Name of the invention: the method of production to produce 5'-inosinate and 5'-inosinate microorganism using the same.

Art

[1]

The present application is a method for producing 5'-inosinate, 5'-inosinate and 5'-inosinate increased emissions produced compositions for using the same genus Corynebacterium microorganism, which produces a 5'-inosinate activity-enhanced emission of the IMP protein It relates to a method.

[2]

BACKGROUND

[3]

One of the nucleic acid-based materials 5'-inosinate (5'-inosine monophosphate; hereinafter IMP) has been used in various fields as an intermediate material of the nucleic acid metabolic pathway, food, drugs and other medical use and the like. In particular, 5'-guanylate; a material that is widely used as a seasoning for foods or food additives, with (5'-guanine monophosphate below GMP). IMP is becoming a known, but that the beef flavor by itself, mono sodium glutamate (MSG) known to enhance the flavor of the positive immature nucleic acid-based seasoning.

[4]

A method of producing the IMP is a method of decomposing ribonucleic acid extracted from yeast cells by the enzymatic method (Japanese Patent Publication No. 1614/1957 call) with a chemical phosphorylation of inosine produced by fermentation (Agri. Biol. Chem ., 36, 1511 there is, and so on) and a method for culturing a microorganism producing IMP and recovering the IMP directly in the culture medium or the like. How are currently the most widely used of these methods is a method using a microorganism capable of producing direct IMP.

[5]

Detailed Description of the Invention

SUMMARY

[6]

In order to produce a high yield of the IMP to a method of directly producing IMP by fermentation of microorganisms of the IMP and the exhaust it must be made smoothly. In order to achieve this objective inventors have conducted extensive research, we identified a protein ImpE1, ImpE2 conducted a study on the emissions proteins involved neunge IMP emissions involved in emissions. If given away to enhance protein ImpE1, ImpE2 activity involved in the IMP discharged, thereby completing the present application by ensuring that the concentration of IMP increases.

[7]

Problem solving means

[8]

One of the purposes of the present application is to provide a microorganism of the genus Corynebacterium that produces a protein enhancing the activity of the IMP emissions, 5'-inosinate.

[9]

It is another object of the present application is to provide a process for producing 5'-inosinate comprises culturing a microorganism of the genus Corynebacterium in a medium the present application.

[10]

It is another object of the present application is to provide a 5'-inosinate for producing a composition comprising a protein, the activity of the protein of the present application IMP discharge enhanced.

[11]

It is another object of the present application is to provide a method of increasing the discharge, 5'-inosinate which comprises a step of enhancing in Corynebacterium spp the IMP emission protein of the instant application.

[12]

Effects of the Invention

[13]

By using a microorganism of the genus Corynebacterium to produce a 5'-inosinate activity-enhanced emission of the IMP protein in the present application it can be produced the 5'-inosinate.

[14]

Best Mode for Carrying Out the Invention

[15]

If it described in detail below. On the other hand, each of the descriptions and embodiments disclosed in this application may be applied to other embodiments and description of each. That is, any combination of various elements disclosed in the present application within the scope of the present application. In addition, it is impossible to see that the scope of the present application limited by the specific description technology.

[16]

[17]

One aspect of the present application for achieving the above object is to provide a microorganism of the genus Corynebacterium, the activity of the IMP protein emissions production cost, 5'-inosinate enhanced.

[18]

[19]

Term in this application, the terms "5'-inosinate exhaust protein" means a protein that participates in discharged outside the 5'-inosinate (5'-inosine monophosphate, hereinafter IMP) cells. For purposes of this application the terms may be used interchangeably as the IMP protein having a discharge function, 5'-inosinate protein of emptying, 5'-inosinate discharge proteins, can be expressed by specifically ImpE, more specifically but it may represent ImpE1, ImpE2, but is not limited thereto. In addition, the proteins may be derived from genus Corynebacterium, in particular may be a one of Corynebacterium stay Yorkshire varnish derived, but is not limited thereto. For example, Corynebacterium and stay Yorkshire varnish origin, a protein having an activity of a corresponding protein having a 5'-inosinate emptying may be used in the protein of the present application.

[20]

[21]

The protein may for example be one consisting of the amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, but includes no sequences that have the same activity as the protein is limited, the sequence information, etc. One of ordinary skill in the art GenBank of the known database NCBI It can be obtained. In addition, the protein is SEQ ID NO: 1 or SEQ ID NO: 2 in amino acid sequence or the at least 80%, of the amino acid sequence having 90%, 95%, 96%, 97%, 98%, or 99% homology or identity which may be the protein. In addition, having such homology or identity if the amino acid sequence shown efficacy corresponding to the protein, with some sequences do proteins having deleted, modified, substituted or added in the amino acid sequence can be used as a protein of the present application will be apparent.

[22]

That is, even if in the present application are described as "protein consisting of a specific SEQ ID NO: Amino Acid Sequence", a protein comprising the amino acid sequence set forth in a particular SEQ ID number, or a protein with the same or equivalent activity consisting of the amino acid sequence of the SEQ ID NO: If the case has, with some sequences do protein having a deletion, modification, substitution, conservative substitutions or added in the amino acid sequence may be used in the present application will be apparent. For example, the variant protein with the same or a case having a corresponding activity, if the amino acid sequences before and after additional sequence that does not change the function of the protein, the mutations may occur naturally, their potential mutations (silent mutation) or retention not intended to exclude the substitution, it is apparent that within the scope of the present application, even if having more such sequences or mutations.

[23]

[24]

The term in the present application, "homology (homology) 'or' identity (identity)" means the degree to each other relating to the two given amino acid sequence or nucleotide sequence and can be expressed as a percentage.

[25]

Terms homology and identity can often be used interchangeably.

[26]

A conserved (conserved) polynucleotide or sequence homology or identity of polypeptides can be used with the default gap penalties established by the program that is determined by the standard arrangement algorithm used. In practice, it has a homology or (homologous) or the same (identical) sequences are generally sequences in whole or in full in the middle or high stringent conditions (stringent conditions) - at least 50% of the length, 60%, 70%, 80% or it may be a hybrid by at least 90%. Hybridization is also considered a polynucleotide containing a degenerate codons instead of the codons in the polynucleotide.

[27]

Whether any two polynucleotide or polypeptide sequence of the has the homology, similarity or identity include, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: by using the default parameters as in 2444 may be determined using known computer algorithms such as the "FASTA" program. Alternatively, only the needles of the EMBOSS package program, as is done in (EMBOSS: 276-277: The European Molecular Biology Open Software Suite, Rice et al, 2000, Trends Genet 16..) (Version 5.0.0 or later) needle-only-flavor (Needleman-Wunsch) algorithm (.. Needleman and Wunsch, 1970, J. Mol Biol 48: 443-453) can be determined is used. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED,.] Academic Press, San Diego, 1994, and [CARILLO ETA /.] (1988) SIAM J Applied Math 48: 1073 contains) for example, you can use the BLAST, ClustalW or the National Center for Biotechnology information database to determine the homology, similarity or identity.

