[0001] The present disclosure pertains to a biosensor based system to detect infection. In particular, the present disclosure provides a system for identifying Escherichia coli infection and antibiotic resistance in patients with acute leukaemia (AL). In particular the present disclosure provides a detecting system comprising a DNA based biosensor system for identifying Escherichia coli in a given sample to detect infection as well as antibiotic resistance in patients with acute leukaemia.

BACKGROUND
[0002] The background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.
[0003] Infection is a critical challenge for a patient suffering from any other diseases, but it becomes fatal in patients with malignancies. Patients having haematological malignancies like acute leukaemia, chronic leukaemia, lymphoma, myeloma develop infection up to 85%, where acute leukaemia (AL) is solely responsible up to 60-65% infection during induction therapy.
[0004] Prophylactic treatment to this infection leads to multi antibiotic resistance and increase the mortality rate. As already known, ß lactam or penicillin antimicrobial agent are the most common treatment for bacterial infection and continue to become most common cause of antibiotic resistance among the gram negative bacterial infection. The reason behind this antibiotic resistance is extended-spectrum ß-lactamases (ESBLs) producing Enterobacteriaceae species due to persistence exposure of ß lactam antibiotics. Hence, due to complications related to infection and lack of immediate culture results, physician are compelled to start prophylactic antibiotic medication to treat infection in AL patients in a set regimen that is the on the first day, antibiotics against gram negative bacteria, third day, antibiotics against gram positive followed by antifungal treatment on the fifth day without waiting for culture report, which further leads to antibiotic resistance due to prolonged exposure to antibiotics and thus increase fatality risk.
[0005] The conventional approach to identify infection causing microorganisms is very tedious, time-consuming, exhaustive, and require special designed laboratories (like P2 Lab) well equipped with high maintenance tools, which need properly trained people to perform single experiment such as staining, culture, sensitivity, microscopy, PCR, RT-PCR, MALDI, sequencing, NGS (Next generation sequencing) and still these tests generate results after 3-7 days. Further, detecting infection and antibiotic resistance with high sensitivity and specificity still remains a challenge, especially in patients already suffering from acute leukaemia or other immune-compromised diseases. Moreover, the existing equipment are not easily movable for setting-up detection system at the site of the patient. Hence, there does exists an urgent unmet need for a portable system for identification of microorganisms like E. coli and detect infection in less time with higher sensitivity and specificity.

OBJECTS OF THE PRESENT DISCLOSURE
[0006] Some of the objects of the present disclosure, which at least one embodiment herein satisfies are as listed herein below.
[0007] It is an object of the present disclosure to provide a detecting system comprising a DNA biosensor for identifying Escherichia coli in a given sample.
[0008] It is an object of the present disclosure to provide a DNA biosensor based detecting system for simultaneously detecting infection as well as antibiotic resistance in patients with acute leukaemia.
[0009] It is an object of the present disclosure to provide a DNA biosensor based detecting system for identifying Escherichia coli in a given sample for simultaneously detecting infection as well as antibiotic resistance in patients with acute leukaemia in shorter duration.
[00010] It is an object of the present disclosure to provide a DNA biosensor based detecting system for identifying Escherichia coli in a given sample for simultaneously detecting infection as well as antibiotic resistance in patients with acute leukaemia with high sensitivity and specificity.
[00011] It is another object of the present disclosure to provide a DNA biosensor based detecting system, which is portable for identifying Escherichia coli in a given sample of patients with acute leukaemia.

SUMMARY
[00012] In an aspect, the present disclosure provides a DNA biosensor based system for identifying a strain of Escherichia coli (E. coli) in a sample for detection of an infection and antimicrobial resistance caused by the strain of E. coli in a patient with acute leukaemia. The system includes a set of hybridization probes including at least one capture probe and at least one detector probe, wherein the working electrodes may be capable of undergoing an oxidation-reduction process and may be functionalized by coating with streptavidin. The capture probe may include a first oligonucleotide sequence that is a single-stranded oligonucleotide tagged with biotin at 5’-end and the detector probe may include a second oligonucleotide sequence that is a single-stranded oligonucleotide tagged with fluorescein at 3’end. In an embodiment, each of the probe can be single-stranded oligonucleotides that may be complimentary to each strand of a pair of strands in a target nucleic acid sequence of a gene corresponding to the strain of E. coli, wherein each of the first oligonucleotide sequence and the second oligonucleotide sequence may be capable of independently hybridizing with each strand of the pair of strands of target nucleic acid sequence obtained after cell lysis of the E. coli, wherein if the target nucleic acid sequence corresponding to the strain of E. coli is present in the sample, the independent hybridization may occur that forms a three-dimensional complex between the target nucleic acid and the set of hybridization probes. The formation of the three-dimensional complex can be detected by the one or more working electrodes by the oxidation-reduction process that may enable generation of an electrical signal for identifying the strain of E. coli in the sample in the nucleic acid based detection of the infection and antimicrobial resistance caused by the strain of E. coli. In an embodiment, the one or more working electrodes are carbon-based electrodes screen printed on a paper.
