloxin, per 100 ul of
PBS) as shown in (a) of FIG. 4.
[0153] Longitudinal bioluminescent imaging revealed that the combination
treatments significantly reduced the overall tumor burden and metastatic spread by day
40 as indicated by decrease in luciferase signal. Untreated mice developed 5 pronounced
ascites, as evidenced by increased abdominal distension and weight gain, whereas
treatment groups showed delayed disease progression as shown in (b), (c), (d) and (e)
of FIG. 4.
[0154] Furthermore, Kaplan-Meier analysis revealed a marked survival benefit in
10 mice receiving combination therapy as depicted in (f) of FIG. 4. Together, these
findings indicate that CAMPI synergizes with anti-PD1 to augment anti-tumor
immunity in an otherwise anti-PD1-monotherapy resistant cancer model.
Example 8: Efficacy of CAMPI along with other therapeutic agents in ovarian
15 cancer (in-vivo).
[0155] To investigate whether CAMPI treatment could augment the therapeutic
efficacy of PARP inhibition in a BRCA-proficient setting, ID8-p53 mutant-BRCAwild
type ovarian cancer cells tagged with luciferase were implanted intraperitoneally
into C57Bl/6J mice.
20 [0156] CAMPI in combination with olaparib, a potent PARP inhibitor, was
administered subcutaneously (50 mg/kg), on every alternate day.
[0157] Olaparib has previously demonstrated significant long-term clinical
benefits. PARP inhibition is most effective in homologous recombination deficient,
particularly BRCA1/2 mutant cancers, and generally shows limited efficacy in tumors
25 with intact BRCA function.
[0158] As depicted in (a) and (b) of FIG. 5, longitudinal bioluminescence imaging
(total photon flux) on day 22, the combination treatment reduced tumor burden
42
compared to olaparib monotherapy, suggesting that CAMPI enhances the anti-tumor
effects of olaparib in a homologous recombination-proficient ovarian cancer.
Example 9: Efficacy of CAMPI across multiple murine models of cancer (in-vivo).
[0159] For determining the efficacy of CAMPI in other preclinical 5 cancer models,
two different tumor models: MC38 colon carcinoma and B16F10 melanoma cells from
C57BL/6 mice were used.
[0160] Procedure: 1 million MC38 or B16F10 cancer cells were injected
subcutaneously into immunocompetent C57BL/6 mice, and CAMPI or vehicle control
10 was administered intratumorally thrice a week. Tumor growth was measured everyday
using vernier calliper from the day a palpable mass was observed (approximately
around 10th day) and weight of the animal was measured every alternate day.
[0161] In both the models, compared to mock (vehicle control), which displayed
a rapid and continuous increase in tumor volume, mice receiving CAMPI exhibited
15 markedly reduced tumor progression, indicating a lesser tumor burden in these mice.
No significant weight change was observed (as depicted in (a) and (b) of FIG. 6). These
results suggest that CAMPI exhibits therapeutic efficacy beyond the ovarian cancer
model, thus demonstrating their potential as versatile immunotherapeutic agents across
multiple cancer types.
20
Example 10: Efficacy of CAMPI across multiple modes of administration (invivo).
[0162] To enhance systemic absorption and investigate whether CAMPI administration
remains effective if delivered via alternate routes, CAMPI was administered
25 subcutaneously rather than intratumorally. MC38 colon carcinoma cells were
implanted subcutaneously into one flank of C57Bl/6J mice, and CAMPI was
administered subcutaneously on the opposite flank on alternate days as depicted in (a)
of FIG. 7.
43
[0163] Subcutaneous CAMPI treatment resulted in a significant reduction in
tumor volume over one week compared to vehicle treated controls (mock) as depicted
in (b) of FIG. 7. These findings indicate that CAMPI remains effective when delivered
via an alternate route, and may in fact, produce a superior therapeutic benefit compared
to intratumoral administration, which is likely due to more efficient 5 lymphatic
drainage, optimal antigen presentation and robust T cell priming.
Example 11: Impact of CAMPI on adoptively transferred antigen-specific CD8+
T cells (in-vivo).