[28]

Polynucleotides or polypeptides of homology, similarity or identity, e.g., Smith and Waterman, Adv. Appl. Math (1981) 2: 482, as is known in, e.g., Needleman et al. (1970), J Mol Biol.48: can be determined by using the GAP computer program, such as 443 compares the sequence information. In summary, GAP program defines a value obtained by dividing the total number of symbols in the shorter of the two sequences from the number, the arrangement similar to sign (i.e., nucleotides or amino acids). The default parameters for the GAP program include: (1) one binary comparison matrix (1 and ratio to the identity-by containing a value of 0 for identity) and Schwartz and Dayhoff, eds, Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: the weighted comparison matrix of 6745 (or the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) addition of 0.10 penalty for each symbol in each gap, and the penalty of 3.0 for each gap (or gap opening penalty 10, gap extension penalty 0.5); And (3) may include no penalty for end gaps. Thus, as used herein, the term "homology" or "identity" represents the relevance (relevance) between the sequences.

[29]

[30]

Term in this application, the terms "enhanced activity" is introduced, the activity of the protein or, means that the activity compared to the endogenous activity or modified before activation with the microorganism improved. "Introducing" in the activity, means that displayed the activity of natural or artificial specific protein microorganisms did not have the original. "Intrinsic activity" is, if the transformation of microorganisms changes in genetic variation due to natural or anthropogenic factors, says the changes before transfection activity of the parent strain specific protein that is inherent.

[31]

For example, the active reinforcement may include both to increase the exhaust to enhance the introduction of IMP protein foreign to the host cell, or introduced into, or activity of the intrinsic emission IMP protein.

[32]

Specifically, activity increased in the present application,

[33]

1) increasing the copy number of the polynucleotide encoding the protein (i.e., encryption),

[34]

2) transformation of the expression control sequences to increase the expression of the polynucleotide,

[35]

3) modification of the polynucleotide sequence on the chromosome so that the enhanced activity of the protein, or

[36]

4) but it can be carried out by such method that modified to enhanced by the combination thereof, but is not limited thereto.

[37]

Wherein 1) increasing the copy number of the polynucleotide is not particularly limited, be performed as operably linked to a vector form, it can be carried out by being inserted into the chromosome in the host cell. In addition, in one aspect of the increased copy number, may be performed by introducing an exogenous polynucleotide or mutant polynucleotide with codon optimization of the polynucleotide indicates the activity of the protein into a host cell. The exogenous polynucleotide may be used without limitation to the origin and a sequence representing the protein with the same / similar activity. The introduction can be carried out by any person skilled in the art to adequately select a known transformation method, the introduced polynucleotide are expressed in the host cell thereby it may be the activity increase the protein is produced. The copy number increases are poly and nucleotides can be present continuously in tandem form, in this case a different polynucleotide sequence encoding an IMP exhaust protein alternately, in sequence, and the same sequence is repeated, can be present, tandem type when present in a row, but may result in the overlapping part between each other, but it is not limited thereto. More specifically, the present application may be the number of copies of a polynucleotide sequence set forth in SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5 increasing.

[38]

Next, 2) modification of the polynucleotide expression control sequences so as to express the increase in the, particularly for but not limited to, the expression deletion of nucleic acid sequence so as to further enhance the activity of the regulatory sequence, insertion, Vivo wholly or conservative substitutions thereof performed in combination to induce a mutation on the sequence, or may be performed by replacing as a nucleic acid sequence having a stronger activity. The expression control sequence may comprise a particularly useful for but not limited to promoters, operator sequences, such as sequences that control the termination of the sequence, the transcription and translation coding for a ribosome binding site. Specifically, there polynucleotide upper portion of the expression unit, may have a strong heterologous promoters connected instead of the original promoter, and examples of the strong promoter may include CJ7 promoter, lysCP1 promoter, EF-Tu promoter, groEL promoters, aceA or aceB promoter. It is the promoter and the polynucleotide are operably linked, but can enhance the expression of the polynucleotide encoding the protein, and the like.

[39]

In addition, 3) modification of the polynucleotide sequence on the chromosome is especially useful for but not limited to, deletion of a nucleic acid sequence so as to further enhance the activity of the polynucleotide sequence, expression control by insertion, Vivo wholly or conservative substitution or a combination of these sequences performed by inducing a mutation on, or can be performed by replacing as in the polynucleotide sequence improved so as to have a stronger activity.

[40]

Finally, 4) the above 1) to 3) how modified to enhanced by the combination of the increased copy number of the polynucleotide encoding the protein, modification of an expression control sequence such that its expression is increased, the polynucleotides on the chromosome of the sequence variations and can be performed by applying the first method with at least one strain of a foreign polynucleotide or a polynucleotide variant thereof optimized codon representing the activity of the protein.

[41]

In addition, the protein or its homologous made by a polynucleotide encoding a protein consisting of the amino acid sequence of SEQ ID NO: of the Application 1, or SEQ ID NO: 2 is the codon degeneracy (codon degeneracy) to the SEQ ID NO: 1 or 2 amino acid sequence with it is apparent that also may contain a polynucleotide that may be translated into protein. For example, it may be comprised of a polynucleotide sequence set forth in SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5. In addition, the probe which can be prepared from a known gene sequence, for example, a complementary sequence and to under stringent conditions Hydride Chemistry, SEQ ID NO: 1 or 2 protein activity consisting of the amino acid sequence of all or part of the nucleotide sequence It has can be included, without limitation, if the sequence encoding the protein. Refers to conditions that permit the specific hybridization between the "stringent condition" is a polynucleotide. These conditions are described in detail in the literature (e.g., J. Sambrook et al., Above). For example, the high homology gene each other, more than 40%, specifically, by at least 90%, more specifically at least 95%, more specifically 97% or more, and particularly particularly genes having at least 99% homologous hybridization and conditions than homology do not hybridize with each other low gene, or a 60 ℃ ordinary washing condition of Southern hybridization, 1XSSC, 0.1% SDS, specifically 60 ℃, 0.1XSSC, 0.1% SDS to each other, more specifically, at a salt concentration and temperature corresponding to 68 ℃, 0.1XSSC, 0.1% SDS, 1 time, specifically, can be exemplified conditions that washed twice or three times.

[42]

Hybridization Although the mismatch (mismatch) between the base be possible depending on the stringency of hybridization, though, requires that the two nucleic acids having a complementary sequence. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, this application can also, as well as similar to the nucleic acid sequence substantially complementary to an isolated nucleic acid fragment comprising the sequence throughout.

[43]

Specifically, a polynucleotide having a homology can be detected using hybridization conditions comprising a hybridization step at Tm value of 55 ℃ using the above-described conditions. Further, the Tm value can be 60 ℃, 63 ℃ or 65 ℃. However, it is not limited to, it can be properly adjusted by those skilled in the art according to the purpose.

[44]

Appropriate stringency for hybridizing polynucleotide is dependent on the degree of complementarity and the length of the polynucleotide and variables are well known in the art (see Sambrook et al., Supra, 9.50-9.51, 11.7-11.8).