[00013] In an embodiment, the system can be used for identifying antibiotic resistant strain selected from wild strain, pathogenic strain and an extended spectrum beta-lactamase (ESBL) producing strains of E.coli.
[00014] In an embodiment, the first oligonucleotide sequence may be a single-stranded oligonucleotide tagged with biotin at 5’- end of the oligonucleotide, and wherein the second oligonucleotide sequence may be a single-stranded oligonucleotide tagged with fluorescein at 3’- end of the oligonucleotide.
[00015] In an embodiment, the capture probe may be localized on working electrodes by conjugation interaction between the streptavidin functionalized on the working electrode, wherein the detection of the sample for identifying the strain of E. coli may be done in a time duration in the range of 1 minute to 120 minutes. In an embodiment, the sample may be a biological fluid selected from blood, urine and other biological fluids of a body. In an embodiment, the detection of the formation of the three-dimensional complex can be done by using Anti-Fluorescein-POD, Fab fragments from sheep, a buffer and detection reagents.
[00016] In another aspect, the present disclosure provides a kit for identifying Escherichia coli (E. coli) in a sample for detection of an infection and antimicrobial resistance caused by E. coli in a patient with acute leukaemia. The kit can include any or a combination of one or more carbon-based working electrodes, a panel of hybridization probes and one or more reagents, wherein the working electrodes may be screen printed on a paper, a panel of hybridization probes and reagents for DNA extraction, wherein the panel of hybridization probes can include capture probes and detector probes that may have oligonucleotides complementary to and capable of hybridizing to a target nucleic acid sequences of a gene for identification of any infection causing pathogenic strain and Antibiotic resistant strain ( ESBL producing strains of E.coli). The one or more reagents can be selected from any or a combination of streptavidin, biotin, Anti-Fluorescein-POD, Fab fragments from sheep, a buffer and detection reagents including 3,3´, 5,5´-tetramethylbenzidine (TMB) stabilized substrate for horseradish peroxidase.
[00017] The system and kit of the present disclosure provides a convenient, rapid and cost-effective way of identifying a strain of E. coli in a sample for detection of an infection and antimicrobial resistance.
[00018] Various objects, features, aspects and advantages of the inventive subject matter will become more apparent from the following detailed description of preferred embodiments.

BRIEF DESCRIPTION OF DRAWINGS
[00019] The accompanying drawings are included to provide a further understanding of the present disclosure, and are incorporated in and constitute a part of this specification. The drawings illustrate exemplary embodiments of the present disclosure and, together with the description, serve to explain the principles of the present disclosure.
[00020] The diagrams are for illustration only, which thus is not a limitation of the present disclosure, and wherein:
[00021] FIG. 1 illustrates the system and overall mechanism of detection of an infection or antibiotic resistance, in accordance with an embodiment of the present disclosure.
[00022] FIG. 2 illustrates cyclic voltammetry data for E. coli infection sensor of varying dilution developed by using Dh-5a as wild strain and MTCC 4296, in accordance with an embodiment of the present disclosure.
[00023] FIGs. 3A-3D illustrate cyclic voltammetry data that show oxidation reduction cycles of various E. coli probes, in accordance with embodiments of the present disclosure.
[00024] FIG. 4A illustrates cyclic voltammetry data that show oxidation reduction cycles depicting pattern of positivity of 16s RNA probes in term of reduction current, in accordance with an embodiment of the present disclosure.
[00025] FIG. 4B illustrates cyclic voltammetry data that show oxidation reduction cycles of an infection biosensor having specificity of infection probes corresponding to rfb gene and 16sRNA, in accordance with an embodiment of the present disclosure.