10 [0164] Procedure: To study the impact of CAMPI on adoptively transferred antigenspecific
CD8+ T cell responses, MC38-ova tumor cells were subcutaneously injected
into athymic nude (Nu/J) mice that lack mature T cells. 7 days later, OT1-CTLs were
intravenously transferred via tail vein injection. This was followed by intratumoral
CAMPI administration thrice a week or left untreated (mock) as described in (a) of
15 FIG. 8.
[0165] It was observed that the adoptive transfer of OT1-CTLs alone delayed tumor
progression initially but failed to sustain control, with tumors relapsing rapidly
thereafter. OT1-only mice also exhibited a marked decline in body weight around 12
days post-ACT, coinciding with tumor relapse. In contrast, mice treated with CAMPI
20 showed complete tumor regression and maintained stable body weight, indicating
improved disease control and better physiological status. Further analysis of the
adoptively transferred CD8 T cells showed that CAMPI injection resulted in a notable
increase in the of OT-1 cells from retro-orbital sinus 7 days after the adoptive transfer
(as depicted in (b), (c) and (d) of FIG. 8). These findings suggest that PMCA1/4
25 inhibition not only enhances endogenous immunity but also significantly boosts the
efficacy and persistence of adoptively transferred antigen-specific CD8+ T cells, and
thus could be useful in augmenting CAR-T therapies in cancer.
44
Example 12: Impact of PMCA-targeted peptides other than caloxin1c2 for
rescuing T cell signaling (in-vivo).
[0166] To determine whether alternative PMCA-targeting peptides could
recapitulate the effects of caloxin within the CAMPI cocktail, thapsigargin was used
in combination along with either of the two distinct peptides, P1 peptide 5 (SEQ ID NO.
8) or P2 peptide (SEQ ID NO. 15).
[0167] Compositions having P1 peptide () and thapsigargin (10nM); and P2
peptide () and thapsigargin (10nM), were independently prepared using a method
similar to that described in Example 1 hereinabove.
10 [0168] P1 peptide was designed in silico to target the extracellular domains of
PMCA1 and PMCA4, while P2 peptide is a modified version of the commercially
available peptide caloxin1c2.
[0169] Both P1 and P2 peptides effectively restored intracellular NFAT levels (as
depicted in FIG. 9) in the presence of malignant ascites (as seen by increase in FITC
15 fluorescence by flow cytometry), indicating that they function similarly to caloxin and
synergize with thapsigargin to rescue T cell signaling under immunosuppressive
conditions.
45
I/We Claim:
1. A pharmaceutical composition for treating cancer, comprising a PMCA
(plasma membrane Ca2+-ATPase) inhibitor and a pharmaceutically acceptable
carrier.
2. The pharmaceutical composition as claimed in claim 1, further 5 comprising a
SERCA (Sarco/Endoplasmic Reticulum Ca2+-ATPase) inhibitor.
3. The pharmaceutical composition as claimed in claim 1, wherein the PMCA
inhibitor inhibits PMCA1, PMCA4, or both, and wherein the PMCA inhibitor
is selected from a peptide inhibitor; a small molecule inhibitor; a nucleic acid
10 inhibitor; or a combination thereof.
4. The pharmaceutical composition as claimed in claim 3, wherein the peptide
inhibitor comprises a peptide having an amino acid sequence of at least 90%
sequence identity to a sequence selected from a group consisting of SEQ ID
NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID
15 NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ
ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, and SEQ ID
NO. 20; or wherein the nucleic acid inhibitor is an shRNA comprising a
nucleotide sequence of at least 80% identity to a sequence selected from a group
consisting of SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, ID NO. 12, and
20 SEQ ID NO. 13.
5. The pharmaceutical composition as claimed in claim 1, wherein the SERCA
inhibitor is selected from thapsigargin, cyclopiazonic acid, 2,5-di-tertbutylhydroquinone
(DBHQ), Mipsagargin, Casearin J, or a derivative thereof.
46
6. The pharmaceutical composition as claimed in claim 1, wherein the
pharmaceutically acceptable carrier is selected from aqueous vehicles; sugars
or sugar alcohols; starches or cellulose derivatives; proteins or polymers; lipids;
surfactants; preservatives; antioxidants; pH adjusting agents; tonicity adjusting
agents; chelating agents; viral vectors; non-viral delivery 5 systems, or
combination thereof.