[45]

[46]

The term "vector" as used in this application refers to a DNA preparation containing the nucleotide sequence of the polynucleotide encoding the desired protein operably linked to suitable control sequences so as to express the desired protein in a suitable host. The control sequences may include any operator sequence, sequences that control the termination of the sequence, and a transcription and translation encoding a suitable mRNA ribosome-binding site for regulating the promoter, such that transcription can initiate transcription. Vector may then be transformed into a suitable host cell, replicate independently of the host genome, or functions, may be integrated into the genome itself.

[47]

Vector used in the present application as long as it can express in a host cell is not particularly limited, it is possible to use any vector known in the art. Examples of the normal vector to be used may be a naturally occurring or recombinant plasmid of the state, cosmid, virus and bacteriophage. For example, the phage vector or course as mid vector may be used. PWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, etc. Charon4A, and Charon21A, pBR series, pUC system, pBluescriptII system as plasmid vector It may be used based pGEM, pTZ-based, such as pCL and pET-based system. More specifically, but you can use the pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector such as, but not limited thereto.

[48]

The available vector herein is not particularly limited and may be a known expression vector. In addition, through the cell in a vector for chromosomal insertion it is possible to insert a polynucleotide encoding a protein of interest in the chromosome. Insertion into the chromosome of the above polynucleotides is any method known in the art, for example, but may be made by homologous recombination, but is not limited to this. It may further comprise a selectable marker (selection marker) to determine the chromosomal insertion. Selectable marker is designed to determine whether the insertion of the transformant screening the transformed cells with a vector, that is, the target nucleic acid molecule, drug resistance, nutritional requirement, given the selectable phenotype such as expression of the resistance or the surface protein on cytotoxic agent markers that can be used. Since the selective agent in a process environment (selective agent) survive only cells expressing a selectable marker, or reflect a different phenotype, it may be selected for transformed cells.

[49]

The term "transgenic" in this application is meant to allow the protein to the polynucleotide encoding the expression by introducing a vector comprising a polynucleotide encoding the target protein in the host cell in a host cell. If the transformed polynucleotide can be as long as expression in a host cell, is inserted in the chromosome of the host cell may be located, or include both of these positions in addition to the chromosome, or no matter what. In addition, the polynucleotides include DNA and RNA encoding the target protein. The polynucleotide so long as it can be expressed is introduced into a host cell, it does not matter whether it is to be introduced in any form. For example, the polynucleotide may be introduced into a host cell in the form of there is expressed by itself in an expression cassette (cassette expression) gene construct containing all the elements required. The expression cassette may include a promoter that is normally operably linked to the polynucleotide (promoter), a transcription termination signal, ribosome binding site and translation termination signal. The expression cassette may be an expression vector form a self-replicable. In addition, the polynucleotide is introduced into a host cell in the form of itself, and may be, which is possibly connected with the operation sequence necessary for the expression in a host cell, and the like. How to transform the above it can be carried out, and includes any method of introducing the nucleic acid into a cell, by selecting suitable standard techniques as known in the art depending on the host cell. For example, electroporation method (electroporation), calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection (microinjection), polyethylene glycol (PEG) method, DEAE- dextran method, cationic liposome method, and Although the like -DMSO lithium acetate method, but is not limited thereto.

[50]

In addition, this term means that at the "operably linked to" the promoter sequence and the expectation that the target protein of the present application to initiate and mediate the transcription of a polynucleotide encoding the polynucleotide sequences are functionally connected. Operative connection can be produced using known genetic recombination techniques in the art, site-specific DNA cleavage and connections, but can be manufactured using, for example, cutting and ligase in the art, not limited to this.

[51]

The term "genus Corynebacterium to produce 5'-inosinate (the genus in the description of Corynebacterium ) microorganism" refers to a genus Corynebacterium microorganisms that have 5'-inosinate production capacity through the wild-type or mutant . Specifically, enhanced by the present application 5'-inosinate genus Corynebacterium microorganism having a production capacity is, or to enhance the activity of the gene is inserted into or associated with the inherent weakness gene native strain itself or outside the production mechanism in a 5'-inosinate 5'-inosinate may be a Corynebacterium spp have the production capacity. 5'than more specifically, pre-change parent strain or non-modified microorganism transformed inosinate may be improved microbial production capability.

[52]

[53]

"Corynebacterium spp" in the present application is specifically Corynebacterium glutamicum ( of Corynebacterium glutamicum ), Corynebacterium ammoniagenes's Ness ( of Corynebacterium ammoniagenes ), Brevibacterium lactose flops momentum ( Brevibacterium lactofermentum ) , Brevibacterium Plastic pan ( Brevibacterium flavu m), Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ), Corynebacterium epi syeonseu ( Corynebacterium efficiens ), Corynebacterium stay Yorkshire varnish ( Corynebacterium stationis) or the like , it is not limited thereto. More specifically, the genus Corynebacterium microorganisms in the present application Corynebacterium Nice Stay Yorkshire ( of Corynebacterium stationis) can be. Specific example, improved Corynebacterium stay Yorkshire varnish ability to produce 5'-inosinate cells by enhancing the activity of a protein having a function for discharging out of the 5'-inosinate ( Corynebacterium stationis) , but may be, but is not limited thereto.

[54]

[55]

As one more aspect of the present application, the 5'-inosinate it provides a production method that includes culturing the microorganism of the genus Corynebacterium enhanced activity of the IMP protein discharged in the medium.

[56]

Specifically, the method of the present application may further comprise the step of recovering the 5'-inosinate in the microorganism or the medium.

[57]

[58]

In the method, the method comprising culturing the microorganism, it can be not specifically limited, known batch culture method, the continuous culture method, performed by a fed-batch culture method. At this time, the culture conditions, particularly for but not limited to, a basic compound to an appropriate pH using: (phosphoric acid or sulfuric acid for example) (for example, pH 5 to 9, in particular (for example, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound may be adjusted to pH 6 to 8, most specifically at pH 6.8), oxygen or oxygen-containing gas mixture is introduced to the culture to maintain the aerobic conditions. The culture temperature is 20 to 45 ℃, specifically, can be maintained for 25 to 40 ℃, but can be cultured for about 10 to 160 hours, without being limited thereto. The 5'-inosinate produced by the culture can be secreted into the culture medium or remains in the cell.

[59]

In addition, the medium for the culture to be used per a carbon source and a carbohydrate (such as glucose, sucrose trehalose, lactose, fructose, maltose, know three, starch and cellulose), maintenance, and fat (such as soybean oil, sunflower seed oil, peanut oil and coconut oil), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (for example, glycerol and ethanol) and organic acids (e.g. acetic acid) can be used by using individually or mixed, such as, but , but it is not limited thereto. The nitrogen source may include nitrogen-containing organic compounds (e.g., peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean bakbun and urea), or inorganic compounds (e.g., ammonium ammonium ammonium sulfate, chloride, phosphate, ammonium carbonate and ammonium nitrate), but it can be used by using individually or mixed, such as, but not limited thereto. Although the source of the phosphate can be individually used, or a mixture of monobasic potassium phosphate, potassium susoyi, such as the corresponding sodium-containing salts to, but is not limited thereto. In addition, the culture medium and other metal salts (such as magnesium sulfate or iron sulfate), essential amino acids, and growth, such as vitamins can include a promoting material.