[00026] FIG. 5 illustrates cyclic voltammetry data showing positivity for species specific drug resistant probe CTX-M1 in E.coli NCIM-2571, in accordance with an embodiment of the present disclosure.

DETAILED DESCRIPTION
[00027] The following is a detailed description of embodiments of the present disclosure. The embodiments are in such detail as to clearly communicate the disclosure. However, the amount of detail offered is not intended to limit the anticipated variations of embodiments; on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the present disclosure as defined by the appended claims.
[00028] Unless the context requires otherwise, throughout the specification which follow, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense that is as “including, but not limited to.”
[00029] Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.
[00030] As used in the description herein and throughout the claims that follow, the meaning of “a,” “an,” and “the” includes plural reference unless the context clearly dictates otherwise. Also, as used in the description herein, the meaning of “in” includes “in” and “on” unless the context clearly dictates otherwise.
[00031] In some embodiments, the numbers expressing quantities of ingredients, properties such as concentration, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term “about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable.
[00032] The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.
[00033] All methods described herein can be performed in suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g. “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.
[00034] The headings and abstract of the invention provided herein are for convenience only and do not interpret the scope or meaning of the embodiments.
[00035] Various terms are used herein. To the extent a term used in a claim is not defined below, it should be given the broadest definition persons in the pertinent art have given that term as reflected in printed publications and issued patents at the time of filing.
[00036] The oxidation-reduction potential means the standard potential of an atom or ion that undergoes oxidation at the anode or reduction at the cathode in an electrochemical cell as compared to the redox potential of a standard carbon-based printed working electrodes
[00037] The present disclosure relates to a DNA biosensor based system for identifying a strain of Escherichia coli (E. coli) in a sample for detection of an infection and antimicrobial resistance caused by the strain of E. coli in a patient with acute leukaemia. The system can be designed and customized for detecting a wide range of infection causing strains of E. coli in the sample. The system of the present disclosure can be an effective alternative for most of the existing modalities in term of time, experimental-expenditure, human labor and cost for infection detection and antibiotic resistance to obtain the results in a qualitative and quantitative manner.
[00038] As per an embodiment of the present disclosure, the system can include a set of hybridization probes comprising at least one capture probe and at least one detector probe. The carbon-based working electrodes may be functionalized by coating with at least one protein. The functionalized protein on the working electrodes may provide a platform for localization of the capture probe on the working electrodes. In an exemplary embodiment, the functionalization may be done with proteins selected from streptavidin and avidin. These protein compounds have extraordinarily high affinity for conjugating compounds like biotin (tagged to capture electrodes) and hence can provide a good localization of the capture probes on the working electrodes. In an embodiment, the one or more electrodes can be capable of undergoing an oxidation-reduction process.
[00039] The capture probe may be a single-stranded oligonucleotide. The first oligonucleotide may be tagged with biotin so that the capture probe can be localised on the one or more working electrodes, wherein biotin is capable of conjugating with the protein on the working electrodes. In an exemplary embodiment, biotin may be tagged at 5-’ or 3’- end of the first oligonucleotide sequence. In an embodiment, the detector probe may be a single-stranded oligonucleotide tagged with fluorescein. In an exemplary embodiment, fluorescein that may be tagged at 5-’ or 3’- end of the second oligonucleotide sequence.
[00040] In an embodiment, each of the first oligonucleotide sequence and the second oligonucleotide sequence can be single-stranded oligonucleotide complimentary to each strand of a pair of strands in a target nucleic acid sequence of a gene corresponding to the strain of E. coli to be identified. Upon lysis of the cell wall of E. coli, the target nucleic acid sequence may be accessed for independent hybridization with the oligonucleotide sequence of the capture probe and the oligonucleotide sequence of the detector probe. In one embodiment, upon cell lysis, the detector probe may be hybridized with one strand of the pair of strands of the target nucleic acid sequence to form a target nucleic acid-detector probe complex, followed by hybridization of the capture probe with another strand of the pair of strands of the target nucleic acid sequence to form a target nucleic acid-capture probe-detector probe complex, which may be a three-dimensional complex between the target nucleic acid and the set of hybridization probes. The technique is efficient due to three-dimensional sandwich structure formed comprising a target sequence in-between a capture probe and detector probe towards the sensor, making the sensor species specific and capable of simultaneously detecting infection and multidrug resistance in a given sample.