7. The pharmaceutical composition as claimed in claim 2, wherein the PMCA
inhibitor and the SERCA inhibitor are present at a molar ratio in the range of
500:1 to 10000:1, preferably 5000:1, or wherein the PMCA inhibitor is present
10 at a weight percentage in the range of 0.002% to 0.04% w/w and the SERCA
inhibitor is present at a weight percentage in the range of 5 x 10-7 % to 2 x 10-4
% w/w, in respect of the total composition.
8. A kit for treating cancer, said kit comprising a PMCA (plasma membrane
Ca2+-ATPase) inhibitor; and optionally, a SERCA (Sarco/Endoplasmic
15 -ATPase) inhibitor.
9. The kit as claimed in claim 8, wherein the PMCA inhibitor and the SERCA
inhibitor are present in a single pharmaceutical composition.
10. The kit as claimed in claim 8, wherein the PMCA inhibitor is selected from a
peptide inhibitor; a small molecule inhibitor; a nucleic acid inhibitor; or
20 combination thereof.
11. The kit as claimed in claim 8, wherein said peptide inhibitor comprises a
peptide having an amino acid sequence of at least 90% sequence identity to a
sequence selected from a group consisting of SEQ ID NO: 1, SEQ ID NO: 2,
SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
47
7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID
NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20 or wherein the
nucleic acid inhibitor is an shRNA comprising a nucleotide sequence of at least
80% identity to a sequence selected from a group consisting of SEQ ID NO. 9,
SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, 5 and SEQ ID NO. 13.
12. The kit as claimed in claim 8, wherein the PMCA inhibitor and the SERCA
inhibitor are present at a molar ratio of 500:1 to 10000:1, preferably 5000:1.
13. The kit as claimed in claim 8, wherein the kit further comprises a therapeutic
agent selected from an immune checkpoint inhibitor, vascular endothelial
10 growth factor (VEGF) neutralizing agent, a chemotherapeutic drug, poly ADPribose
polymerase (PARP) inhibitor, Transforming growth factor beta (TGF-)
inhibitor, lipid inhibitor, adoptive T cell, or a combination thereof.
14. The kit as claimed in claim 13, wherein the immune checkpoint inhibitor is
selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a CD39
15 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT
inhibitor, a CD36 inhibitor, or combination thereof; wherein the VEGF
neutralizing agent is an anti-VEGF antibody or anti-VEGF receptor antibody,
wherein the VEGF neutralizing agent is selected from Bevacizumab,
Ramucirumab, Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib, or
20 combination thereof; wherein the chemotherapeutic drug is selected from
Paclitaxel, Carboplatin, Doxorubicin, Topotecan, Gemcitabine, or combination
thereof; wherein the PARP inhibitor is selected from Olaparib, Niraparib,
Rucaparib, Talazoparib, or combination thereof; wherein the TGF beta
inhibitor is selected from Galunisertib, HYL001, Vactosertib, SB-431542,
48
Fresolimumab, AVID200, LY2109761, Pirfenidone, Losartan, Ker-050, or
combination thereof; or wherein the lipid inhibitor is selected from Denifanstat,
Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline,
Ranolazine, simvastatin, atorvastatin, Edelfosine, Miltefosine, and combination
5 thereof.
15. A method of enhancing T cell activity, comprising contacting the T cell with a
PMCA inhibitor; or a combination comprising a PMCA inhibitor and a SERCA
inhibitor.
16. The method as claimed in claim 15, comprising contacting the T cell with the
10 pharmaceutical composition comprising a PMCA inhibitor, as claimed in claim
1 or 2; or a combination comprising a PMCA inhibitor and a SERCA inhibitor.
17. The method as claimed in claim 15, wherein said method comprises contacting
the T cell with a therapeutic agent selected from an immune checkpoint
inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a PARP
15 inhibitor, a TGF beta inhibitor, a lipid inhibitor, adoptive T cell, or combination
thereof.
18. The method as claimed in claim 15, wherein the PMCA inhibitor and the
SERCA inhibitor are provided in a single composition or separate composition.