[60]

The method for recovering the 5'-inosinate produced in the incubation step of the present application can be by using a suitable method known in the art according to the culture method to collect the desired 5'-inosinate from the culture broth. For example, this can be used centrifugation, filtration, anion exchange chromatography, crystallization and HPLC, etc., it can be recovered from the culture medium or the desired 5'-inosinate microorganism by using the appropriate method known in the art.

[61]

In addition, the recovery step may comprise a purification step, may be performed using a suitable method known in the art. Thus, the 5'-inosinate which number of the microorganism may be a fermentation broth containing the purified form or a 5'-inosinate.

[62]

[63]

This application is yet another one embodiment, the service for the 5 & apos; comprising a protein or a polynucleotide encoding the amino acid sequence consisting of SEQ ID NO: 1 or SEQ ID NO: 2 of the present application inosinate producing composition.

[64]

The compositions of the present application may include, without limitation, a structure capable of operating the polynucleotide further. Further, in the composition of the present application, a polynucleotide may be in the form contained in the vector able to express a gene operably linked to the introduced in a host cell.

[65]

In addition, the composition may further comprise any suitable excipients commonly used in compositions for the production of 5'-inosinate. Such excipients include, for example, preservatives, wetting agents, dispersing agents, suspending agents, or the like, but a buffer, a stabilizer or isotonic agent, and the like.

[66]

[67]

This application is yet another one embodiment, provides, for the production, Corey four 5'-inosinate production increase of tumefaciens in microorganisms of proteins consisting of SEQ ID NO: 1 or SEQ ID NO: 2 amino acid sequences.

[68]

[69]

The present application provides yet another one embodiment, SEQ ID NO: 1 or SEQ ID NO emissions increase method of the amino acid, 5'-inosinate which comprises a step of enhancing the protein consisting of a sequence in a microorganism of the genus Corynebacterium.

[70]

[71]

This application is yet another one embodiment, provides, for the production, Corey four 5'-inosinate emissions increase in tumefaciens in microorganisms of proteins consisting of SEQ ID NO: 1 or SEQ ID NO: 2 amino acid sequences.

[72]

[73]

The term "protein consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2", "enhanced" and "microbial genus Corynebacterium" is as described above.

[74]

Mode for the Invention

[75]

It is described in more detail by the following Examples in the present application. However, these examples are for explaining the present application by way of example and, not necessarily the scope of the present application limited by these embodiments, it will be apparent to those skilled in the art of the present application.

[76]

[77]

Example 1: I genomic DNA library produced

[78]

[79]

For the Corynebacterium involved in the IMP emissions to just identified a protein Corynebacterium Nice Stay Yorkshire ( of Corynebacterium stationis was manufactured's genomic DNA library of) ATCC6872.

[80]

Since the genus Corynebacterium wild strains were, making CJI0323 strain ATCC6872 comes with IMP producing ability to not produce the IMP, or even produce IMP since very only be a very small amount is produced, to confirm the IMP producing ability . Transformed to the genomic DNA library of the strain ATCC6872 with the manufacturing CJI0323 was performed by screening of a membrane protein involved in the wild type IMP discharge. Specific experiments are as follows.

[81]

[82]

Example 1-1: IMP production strains Screening Day CJI0323

[83]

In order to produce a state of IMP production ATCC6782-derived ATCC6872 a phosphate buffer to 10 (pH 7.0) or citrate buffer (pH5.5) 7 ~ 10 8 are suspended in cell / ml. This was treated by UV-induced mutations in. Washed with 0.85% sodium chloride solution twice, and by diluting the material to confer resistance on a minimal medium containing 1.7% agar in a culture medium containing an appropriate concentration to give a smear after colony. Culturing individual colonies in a nutrient medium and was cultured for 24 hours in a seed medium. 3-4 days incubation resulting in a fermentation medium, the product IMP accumulated in the culture were selected for the best colony. In order to produce a high concentration of IMP production primary requirement adenine, guanine leakage type, lysozyme sensitivity, 3,4-dihydro-proline-resistant, streptomycin resistant, azetidine carboxylic acid-resistant, tear-resistant proline, serine aza-resistant, sulfamic guanidine resistance, Nord valine resistance, tri meto was carried out the above process in order to impart resistance in sequence for each material Supreme, the tolerance for the material was given and the final selection excellent CJI0323 IMP producing ability. In Table 1 are shown by comparing the degree of resistance against CJI0323 ATCC6872.

[84]

[85]

TABLE 1
characteristic ATCC6872 CJI0323
Adenine requirement Biyo configuration Requirement
Guanine leakage type Biyo configuration Leak-type
Lysozyme sensitivity 80 ug / ml 8 ug / ml
3,4-dihydro-proline-resistant 1000 ug / ml 3500 ug / ml
Streptomycin resistant 500 ug / ml 2000 ug / ml
Azetidine carboxylic acid tolerance 5 mg/ml 30 mg/ml
Thiazol-proline-resistant 10 ug / ml 100 ug / ml
Aza-serine-resistant 25 ug / ml 100 ug / ml
Guanidine preached tolerance 50 ug / ml 200 ug / ml
Norvaline resistance 0.2 mg/ml 2 mg/ml
Mezzo-resistant tree Supreme 20 ug / ml 100 ug / ml

[86]

[87]

- minimal medium: Glucose 2%, sodium 0.3%, phosphoric acid of claim 1, potassium 0.1%, the second 0.3% potassium phosphate, 0.3% magnesium sulfate, calcium chloride 10mg / l, ferrous sulfate 10mg / l, zinc sulfate 1mg / l, manganese chloride 3.6mg / l, L- cysteine ​​20mg / l, calcium pantothenate 10mg / l, thiamine hydrochloride 5mg / l, biotin, 30ug / l, adenine 20mg / l, guanine 20mg / l, pH7.3

[88]

[89]

- nutrient medium: peptone 1%, meat 1%, 0.25% sodium chloride, yeast extract, 1%, 2% agar, pH 7.2

[90]

[91]

- seed medium: glucose 1%, peptone 1%, meat 1%, 1% yeast extract, 0.25% sodium chloride, adenine 100mg / l, guanine 100mg / l, pH 7.5

[92]

[93]

- a fermentation medium 0.1% sodium glutamate, 1% ammonium chloride, 1.2% magnesium sulfate, 0.01% calcium chloride, ferrous sulfate 20mg / l, manganese sulfate 20mg / l, zinc sulfate 20mg / l, copper sulfate 5mg / l, L- Cysteine ​​23mg / l, was added to be alanine 24mg / l, nicotinic acid 8mg / l, biotin 45㎍ / l, thiamine hydrochloride 5mg / l, adenine 30mg / l, phosphoric acid (85%) of 1.9%, 2.55% glucose, 1.45% of fructose by using .