[00041] In an embodiment, formation of three-dimensional complex can be detected by the one or more working electrodes by the oxidation-reduction process that enables generation of an electrical signal for identifying the strain of E. coli in the sample in detection of the infection and antimicrobial resistance. In an embodiment, the one or more carbon-based working electrodes may be carbon based electrodes screen printed on a paper. In an embodiment, the detection of the formation of the three-dimensional complex can be done by using one or more reagents selected from any or a combination of anti-fluorescein monoclonal Fab fragment, horseradish peroxidase, a buffer and detection reagents (TMB Substrate). The reagent anti-fluorescein monoclonal Fab fragment may be used for detection of fluorescein-labelled compounds whereas reagent horseradish peroxidase is a metalloenzyme that can catalyse the oxidation of various organic substrates. These reagents may be added after formation of the three dimensional complex, wherein the anti-fluorescein monoclonal Fab fragment may interact with the fluorescein of the detector probe and enable detection of the three-dimensional complex. The reagent horseradish peroxidase may enable to promote the oxidation and reduction process to generate the electrical signal that may be measured using one or known techniques. Thus, these reagents may enable measurement of one or more attributes related to qualitative and/or quantitative analysis of the three-dimensional complex for effective identification of the type or the strain of E. coli and their quantitative analysis.
[00042] Based on the type of oligonucleotide being used in the capture probe and the detector probe, the type of E. coli strain may be identified. The formation of the three-dimensional complex may be confirmed by detection using one or more methods that can enable measurement of electrical signal due to formation of the complex, wherein the three-dimensional complex formation may depend on the nature of the target nucleic acid sequence and thus provide a qualitative data on the type of E. coli strain being detected. Based on the measurement, current output can provide an estimate of hybridization between capture probe, target nucleic acid sequence and the detector probe, wherein the result can indicate number of bacterial cells in the sample that may be directly proportional to current output. In an embodiment, the current output may be measured by using cyclic voltammetry. In an exemplary embodiment, a potential of ±2.5V may be applied for a time duration in the range of 30 seconds to 1.5 minutes with scan rate of 0.1 second to obtain the current output that may provide a quantitative idea regarding the number of bacterial cells in the sample.
[00043] In certain embodiments the present disclosure provides a capture probe and a detector probe specific to a target nucleic acid sequence of a specific gene(s) for identifying antibiotic resistance selected from wild strain, pathogenic strain and an extended spectrum beta-lactamase (ESBL) producing strains of E.coli.
[00044] In an embodiment, the set of hybridization probes may be capable of individually hybridizing to 16S rRNA of pathogenic E. coli strain MTCC-4296, wherein the probes may be used to identify a UTI infection and discriminate from the pathogenic and drug-resistant E. coli strains.
[00045] In an embodiment, the set of hybridization probes may be capable of individually hybridizing to a target nucleic acid sequence of rfb-E gene of E. coli O157:H7 strain and identifying the pathogenic E. coli strain (Enterotoxigenic E.coli- ETEC) to detect haemorrhagic infection.
[00046] In an embodiment, the set of hybridization probes may be capable of individually hybridizing to any of the target nucleic acid sequence of the gene selected from CTX-M1, in extended spectrum beta-lactamase (ESBL) producing E. coli resistant to antibiotics selected from cephalosporins belonging to one to four classes, fluoroquinolones, and monobactam in detection of multi-drug resistance.
[00047] In an embodiment, the target nucleic acid sequence can correspond to a DNA or a plasmid. In an embodiment, the first oligonucleotide sequence and the second oligonucleotide sequence can have a sequence selected from CTGCGGGTAACGTCAATGAGCAAA corresponding to 16s RNA, CTATTACTACAGGTGAAGGTGGAAT corresponding to rfb gene, and GGCATTGATTAACACAGCAGATAA corresponding to CTX-M gene.
[00048] In an embodiment, the detection of the sample for identifying the strain of E. coli may be done in a time duration in the range of 1 min to 120 mins. In an exemplary embodiment, the detection may be done in a time period of less than 2 hours. In another exemplary embodiment, the sample may be detected for identification of the strain of E. coli in the range of 1 minutes to 5 minutes. The sample may be a biological fluid selected from blood, urine and other biological fluids of a body. The system of the present disclosure may enable a detection limit in the range of 10 to 10 10 CFU/ml in a sample such as blood and urine samples. The system may be very specific due to its gene specific probes hybridization to the target sequence.