19. The method as claimed in claim 15, wherein the PMCA inhibitor is selected
20 from a peptide inhibitor; a small molecule inhibitor; a nucleic acid inhibitor; or
combination thereof.
20. The method as claimed in claim 19, wherein said peptide inhibitor comprises a
peptide having an amino acid sequence of at least 90% sequence identity to a
sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ
49
ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ
ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO.
18, SEQ ID NO. 19 and SEQ ID NO. 20; or wherein the nucleic acid inhibitor
is an shRNA comprising a nucleotide sequence of at least 80% identity to a
sequence selected from a group consisting of SEQ ID NO. 5 9, SEQ ID NO. 10,
SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 13, or wherein the SERCA
inhibitor is selected from thapsigargin, cyclopiazonic acid, DBHQ,
Mipsagargin, Casearin J, or a derivative thereof.
21. The method as claimed in claim 17, wherein the immune checkpoint inhibitor
10 is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a
CD39 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT
inhibitor, a CD36 inhibitor, or combination thereof; wherein the VEGF
neutralizing agent is an anti-VEGF antibody or anti-VEGF receptor antibody,
wherein the VEGF neutralizing agent is selected from Bevacizumab,
15 Ramucirumab, Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib, or
combination thereof; wherein the chemotherapeutic drug is selected from
Paclitaxel, Carboplatin, Doxorubicin, Topotecan, Gemcitabine, or combination
thereof; wherein the PARP inhibitor is selected from Olaparib, Niraparib,
Rucaparib, Talazoparib, or combination thereof; wherein the TGF beta
20 inhibitor is selected from Galunisertib, HYL001, Vactosertib, SB-431542,
Fresolimumab, AVID200, LY2109761, Pirfenidone, Losartan, Ker-050, or
combination thereof; or wherein the lipid inhibitor is selected from Denifanstat,
Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline,
50
Ranolazine, simvastatin, atorvastatin, Edelfosine, Miltefosine, and combination
thereof.
22. A method of treating cancer in a subject, comprising administering to the
subject a PMCA inhibitor; or a combination comprising a PMCA inhibitor and
5 a SERCA inhibitor.
23. The method as claimed in claim 22, comprising administering to the subject the
pharmaceutical composition comprising a PMCA inhibitor, as claimed in claim
1 or 2; or combination comprising a PMCA inhibitor and a SERCA inhibitor.
24. The method as claimed in claim 22, wherein said method further comprises
10 administering to the subject a therapeutic agent selected from an immune
checkpoint inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a
PARP inhibitor, a TGF beta inhibitor, a lipid inhibitor, adoptive T cell, or
combination thereof
25. The method as claimed in claim 22, wherein the PMCA inhibitor and the
15 SERCA inhibitor are administered as a single composition or separate
composition.
26. The method as claimed in claim 22, wherein the PMCA inhibitor is peptide
inhibitor comprising a peptide having an amino acid sequence of at least 90%
sequence identity to a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2,
20 SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID
NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20, or wherein said
PMCA inhibitor is a nucleic acid inhibitor comprising a nucleotide sequence of
51
at least 80% identity to a sequence selected from a group consisting of SEQ ID
NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 13.
27. The method as claimed in claim 22, wherein the SERCA inhibitor is selected
from thapsigargin, cyclopiazonic acid, DBHQ, Mipsagargin, Casearin J or a
derivative 5 thereof.
28. The method as claimed in claim 22, wherein the immune checkpoint inhibitor
is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a
CD39 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT
inhibitor, a CD36 inhibitor, or combination thereof; wherein the anti-VEGF or
10 anti-VEGF receptor antibody is selected from Bevacizumab, Ramucirumab,
Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib or combination
thereof; wherein the chemotherapeutic drug is selected from Paclitaxel,
Carboplatin, Doxorubicin, Topotecan, Gemcitabine or combination thereof;
wherein the PARP inhibitor is selected from Olaparib, Niraparib, Rucaparib,
15 Talazoparib or combination thereof; wherein the TGF beta inhibitor is selected
from Galunisertib, HYL001, Vactosertib, SB-431542, Fresolimumab,
AVID200, LY2109761, Pirfenidone, Losartan, Ker-050 or combination
thereof; or wherein the lipid inhibitor is selected from Denifanstat, Orlistat,
Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline, Ranolazine,
20 simvastatin, atorvastatin, Edelfosine, Miltefosine and combination thereof.