[94]

Example 1-2: CJI0323 entry into force of the potency test

[95]

Species after the diameter of the medium dispensed in 2ml 18mm test tube and pressure sterilization, respectively inoculated and cultured for 24 hours with shaking at 30 ℃ temperature and CJI0323 ATCC6872 was used as a seed culture. After dispensing the fermentation broth 29ml in 250ml Erlenmeyer flask for shaking and sterilized 15 minutes at 121 ℃ pressurized temperature, and inoculated with the seed culture 2ml were cultured for 3 days. The culture conditions were controlled as a rotation speed 170rpm, temperature 30 ℃, pH 7.5.

[96]

After the completion of the culture was measured by the method for production of IMP using HPLC (LC20A SHIMAZDU), culture results are shown in Table 2 below.

[97]

[98]

TABLE 2
Strain name IMP (g/L)
ATCC6872 0
CJI0323 9.52

[99]

[100]

Example 1-3: Excavating emissions protein

[101]

It was added for further IMP in the minimum by the addition of a 1.7% agar medium was established screening criteria showing the growth decrease (growth inhibition) of CJI0323 strain. ATCC6872 to transform the genomic library plasmid with electroporation to CJI0323 strains and (van der Rest et al. 1999), were selected colonies are grown in a reduced release the added medium conditions excess IMP. The nucleotide sequence from the sequencing technique to obtain the plasmid from selected colonies was analyzed. This was identified from a membrane protein 1 species involved sikineunde release the reduced growth in excess of the added IMP conditions.

[102]

Corynebacterium membrane protein of said one type of SEQ ID NO: 2 is the amino acid sequence, and SEQ ID NO: 5 of the sequence: was identified to be (NCBI GenBank NZ_CP014279, WP_066795121, MFS transporter). The film was known as MFS transporter protein, but did not confirm a definite function, and further features of the IMP emissions is not known. In the present application it was named as ImpE2 (WT).

[103]

[104]

Example 2: ImpE1, ImpE2 Identification

[105]

[106]

Example 2-1: impE1, impE2 OK

[107]

The film was confirmed that the gene construct of SEQ ID NO: 5 in the NCBI to find out the functions of the protein ImpE2 (NCBI GenBank: NZ_CP014279, WP_066795121 , MFS transporter). SEQ ID NO: 5 ( impE2 ) is the beginning of the ORF in the gene 7bp impE2 upstream: it was confirmed to be overlapped with (NCBI GenBank NZ_CP014279, WP_066795119, transcriptional regulator). impE2 protein encoded from the corresponding genes and gene located on upstream was still had the function not OK named ImpE1 (WT) in this present application (the nucleotide sequence of SEQ ID NO: 1 and amino acid sequence of SEQ ID NO: 4).

[108]

[109]

Example 2-2: impE1 or impE2 deficient vector production

[110]

If carried sikyeoteul defect in Examples 1 and IMP-producing strain or the ImpE1 ImpE2 that involved in releasing a growth reduction due to the sympathetic IMP through 2-1, to produce a defect vector for each gene in order to ensure that reduced emission capability IMP It was.

[111]

Gene segments to produce a vector was obtained via a PCR ATCC6872 to the genomic DNA as a template.

[112]

Specifically, the impE1 PCR for SEQ ID NO 6, 7 of the primers and SEQ ID NO: 8 and a primer of 9, impE2 was used for PCR on the of SEQ ID NO: 10 and 11 primers and SEQ ID NO: 12 and 13 primers ( Table 3).

[113]

[114]

TABLE 3
SEQ ID NO: primer Sequence (5'-3 ')
6 impE1 cup 1 GCTCTAGACGAGAAAGCTAAAGCCGGTGA
7 impE1 cup-2 GTTTTTAGCTACCATTGTTACACCCCGTGCAAGTTT
8 impE1 cup-3 GCACGGGGTGTAACAATGGTAGCTAAAAACTCCACC
9 impE1 cup-4 GCTCTAGAAATAGTTGGGGAAGTCCACTC
10 impE2 header-1 GCTCTAGACTTGGATGACCTGGTGGAAAA
11 impE2 header-2 CTTGGAGAAAATTTCCTACCATTCCAGTCCTTTCGT
12 impE2 header-3 GGACTGGAATGGTAGGAAATTTTCTCCAAGGGAAAT
13 impE2 header-4 GGACTAGTGGATTGTGTTGACGCACGATG
14 impE1E2 cup-2 CTTGGAGAAAATTTCTGTTACACCCCGTGCAAGTTT
15 impE1E2 cup-3 GCACGGGGTGTAACAGAAATTTTCTCCAAGGGAAAT

[115]

[116]

At this time, using primer (s) in the National Institutes of Health Gene Bank (NIH GenBank) Corynebacterium stationis (ATCC6872) genes: was prepared on the basis of information on the (NCBI Genbank NZ_CP014279) and the surrounding nucleotide sequence.

[117]

PCR conditions were carried out for 5 min denaturation at 94 ℃, and then repeat 25 1 minutes 72 ℃ 94 ℃ 30 cho denaturation, 52 ℃ 3 bun annealing, polymerization time, polymerization at 72 ℃ 5 minutes of reaction. Subjected to SEQ ID NO: 6 and 7 as primers, SEQ ID NO: 8 and 9 in the overlap PCR the two impE1 gene fragment amplified using the primers as a template were obtained polynucleotide template of 1.8 kbp. A fragment of the obtained gene was digested with a restriction enzyme XbaI. T4 ligase pDZ of the line was cut using a kinase to XbaI restriction enzyme to the gene fragment (the Republic of Korea Patent No. 10-0924065 and International Publication Patent No. 2008-033001), and the vector was prepared pDZ- △ impE1. Also amplified with primers of SEQ ID NOS: 10 and 11 impE2 amplified using the gene fragment and SEQ ID NO: 12 and 13 primers impE2 subjected to nested PCR with the two gene fragments as the template to obtain a template polynucleotide of the 1.7kbp could. A fragment of the obtained gene as a XbaI restriction enzyme was cut out, speI. The T4 ligase was cloned into pDZ vector of the line cut by the kinase to the XbaI restriction enzyme to the gene fragment, to prepare a pDZ- △ impE2.

[118]

[119]

Example 2-3: impE1, impE2 integrated deficient vector production

[120]

A gene encoding a protein involved sikineunde release growth reduction due to the IMP impE1 and impE2 because two superimposed gene may need to be adjusted at the same time. Thus impE1 and impE2 were all to produce a defective vector.