[00049] The detecting system in accordance with the present disclosure is novel, rapid, economical, sensitive and specific to target nucleic acid of a specific gene, robust, portable and capable of being used as a point of care device. The detecting system in accordance with the present disclosure renders it useful specifically in oncologist clinics to detect infection and antibiotic resistance status. The detecting system in accordance with the present disclosure can enable a physician to identify the E. coli infection and antibiotic resistance in a given sample in acute leukaemia (AL)patients during induction therapy, which will help in stratifying the AL patients according to their disease severity to tolerate the treatment. Thus, the detecting system in accordance with the present disclosure can help physician to and arrive at the treatment regimen by selecting suitable antibiotics according to the site and species-specific infection. The detecting system in accordance with the present disclosure can be useful in detecting infection in patients with different malignancies, which are predominant in bacterial infection and likewise in patients with others diseases as well. The detecting system in accordance with the present disclosure can be used as a monitor tool of infection in patients suffering from acute leukaemia, other cancers and diseases.
[00050] In another aspect, the present disclosure provides a kit for identifying a strain of Escherichia coli (E. coli) in a sample in DNA-based detection of an infection and antimicrobial resistance caused by the strain of E. coli in a patient with acute leukaemia. The kit can include any or a combination of one or more carbon-based working electrodes screen printed on a paper, a panel of hybridization probes and one or more reagents, wherein the panel of hybridization probes can include capture probes and detector probes that have oligonucleotides complementary to and capable of hybridizing to a target nucleic acid sequences of a gene for identification of infection causing wild strain, pathogenic strain and ESBL producing strains of E.coli. The one or more reagents can be selected from any or a combination of streptavidin, biotin, anti-fluorescein monoclonal Fab fragment, horseradish peroxidase, a buffer and detection reagents.
[00051] In an exemplary embodiment, the kit can include working electrodes provided by microfabrication technology by printing carbon-based working electrodes on a cellulosic substrate and capable of undergoing and measuring oxidation-reduction; a single-stranded oligonucleotide capture probe, and a single-stranded oligonucleotide detector probe complimentary to and capable of hybridizing with target nucleic acid sequence of a specific gene of one or more of microbial strain(s) selected from a wild type strain, an infection causing strain and an antibiotic resistant bacteria; and optionally other reagents.
[00052] In an embodiment, the kit can include a panel of sets of probes (capture probes and detector probes), wherein each set can include a single-stranded oligonucleotide capture probe biotin tagged at 5’end, and a single-stranded oligonucleotide detector probe fluorescent tagged at 3’- end, wherein the respective oligonucleotides of the probes can be complimentary to and capable of hybridizing with target nucleic acid sequence of a specific gene of E. coli strain.
[00053] In another aspect, the present disclosure provides a method for preparation of the working electrodes and probes for identification of infection-causing strain of E.coli in a given sample as also illustrated in FIG. 1. The method can include obtaining working electrodes by microfabrication technology by printing carbon-based working electrodes on paper, wherein the working electrodes may be capable of undergoing and measuring oxidation-reduction; providing a set/panel of a single-stranded oligonucleotide capture probe, and a single-stranded oligonucleotide detector probe, each probe bearing oligonucleotides that can be complimentary to and capable of hybridizing to target nucleic acid sequence of a specific gene(s) of one or more infection causing and antibiotic resistant bacterial cells; functionalizing printed carbon-based working electrodes with streptavidin (numeral 1 in FIG. 1); localizing a single-stranded oligonucleotide capture probe tagged with biotin on the DNA biosensor (2); lysing the bacterial cells of E. coli in the given sample and releasing the target nucleic acid sequence (3); allowing the first hybridization to take place between a fluorescein tagged single stranded oligonucleotide detector probe capable of hybridizing with the target nucleic acid sequence at a specific temperature to form a detector probe-target nucleic acid complex (4); allowing the second hybridization to take place between the detector probe-target nucleic acid complex with the capture probe localized on the screen printed electrode-target nucleic acid sequence forming a three dimensional structure of the target nucleic acid sequence between the capture probe and the detector probe towards the sensor (5); adding anti-fluorescein monoclonal Fab fragment on the resultant three dimension structure of the capture probe-target nucleic acid sequence-detector probe; adding horseradish peroxidase; and measuring the oxidation-reduction response at the sensor working electrodes on a suitable test equipment (6).