29. The method as claimed in claim 22, wherein the cancer is selected from the
group consisting of ovarian cancer, colorectal cancer, melanoma, breast cancer,
lung cancer, pancreatic cancer, prostate cancer, gastric cancer, liver cancer,
52
renal cancer, bladder cancer, head and neck cancer, glioblastoma, esophageal
cancer, cervical cancer, endometrial cancer, and hematological malignancies.
30. The method as claimed in claim 22, wherein said administering is performed
by intraperitoneal, intratumoral, intravenous, intradermal, intramuscular,
subcutaneous and/or oral 5 administration.
31. A process for preparing the pharmaceutical composition as claimed in claim 1,
comprising mixing a PMCA inhibitor and a pharmaceutically acceptable
carrier; and optionally mixing a SERCA inhibitor, to obtain the pharmaceutical
composition.
10 32. A PMCA inhibitor for use in treating cancer in a subject, or for enhancing T
cell activity.
33. A combination comprising a PMCA inhibitor and a SERCA inhibitor for
treating cancer in a subject, or for enhancing T cell activity.
34. The combination, as claimed in claim 33, further comprising a therapeutic agent
15 selected from an immune checkpoint inhibitor, a VEGF neutralizing agent, a
chemotherapeutic drug, a PARP inhibitor, a TGF beta inhibitor, a lipid
inhibitor, adoptive T cell, or combination thereof.
53
ABSTRACT
CALCIUM ATPASE MODULATION FOR CANCER IMMUNOTHERAPY,
COMPOSITIONS, METHODS AND KITS THEREFOR
The present disclosure provides a pharmaceutical composition/combination for
treating cancer, comprising a PMCA (plasma membrane Ca2+-ATPase) 5 inhibitor, or
PMCA (plasma membrane Ca2+-ATPase) inhibitor and a SERCA (Sarco/Endoplasmic
Reticulum Ca2+-ATPase) inhibitor; and a pharmaceutically acceptable carrier. The
disclosure also provides a kit for treating cancer comprising a PMCA (plasma
membrane Ca2+-ATPase) inhibitor, or PMCA (plasma membrane Ca2+-ATPase)
10 inhibitor and a SERCA (Sarco/Endoplasmic Reticulum Ca2+-ATPase) inhibitor.
Methods of enhancing T cell activity, or treating cancer in a subject.
54 , Claims:I/We Claim:
1. A pharmaceutical composition for treating cancer, comprising a PMCA
(plasma membrane Ca2+-ATPase) inhibitor and a pharmaceutically acceptable
carrier.
2. The pharmaceutical composition as claimed in claim 1, further 5 comprising a
SERCA (Sarco/Endoplasmic Reticulum Ca2+-ATPase) inhibitor.
3. The pharmaceutical composition as claimed in claim 1, wherein the PMCA
inhibitor inhibits PMCA1, PMCA4, or both, and wherein the PMCA inhibitor
is selected from a peptide inhibitor; a small molecule inhibitor; a nucleic acid
10 inhibitor; or a combination thereof.
4. The pharmaceutical composition as claimed in claim 3, wherein the peptide
inhibitor comprises a peptide having an amino acid sequence of at least 90%
sequence identity to a sequence selected from a group consisting of SEQ ID
NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID
15 NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ
ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, and SEQ ID
NO. 20; or wherein the nucleic acid inhibitor is an shRNA comprising a
nucleotide sequence of at least 80% identity to a sequence selected from a group
consisting of SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, ID NO. 12, and
20 SEQ ID NO. 13.
5. The pharmaceutical composition as claimed in claim 1, wherein the SERCA
inhibitor is selected from thapsigargin, cyclopiazonic acid, 2,5-di-tertbutylhydroquinone
(DBHQ), Mipsagargin, Casearin J, or a derivative thereof.