[121]

impE1 and impE2 PCR was performed using primers of SEQ ID NOS: 6 and 14, and primers SEQ ID NO: 15 and 13. At this time, using primer Corynebacterium stay Yorkshire varnish (ATCC6872) gene (s) in the National Institutes of Health Gene Bank (NIH GenBank): was prepared on the basis of information on the (NCBI Genbank NZ_CP014279) and the surrounding nucleotide sequence. SEQ ID NO: 6 and 14, and amplified using primers of impE1 gene fragment and SEQ ID NO: 15 and 13. The amplified using primers of impE2 by the two gene fragments subjected to nested PCR as a template to obtain a template polynucleotide of the 2.0kbp could. A fragment of the obtained gene was digested with XbaI, respectively, speI. The T4 ligase was cloned into pDZ vector of the line cut by the kinase to the XbaI restriction enzyme to the gene fragment, to prepare a pDZ- △ impE1E2.

[122]

[123]

Example 2-4: impE1, impE2 deficient production strain

[124]

Carried out after the transformation into the two kinds as in the electroporation method 1 kinds of plasmids prepared in Example 2-3 to each CJI0323 prepared in Example 2-2 (Appl Microbiol.Biotechnol (1999) 52:.. 541- 545 transfection method used), the strain by the recombinant vector is inserted into a chromosome of a homologous sequence according to was screened in medium containing kanamycin (kanamycin) 25 mg / L. The selected primary isolates was further carried out secondary cross (cross-over). Gene defect if the final transformed strains was confirmed by carrying out PCR using the primer pair of SEQ ID NO: 6,9 and SEQ ID NO: 10, 13 and SEQ ID NO: 6 and 13.

[125]

The selected strain is CJI0323_ △ impE1, named CJI0323_ impE2 △, △ CJI0323_ impE1E2 and to evaluate the production performance of the IMP of the strain.

[126]

[127]

Species to the diameter of the medium dispensed in 2ml 18mm test tube, and sterilized after pressing, CJI0323, CJI0323_ △ impE1, CJI0323_ △ impE2, CJI0323_ △ inoculated impE1E2 24 hours with shaking at 30 ℃ temperature culture was used as seed culture. After dispensing the fermentation broth 29ml in 250ml Erlenmeyer flask for shaking and sterilized 15 minutes at 121 ℃ pressurized temperature, and inoculated with the seed culture 2ml were cultured for 3 days. The culture conditions were controlled as a rotation speed 170rpm, temperature 30 ℃, pH 7.5.

[128]

By a method using HPLC After the completion of the culture was measured production of IMP, culture results are shown in Table 4 below.

[129]

[130]

TABLE 4
Strain name IMP (g/L)
CJI0323 9.52
CJI0323_ △ impE1 1.92
CJI0323_ △ impE2 1.88
CJI0323_ △ impE1E2 1.80

[131]

[132]

At this time, the parent strain of Corynebacterium stay Yorkshire varnish CJI0323 the result of a comparison within the IMP accumulation medium, prepared under CJI0323_ △ impE1, CJI0323_ △ impE2, CJI0323_ △ the same conditions impE1E2 strains as shown in Table 4 of parent strain confirmed that the concentration decreases about 8g / L of IMP and was identified as ImpE1, ImpE2 the proteins involved in the IMP discharge.

[133]

[134]

Example 3: wild-type impE1, impE2 strengthen

[135]

[136]

After the genus Corynebacterium wild strains do not produce the IMP, or because the very only be a very small amount is produced even producing IMP, deficiency of ImpE protein in CJI0323 strains with IMP producing ability by introducing a wild-type ImpE protein restoration, and also it confirmed the IMP emptying increased by strengthening ImpE wild-type protein by enhancing the activity of protein ImpE. Enhanced activity of the protein was used as one of methods of strengthening method, increasing the copy number, enhanced promoter and method.

[137]

[138]

Example 3-1: wild-type impE1, impE2 production integrated vector introduced

[139]

ImpE were obtained through PCR, a gene fragment to produce a first vector to produce a strain introduced with the wild-type genomic DNA as a template to ATCC6872. Wild type impE1 and impE2 PCR was performed using the primers of SEQ ID NOS: 6 and 13. SEQ ID NO: 6 and 13 of the wild-type amplification using the primer of impE1-impE2 gene entire fragment was treated with restriction enzymes XbaI, SpeI, and cloned into the XbaI restriction enzyme located in the pDZ vector to prepare a pDZ-impE1E2 (WT).

[140]

[141]

Example 3-2: wild-type impE1 enhance vector production

[142]

To produce a first vector ImpE1 enhanced, ATCC6872, a gene fragment to produce a vector to obtain a genomic DNA as a template by PCR. impE1 thought to be the promoter region in order to enhance the impE1 sequence number, including the upstream about 370bp was amplified with primers 16 and 17. The amplified impE1 was treated with a restriction enzyme, a gene fragment of a XbaI, and cloned into the XbaI restriction enzyme place, to prepare a pDZ-impE1 (WT) 2-1 to the vector pDZ. After vector construction for 2copy impE1 the PCR it was performed using the primer pair of SEQ ID NO: 18 and 19. Each DNA fragment obtained was cloned into pDZ-impE1 (WT) 2-1 DNA was cut with the restriction enzyme NotI, and the DNA cut with the same restriction enzymes. The prepared vector was named pDZ-impE1 (WT) 2X.

[143]

[144]

Example 3-3: wild-type impE1, impE2 integrated enhanced vector production

[145]

impE1 and impE2 to produce an enhanced integrated strains, wild-type impE1 and impE2 the integration of the gene was amplified by PCR using primers of SEQ ID NOS: 16 and 20. The amplified gene fragment was treated with restriction enzymes XbaI, and cloned into the XbaI restriction enzyme place, to prepare a pDZ-impE1E2 (WT) 2-1 to the vector pDZ. After vector construction for 2copy impE1E2 the PCR it was performed using the primer pair of SEQ ID NO: 18 and 21. Each DNA fragment obtained was cloned into pDZ-impE1E2 (WT) 2-1 DNA was cut with the restriction enzyme NotI, and the DNA cut with the same restriction enzymes. The prepared vector was named pDZ-impE1E2 (WT) 2X.

[146]

[147]

Table 5
SEQ ID NO: primer Sequence (5'-3 ')
16 impE1 2-1 GCTCTAGAGAACGGAGTCATCTCCTTTGC
17 impE1 2-2 GGGTCTAGAGAAGCGGCCGCCTACCATTCCAGTCCTTTCGT
18 impE1 2-3 AAGGAAAAAAGCGGCCGCGAACGGAGTCATCTCCTTTGC
19 impE1 2-4 AAGGAAAAAAGCGGCCGCCTACCATTCCAGTCCTTTCGT
20 impE1E2 2-2 GGGTCTAGAGAAGCGGCCGCCCAAACGCTCTGCAAGAAACTG
21 impE1E2 2-4 ATAAGAATGCGGCCGC CCAAACGCTCTGCAAGAAACTG

[148]

[149]

Example 3-4: wild-type impE1, impE2 introduced / enhanced strain evaluation

[150]

Conducted after transfection the pDZ-impE1E2 (WT) prepared in Example 3-1 as a CJI0323_ △ electroporation method to impE1E2 strain prepared in Example 2 (Appl Microbiol.Biotechnol (1999) 52:.. 541-545 transfection method used), the strain by the recombinant vector is inserted into a chromosome of a homologous sequence according to was screened in medium containing kanamycin (kanamycin) 25 mg / L. The selected primary isolates was further carried out secondary cross (cross-over). Whether the final transformants transgenic for the conversion strain was confirmed by carrying out PCR using the primer pair SEQ ID NO: 6, 13. After evaluating the production strain CJI0323_ △ impE1E2_impE1E2 (WT) when the wild type and impE1 impE2 introduced in CJI0323 strain it was confirmed IMP producing ability.