[00054] In an embodiment the hybridization between the fluorescein tagged single stranded oligonucleotide detector probe with the target nucleic acid sequence may be done at 65 0C in incubator. The method in accordance with the present disclosure may be carried out by adopting cyclic voltammetry principle for measuring the reduction potential of a microbial species in the reaction solution. In an embodiment, the suitable equipment to measure the electrical signal/oxidation-reduction response may be portable potentiometer/potentiostat, which being, a low cost equipment can add to the cost-effectiveness of the testing.
[00055] In an embodiment the hybridization may be carried out by applying current to the working electrodes. The voltage applied can be of ±2.5V about 1 minute, preferably from about 30 seconds to 90 seconds with a scan rate of 0.1 second to about 0.5 seconds. The current output may impart threshold of hybridization between capture probe-target nucleic acid sequence-detector probe. The result may be generated in format of number of bacterial cells in the sample directly proportional to reduction current output using cyclic voltammetry principle.
[00056] The localization of probes, and double hybridization between capture probe, target nucleic acid sequence and detector probe provide three-dimensional structure working electrode of screen printed electrode acting as a nucleic acid based or DNA biosensor, and thereby result in profound sensitivity in detecting infection causing and antibiotic resistant strain of E. coli and thereby enables detection of infection and antibiotic or multidrug resistance. The method in accordance with the present invention is capable of detecting infection causing and antibiotic resistant bacteria within 1 minute to 120 minutes.
[00057] The system and kit in accordance with the present disclosure is capable of detecting microbial cells from 101 to 10 10 CFU/ml from a given sample, the sample preferably being blood and urine samples. The system and kit of the present disclosure may be capable of providing results in terms of cell number of E.coli strain causing infection and antibiotic resistant in patient with acute leukaemia, are accordingly more sensitive as compared to the conventional culture tools and method used to detect infection. Further, due to ability to identify specific bacterial cells due to specificity to target nucleic acid, the system and kit of the present disclosure are contemplated to be superior in term of time and other aspects to the existing culture, PCR and sequencing tools and techniques. The system and kit in accordance with the present disclosure can be used by a physician to prescribe specific antibiotic course to acute leukaemia patients who are suffering from infection based on the output received. The system and kit of the present disclosure can also be used by a physician to identify infection in each and every disease where it can be used as monitoring tool to treat infection in acute leukaemia patients, thus providing faster and cost-effective analysis that can overcome the disadvantages of the conventional systems.
[00058] The present disclosure is further explained in the form of following examples. However, it is to be understood that the foregoing examples are merely illustrative and are not to be taken as limitations upon the scope of the invention. Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications may be made without departing from the scope of the invention.
Example-1 (Preparation of the E.coli biosensor electrodes/probes and measurement of biological sample)
[00059] An electrode for biosensor based detection system was prepared for detecting E. coli strain by microfabrication technology by printing carbon-based working electrodes on paper. The printed carbon-based working electrodes were functionalized with 10µL of 0.5mg/ml streptavidin at room temperature for 10 minutes. The 10µL of E.coli specific targeted (16s RNA gene targeted for E.coli infection (UTI,URI etc. detection/rfb-E gene to target EHEC -haemorrhagic infection/CTX-M gene targeted ESBL producing E.coli for antibiotic resistance) capture probe was immobilized on the screen printed electrode by at room temperature for 30 minutes, after which the probe was then washed with phosphate buffer saline (having19ml of 1M Na2HPO4 and 81ml of 1M K2HPO4) having pH of 7.4.