46
6. The pharmaceutical composition as claimed in claim 1, wherein the
pharmaceutically acceptable carrier is selected from aqueous vehicles; sugars
or sugar alcohols; starches or cellulose derivatives; proteins or polymers; lipids;
surfactants; preservatives; antioxidants; pH adjusting agents; tonicity adjusting
agents; chelating agents; viral vectors; non-viral delivery 5 systems, or
combination thereof.
7. The pharmaceutical composition as claimed in claim 2, wherein the PMCA
inhibitor and the SERCA inhibitor are present at a molar ratio in the range of
500:1 to 10000:1, preferably 5000:1, or wherein the PMCA inhibitor is present
10 at a weight percentage in the range of 0.002% to 0.04% w/w and the SERCA
inhibitor is present at a weight percentage in the range of 5 x 10-7 % to 2 x 10-4
% w/w, in respect of the total composition.
8. A kit for treating cancer, said kit comprising a PMCA (plasma membrane
Ca2+-ATPase) inhibitor; and optionally, a SERCA (Sarco/Endoplasmic
15 -ATPase) inhibitor.
9. The kit as claimed in claim 8, wherein the PMCA inhibitor and the SERCA
inhibitor are present in a single pharmaceutical composition.
10. The kit as claimed in claim 8, wherein the PMCA inhibitor is selected from a
peptide inhibitor; a small molecule inhibitor; a nucleic acid inhibitor; or
20 combination thereof.
11. The kit as claimed in claim 8, wherein said peptide inhibitor comprises a
peptide having an amino acid sequence of at least 90% sequence identity to a
sequence selected from a group consisting of SEQ ID NO: 1, SEQ ID NO: 2,
SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
47
7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID
NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20 or wherein the
nucleic acid inhibitor is an shRNA comprising a nucleotide sequence of at least
80% identity to a sequence selected from a group consisting of SEQ ID NO. 9,
SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, 5 and SEQ ID NO. 13.
12. The kit as claimed in claim 8, wherein the PMCA inhibitor and the SERCA
inhibitor are present at a molar ratio of 500:1 to 10000:1, preferably 5000:1.
13. The kit as claimed in claim 8, wherein the kit further comprises a therapeutic
agent selected from an immune checkpoint inhibitor, vascular endothelial
10 growth factor (VEGF) neutralizing agent, a chemotherapeutic drug, poly ADPribose
polymerase (PARP) inhibitor, Transforming growth factor beta (TGF-)
inhibitor, lipid inhibitor, adoptive T cell, or a combination thereof.
14. The kit as claimed in claim 13, wherein the immune checkpoint inhibitor is
selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a CD39
15 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT
inhibitor, a CD36 inhibitor, or combination thereof; wherein the VEGF
neutralizing agent is an anti-VEGF antibody or anti-VEGF receptor antibody,
wherein the VEGF neutralizing agent is selected from Bevacizumab,
Ramucirumab, Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib, or
20 combination thereof; wherein the chemotherapeutic drug is selected from
Paclitaxel, Carboplatin, Doxorubicin, Topotecan, Gemcitabine, or combination
thereof; wherein the PARP inhibitor is selected from Olaparib, Niraparib,
Rucaparib, Talazoparib, or combination thereof; wherein the TGF beta
inhibitor is selected from Galunisertib, HYL001, Vactosertib, SB-431542,
48
Fresolimumab, AVID200, LY2109761, Pirfenidone, Losartan, Ker-050, or
combination thereof; or wherein the lipid inhibitor is selected from Denifanstat,
Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline,
Ranolazine, simvastatin, atorvastatin, Edelfosine, Miltefosine, and combination
5 thereof.
15. A method of enhancing T cell activity, comprising contacting the T cell with a
PMCA inhibitor; or a combination comprising a PMCA inhibitor and a SERCA
inhibitor.
16. The method as claimed in claim 15, comprising contacting the T cell with the
10 pharmaceutical composition comprising a PMCA inhibitor, as claimed in claim
1 or 2; or a combination comprising a PMCA inhibitor and a SERCA inhibitor.
17. The method as claimed in claim 15, wherein said method comprises contacting
the T cell with a therapeutic agent selected from an immune checkpoint
inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a PARP
15 inhibitor, a TGF beta inhibitor, a lipid inhibitor, adoptive T cell, or combination
thereof.