[151]

Also, CJI0323_ △ impE1E2_impE1E2 (WT) a by the strain in recombination of homologous sequences by transforming the pDZ-impE1 (WT) 2X, pDZ-impE1E2 (WT) 2X vector electroporation electroporation method vector was inserted into the chromosome strains were selected on medium containing kanamycin (kanamycin) 25 mg / L. The selected primary isolates was further carried out secondary cross (cross-over). Whether the final plasma enhanced genes of the conversions strain it was confirmed by carrying out PCR using the primer pair SEQ ID NO: 16, 19 and SEQ ID NO: 16, 21. CJI0323_ △ impE1E2_impE1E2 (WT), CJI0323_ △ impE1E2_impE1E2 (WT) conduct _impE1 (WT) 2X and CJI0323_ △ impE1E2_impE1E2 (WT) _impE1E2 (WT) 2X and incubated in the same manner as in Example 2-4, obtaining a strain, and the strain to evaluate the production capacity of the IMP. We measured the production of IMP by the method using HPLC After the completion of the culture, culture results are shown in the following table 6.

[152]

[153]

TABLE 6
Strain name IMP (g/L)
CJI0323_ △ impE1E2 1.80
CJI0323_△impE1E2_impE1E2(WT) 2.32
CJI0323_△impE1E2_impE1E2(WT)_impE1(WT) 2X, 2.52
CJI0323_△impE1E2_impE1E2(WT)_impE1E2(WT) 2X 2.97

[154]

[155]

At this time, the four corridor my IMP accumulation medium of the parent strain tumefaciens stay Yorkshire varnish CJI0323_ △ impE1E2_impE1E2 (WT) and comparing a result, the ImpE1 or ImpE1 and ImpE2 activity under the same conditions as shown in Table 6 of a strain enhanced at the same time It was verified that the concentration is increased up to 28% of the parent strain compared to IMP. Even if the production does not produce the IMP in the genus Corynebacterium microorganisms that produce only infinitesimal, IMP increased production due to the increased activity of a protein ImpE can be interpreted as very meaningful.

[156]

The production cost and CJI0323 CJI0323_ △ impE1E2_impE1E2 (WT) _ impE1E2 (WT) 2X (CJI2236) are each Corynebacterium stay Yorkshire varnish CN01-0323 and stiffness to four bacterium named Solarium stay Yorkshire varnish CN01-2236 under the Budapest Treaty on the International Deposits Deposits agency for Korea Culture Center of microorganisms accession number KCCM12151P respectively deposited as of November 7, 2017 date of the (Korean CultureCenter of microorganisms, KCCM), dated 25 October 2017 and was given the accession number KCCM12137P.

[157]

[158]

Example 3-5: wild-type impE1 or impE2 enhanced promoter of vector production

[159]

Gene fragment was obtained by PCR of genomic DNA to the ATCC6872 as a template for making a vector is replaced by an enhanced promoter for each gene promoter.

[160]

The enhanced promoter was used for Corynebacterium stay Yorkshire (Republic of Korea Patent Publication No. 10-0620092) Pcj7 that are reported to be strongly expressed in a fitness promoter.

[161]

impE1 PCR was processed for each of the gene fragments amplified by using primers of SEQ ID NOS: 22 and 13 primers, 24 and 25 of a restriction enzyme of XbaI, NdeI, was cloned into the XbaI restriction enzyme located in the pDZ vector. And to amplify the Pcj7 gene fragment handle fragment obtained by proceeding the PCR with primers of SEQ ID NOS: 30 and 31 ATCC6872 it to the genomic DNA as a template with NdeI and processing the produced vector as a NdeI pDZ-Pcj7_impE1 (WT) vector It was produced.

[162]

impE2 PCR was processed for each of the gene fragments amplified by using primers of SEQ ID NOS: 26 and 27 primers, 28 and 29 with restriction enzyme XbaI in, NdeI, was cloned into the XbaI restriction enzyme located in the pDZ vector. Processing the obtained Pcj7 gene fragment and vector by NdeI made to prepare a pDZ-Pcj7_impE2 (WT) vector.

[163]

[164]

Table 7
SEQ ID NO: primer Sequence (5'-3 ')
22 impE1 Pcj7-1 GCTCTAGAGGTGAGCGCGAAGGGGACGCG
23 impE1 Pcj7-2 GGAATTCCATATGTGTTACACCCCGTGCAAGTTT
24 impE1 Pcj7-3 GGAATTCCATATGCATGCTGTGCAAGAAGTT
25 impE1 Pcj7-4 GCTCTAGATTCAGCATTGGCCACTGGGAA
26 impE2 Pcj7-1 GCTCTAGATTGCATGCTGTGCAAGAAGTT
27 impE2 Pcj7-2 GGAATTCCATATGCTACCATTCCAGTCCTTTCGT
28 impE2 Pcj7-3 GGAATTCCATATGGTAGCTAAAAACTCCACC
29 impE2 Pcj7-4 GCTCTAGAAATAGTTGGGGAAGTCCACTC
30 Pcj7 F GGAATTCCATATGTCCCAGCGCTACTAATAGG
31 Pcj7 R GGAATTCCATATGGAGTGTTTCCTTTCGTTGGG

[165]

[166]

Example 3-6: wild-type impE1, impE2 promoter replacement strain evaluation

[167]

Carried out after transformation with the CJI0323_ △ impE1E2_impE1E2 (WT) electroporation method to strain produced in the embodiment the two kinds of plasmids prepared in Example 4-1, each example 3-3 (Appl. Microbiol.Biotechnol. (1999) 52 : transformation method used), the strain by the recombinant vector is inserted into a chromosome of a homologous sequence of the 541-545 were selected on medium containing kanamycin (kanamycin) 25 mg / L. The selected primary isolates was further carried out secondary cross (cross-over). Whether the final plasma enhanced genes of the conversions strain it was confirmed by carrying out PCR using the primer pair SEQ ID NO: 22, 25 and SEQ ID NO: 26, 27. Strains of the produced 2 species was named CJI0323_ △ impE1E2_impE1E2 (WT) _Pcj7 / impE1 (WT), CJI0323_ △ impE1E2_impE1E2 (WT) _Pcj7 / impE2 (WT). Further, making the CJI0323_ △ impE1E2_impE1E2 (WT) _Pcj7 / impE1 (WT) was transformed with the pDZ-Pcj7_impE2 (WT) based on the strain, the strain by the recombinant vector is inserted into a chromosome of a homologous sequence is kanamycin (kanamycin) were selected on a medium containing 25 mg / L. The selected primary isolates was further carried out secondary cross (cross-over). Whether the final plasma enhanced genes of the conversions strain it was confirmed by carrying out PCR using the primer pair SEQ ID NO: 26, 29. The prepared strain was designated as CJI0323_ △ impE1E2_impE1E2 (WT) _Pcj7 / impE1 (WT) _Pcj7 / impE2 (WT). Next, the production strain CJI0323_ △ impE1E2_impE1E2 (WT) _Pcj7 / impE1 (WT), CJI0323_ △ impE1E2_impE1E2 (WT) _Pcj7 / impE2 (WT), and CJI0323_ △ impE1E2_impE1E2 (WT) _Pcj7 / impE1 (WT) _Pcj7 / impE2 (WT ) carried by the respective cultures in the same manner as in example 2-4, were evaluated for IMP producing ability.