18. The method as claimed in claim 15, wherein the PMCA inhibitor and the
SERCA inhibitor are provided in a single composition or separate composition.
19. The method as claimed in claim 15, wherein the PMCA inhibitor is selected
20 from a peptide inhibitor; a small molecule inhibitor; a nucleic acid inhibitor; or
combination thereof.
20. The method as claimed in claim 19, wherein said peptide inhibitor comprises a
peptide having an amino acid sequence of at least 90% sequence identity to a
sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ
49
ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ
ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO.
18, SEQ ID NO. 19 and SEQ ID NO. 20; or wherein the nucleic acid inhibitor
is an shRNA comprising a nucleotide sequence of at least 80% identity to a
sequence selected from a group consisting of SEQ ID NO. 5 9, SEQ ID NO. 10,
SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 13, or wherein the SERCA
inhibitor is selected from thapsigargin, cyclopiazonic acid, DBHQ,
Mipsagargin, Casearin J, or a derivative thereof.
21. The method as claimed in claim 17, wherein the immune checkpoint inhibitor
10 is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a
CD39 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT
inhibitor, a CD36 inhibitor, or combination thereof; wherein the VEGF
neutralizing agent is an anti-VEGF antibody or anti-VEGF receptor antibody,
wherein the VEGF neutralizing agent is selected from Bevacizumab,
15 Ramucirumab, Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib, or
combination thereof; wherein the chemotherapeutic drug is selected from
Paclitaxel, Carboplatin, Doxorubicin, Topotecan, Gemcitabine, or combination
thereof; wherein the PARP inhibitor is selected from Olaparib, Niraparib,
Rucaparib, Talazoparib, or combination thereof; wherein the TGF beta
20 inhibitor is selected from Galunisertib, HYL001, Vactosertib, SB-431542,
Fresolimumab, AVID200, LY2109761, Pirfenidone, Losartan, Ker-050, or
combination thereof; or wherein the lipid inhibitor is selected from Denifanstat,
Orlistat, Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline,
50
Ranolazine, simvastatin, atorvastatin, Edelfosine, Miltefosine, and combination
thereof.
22. A method of treating cancer in a subject, comprising administering to the
subject a PMCA inhibitor; or a combination comprising a PMCA inhibitor and
5 a SERCA inhibitor.
23. The method as claimed in claim 22, comprising administering to the subject the
pharmaceutical composition comprising a PMCA inhibitor, as claimed in claim
1 or 2; or combination comprising a PMCA inhibitor and a SERCA inhibitor.
24. The method as claimed in claim 22, wherein said method further comprises
10 administering to the subject a therapeutic agent selected from an immune
checkpoint inhibitor, a VEGF neutralizing agent, a chemotherapeutic drug, a
PARP inhibitor, a TGF beta inhibitor, a lipid inhibitor, adoptive T cell, or
combination thereof
25. The method as claimed in claim 22, wherein the PMCA inhibitor and the
15 SERCA inhibitor are administered as a single composition or separate
composition.
26. The method as claimed in claim 22, wherein the PMCA inhibitor is peptide
inhibitor comprising a peptide having an amino acid sequence of at least 90%
sequence identity to a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2,
20 SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:
7, SEQ ID NO: 8, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID
NO. 17, SEQ ID NO. 18, SEQ ID NO. 19 and SEQ ID NO. 20, or wherein said
PMCA inhibitor is a nucleic acid inhibitor comprising a nucleotide sequence of
51
at least 80% identity to a sequence selected from a group consisting of SEQ ID
NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 13.
27. The method as claimed in claim 22, wherein the SERCA inhibitor is selected
from thapsigargin, cyclopiazonic acid, DBHQ, Mipsagargin, Casearin J or a
derivative 5 thereof.
28. The method as claimed in claim 22, wherein the immune checkpoint inhibitor
is selected from a PD1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, a
CD39 inhibitor, a CD73 inhibitor, LAG-3 inhibitor, a TIM-3 inhibitor, a TIGIT
inhibitor, a CD36 inhibitor, or combination thereof; wherein the anti-VEGF or
10 anti-VEGF receptor antibody is selected from Bevacizumab, Ramucirumab,
Aflibercept, Sunitinib, Sorafenib, Pazopanib, Nintedanib or combination
thereof; wherein the chemotherapeutic drug is selected from Paclitaxel,
Carboplatin, Doxorubicin, Topotecan, Gemcitabine or combination thereof;
wherein the PARP inhibitor is selected from Olaparib, Niraparib, Rucaparib,
15 Talazoparib or combination thereof; wherein the TGF beta inhibitor is selected
from Galunisertib, HYL001, Vactosertib, SB-431542, Fresolimumab,
AVID200, LY2109761, Pirfenidone, Losartan, Ker-050 or combination
thereof; or wherein the lipid inhibitor is selected from Denifanstat, Orlistat,
Cerlenin, C75, A939572, CAY10566, Etomoxir, Perhexiline, Ranolazine,
20 simvastatin, atorvastatin, Edelfosine, Miltefosine and combination thereof.
29. The method as claimed in claim 22, wherein the cancer is selected from the
group consisting of ovarian cancer, colorectal cancer, melanoma, breast cancer,
lung cancer, pancreatic cancer, prostate cancer, gastric cancer, liver cancer,
52
renal cancer, bladder cancer, head and neck cancer, glioblastoma, esophageal
cancer, cervical cancer, endometrial cancer, and hematological malignancies.
30. The method as claimed in claim 22, wherein said administering is performed
by intraperitoneal, intratumoral, intravenous, intradermal, intramuscular,
subcutaneous and/or oral 5 administration.
31. A process for preparing the pharmaceutical composition as claimed in claim 1,
comprising mixing a PMCA inhibitor and a pharmaceutically acceptable
carrier; and optionally mixing a SERCA inhibitor, to obtain the pharmaceutical
composition.
10 32. A PMCA inhibitor for use in treating cancer in a subject, or for enhancing T
cell activity.
33. A combination comprising a PMCA inhibitor and a SERCA inhibitor for
treating cancer in a subject, or for enhancing T cell activity.
34. The combination, as claimed in claim 33, further comprising a therapeutic agent
15 selected from an immune checkpoint inhibitor, a VEGF neutralizing agent, a
chemotherapeutic drug, a PARP inhibitor, a TGF beta inhibitor, a lipid
inhibitor, adoptive T cell, or combination thereof.
53
| # | Name | Date |
|---|---|---|
| 1 | 202641047678-STATEMENT OF UNDERTAKING (FORM 3) [14-04-2026(online)].pdf | 2026-04-14 |
| 3 | 202641047678-Sequence Listing in PDF [14-04-2026(online)].pdf | 2026-04-14 |
| 4 | 202641047678-POWER OF AUTHORITY [14-04-2026(online)].pdf | 2026-04-14 |
| 5 | 202641047678-FORM-9 [14-04-2026(online)].pdf | 2026-04-14 |
| 6 | 202641047678-FORM FOR SMALL ENTITY(FORM-28) [14-04-2026(online)].pdf | 2026-04-14 |
| 7 | 202641047678-FORM 1 [14-04-2026(online)].pdf | 2026-04-14 |
| 8 | 202641047678-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [14-04-2026(online)].pdf | 2026-04-14 |
| 9 | 202641047678-EDUCATIONAL INSTITUTION(S) [14-04-2026(online)].pdf | 2026-04-14 |
| 10 | 202641047678-DRAWINGS [14-04-2026(online)].pdf | 2026-04-14 |
| 11 | 202641047678-DECLARATION OF INVENTORSHIP (FORM 5) [14-04-2026(online)].pdf | 2026-04-14 |
| 12 | 202641047678-COMPLETE SPECIFICATION [14-04-2026(online)].pdf | 2026-04-14 |
| 13 | 202641047678-FORM-8 [20-04-2026(online)].pdf | 2026-04-20 |
| 14 | 202641047678-FORM 18A [20-04-2026(online)].pdf | 2026-04-20 |
| 15 | 202641047678-EVIDENCE OF ELIGIBILTY RULE 24C1f [20-04-2026(online)].pdf | 2026-04-20 |