[168]

We measured the production of IMP by the method using HPLC After the completion of the culture, culture results are shown in the following table 8.

[169]

[170]

Table 8
Strain name IMP (g/L)
CJI0323_△impE1E2_impE1E2(WT) 2.32
CJI0323_△impE1E2_impE1E2(WT)_Pcj7/impE1(WT) 2.47
CJI0323_△impE1E2_impE1E2(WT)_Pcj7/impE2(WT) 2.81
CJI0323_△impE1E2_impE1E2(WT)_Pcj7/impE1(WT)_Pcj7/impE2(WT) 2.97

[171]

[172]

At this time, the inside IMP accumulation medium parent strain of Corynebacterium stay Yorkshire varnish CJI0323_ △ impE1E2_impE1E2 (WT) and comparing a result, the ImpE1 and / or ImpE2 activity strengthened under the same conditions, strains as shown in Table 8 of the the concentration of the parent strain compared to IMP was found that up to 28% increase.

[173]

Said the CJI0323_ △ impE1E2_impE1E2 (WT) produced _Pcj7 / impE1 (WT) and CJI0323_ △ impE1E2_impE1E2 (WT) _Pcj7 / impE2 (WT) strain international deposit agency Conservation Center Korea microorganisms under the Budapest Treaty (Korean Culture Center of Microorganisms, KCCM) November 2, 2018 date of accession to the KCCM12357P been given an accession number and KCCM12358P respectively.

[174]

[175]

Example 4: IMP production share-based impE1, impE2 strengthen

[176]

[177]

Example 4-1: Production IMP state based impE1, impE2 enhanced production strain

[178]

The activity of succinate synthase (adenylosuccinate synthetase) and IMP dehydrogenase (IMP dehydrogenase) to adenylate for the degradation pathways of the IMP from ATCC6872 in order to determine the enhanced effect of impE1, impE2 in IMP-producing strain of weakening It was produced in the strain. The first start codon by changing the second nucleotide from a to t encoding the two enzymes in the nucleotide sequence of each gene purA and guaB was changed. The ATCC6872 in which the expression of the two genes is attenuated strain was named CJI9088. Produced in Example 3-3 in the manufacture CJI9088 strain pDZ-impE1 (WT) 2X and pDZ-impE1E2 (WT) 2X vector in a chromosome by recombination of homologous sequences in transformed by electroporation method is inserted strains were selected on medium containing kanamycin 25mg / l. The selected primary isolates was carried out a second cross again. Whether the final transformants transgenic for the conversion strain was confirmed by carrying out PCR using the primer pair SEQ ID NO: 6, 13.

[179]

The fabricated CJI9088 and CJI9088_impE1 (WT) 2X, CJI9088_impE1E2 (WT) was evaluated for IMP producing ability of the strain 2X. We measured the production of IMP by the method using HPLC After the completion of the culture, culture results are shown in the following table 9.

[180]

[181]

Table 9
Strain name IMP (g/L)
CJI9088 0.52
CJI9088_impE1(WT) 2X 0.68
CJI9088_impE1E2(WT) 2X 0.87

[182]

[183]

Make my accumulated IMP medium results, it was confirmed that the increase up to 67% compared to the parent strain CJI9088 IMP producing ability. From this, by enhancing the activity of the protein (ImpE) for discharging the 5'-inosinate of the present application, it was confirmed that the IMP can be increased output.

[184]

[185]

From the above description, those skilled in the filed will appreciate that this application without changing the technical spirit or essential features may be embodied in other specific forms. In this regard, the embodiments described above are only to be understood as exemplary rather than limiting in all aspects. The scope of the present application should be construed as the meaning and scope, and all such modifications as derived from the equivalent concepts of the following claims rather than the foregoing description within the scope of the present application.

[186]

[187]

[188]

[189]

[190]

Claims

[Claim 1]

SEQ ID NO: 1, or genus Corynebacterium microorganism, the activity of the protein consisting of the amino acid sequence of SEQ ID NO: 2 to produce a reinforced, 5'-inosinate.

[Claim 2]

The method of claim 1, wherein the microorganism of the genus Corynebacterium is Corynebacterium stay Yorkshire fitness (to produce the 5'-inosinate Corynebacterium stationis) of, the genus Corynebacterium microorganism producing 5'-inosinate.

[Claim 3]

The method of claim 1, wherein the reinforcement are: 1) increasing the copy number of the polynucleotide encoding the amino acid sequence, 2) modification of the expression control sequences to increase the expression of the polynucleotide, and 3) the chromosome so that the enhanced activity of the protein on the polyester variant of the nucleotide sequence, or 4) the genus Corynebacterium microorganism which produces a combination thereof, 5'-inosinate.

[Claim 4]

2. The method of claim 1, wherein the microorganism adenylate a succinate synthase (adenylosuccinate synthetase) or IMP dehydrogenase (IMP dehydrogenase) Corynebacterium which is active to produce the added, 5'-inosinate weakening in the Solarium spp.

[Claim 5]

The 5'-inosinate method comprising the step of culturing a microorganism of the genus Corynebacterium of claim 1 in a culture medium.

[Claim 6]

The method of claim 5, wherein the method 5'-inosinate method further comprising the step of recovering the 5'-inosinate in the microorganism or the medium.

[Claim 7]

The method of claim 5, wherein the microorganism of the genus Corynebacterium is Corynebacterium stay Yorkshire fitness (to produce the 5'-inosinate Corynebacterium stationis) of 5'-inosinate method.

[Claim 8]

5'-inosinate producing composition comprising a protein consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[Claim 9]

Of SEQ ID NO: 1 or SEQ ID NO: 2 protein consisting of the amino acid sequence of, the genus Corynebacterium 5'-inosinate, for the production of a microorganism producing increased.

[Claim 10]

SEQ ID NO: 1, or the method of increasing the discharge SEQ ID NO: 2, 5'-inosinate which comprises a step of enhancing the protein consisting of the amino acid sequence in the microorganism of the genus Corynebacterium.

[Claim 11]

Of SEQ ID NO: 1 or SEQ ID NO: 2 protein consisting of the amino acid sequence of, the genus Corynebacterium 5'-inosinate, for the production of microbial emissions increase.