A biological sample containing human urine (or blood sample) was taken from an acute leukaemia patient. The urine sample was used in undiluted form whereas a blood sample was diluted with water in 1:1 ratio before usage. The sample was centrifuged at 14000 rpm for 15 minutes at room temperature to obtain a sedimented portion/pellet of plasmid DNA which was used for further analysis whereas the supernatant was discarded. Further, a 350µL cocktail mixture was prepared for adding to the pellet obtained from the urine sample for carrying out cell lysis of the gram negative bacterium to be detected. The cocktail mixture included 1 molar sodium hydroxide solution, 10% Tween+ 20mM Tris(hydroxymethyl)aminomethane hydrochloride (Tris HCl), 1 mM EDTA, Lysozyme (10mg/ml) in 10mM tris HCL, wherein the volume ratio of all the five ingredients was 1:1:1:0.5:0.25. Upon adding the cocktail mixture to the pellet obtained by the centrifugation of the urine sample, the urine sample released target nucleic acid sequence after cell lysis. The resultant mixture was centrifuged at 14000 rpm for 15 minutes and the resultant supernatant solution was taken. A complex based on hybridization between nucleic acid sequence and detector probe was obtained by adding a species specific detector probe to the supernatant solution inside cold box at 65° C incubator for 10 minutes to form a detector probe-target nucleic acid complex. The detector probe was designed and prepared by tagging a single-stranded oligonucleotide with fluorescein. After that, second hybridization was allowed between the detector probe-target nucleic acid complex with the capture probe – inside a cold box (having temperature of 4 °C) at 65° C incubator for 15 minutes, forming a three dimensional structure of the target nucleic acid sequence with the capture probe and the detector probe. This was followed by addition of Anti-Fluorescein-POD, Fab fragments from sheep was done for 10 minutes at room temperature and the oxidation-reduction response at the sensor electrodes was measured adding TMB substrate using potentiostat.
Example 2 – E. coli sensor to detect Urinary tract infection (UTI) and bloody diarrhoea in acute leukaemia patient:
The bacterial cultures were grown in Luria broth over night at 37°C at 180 rpm in an incubator cum shaker as per standard guideline. The cells were isolated in log phase where OD between (0.5-1) was used at 600nm, and further spiked individually with blood and urine sample wherein the urine sample was used in undiluted form whereas blood sample was diluted with water in 1:1. The sensor was standardized for E.coli culture using standard E.coli bacterial isolates and later implemented in experiment for detection in the blood and urine spiked with E.coli strain up to 101 to 1010 CFU.
E. coli infection sensor was developed by using MTCC 4296 (UTI pathogenic E. coli strain as positive control for UTI infection. The cyclic voltammetry data for all the dilutions are as provided in Table 1 and in FIG. 2.
Table 1: E. coli Probe in diluted samples 01 to 09 of MTCC 4296 (UTI pathogenic E. coli strain
Diluted samples Dilution level Voltage (V) Current (in (µA)
01 10-1 0.18 -29.81
02 10-2 0.19 -23
03 10-3 0.22 -19.4
04 10-4 0.18 -19
05 10-5 -0.21 -17.4
06 10-6 0.18 -15.9
07 10-7 0.21 -9.7
08 10-8 0.21 -8.992
09 10-9 0.21 -4

To develop E. coli sensor to detect haemorrhagic diarrhoea, O157-H7 strain was purchased from Microbial Type Culture Collection and Gene Bank, Pune India. The present method was focussed on detection of the rfb-E gene to detect the presence of all possible E. coli O157 strains, wherein unique trait of rfb gene to detect all 39 strains (that for O157:H7 and O157:H). The O157 rfb-E PCR assay developed herein provides a selective and rapid technique for confirmation of the O157 serogroup.
FIGs. 3A-3D illustrate cyclic voltammetry data that show oxidation reduction cycles of various E. coli probes used in this study, wherein a positive result or presence of a strain of E.coli was known by presence of reduction current. As illustrated in FIG. 3A and 3B, 16s RNA based probe shows positivity towards UTI strain MTCC-4296 respectively. Further, as shown in FIG. 3C, rfb gene based probe shows positivity in pathogenic strain of E.coli O157:H7 and as indicated from FIG. 3D illustrates CTX-M-1 based probe shows positivity in drug resistant strain of E.coli NCIM-2571. This data is further illustrated in a tabular form as given in Table 2 below.
Table 2: 16S RNA probes in different E.coli strains i.e. DH-5a (wild strain) , MTCC-4296, rfb probe in O-157-H7 and CTX-M probe in ESBL producing E.coli strain NCIM-2571

16s RNA in E. Coli (Dh-5a strain) 16s RNA in E.coli UTI strain MTCC-4296 Rfb probe in E. coli O-157-H7 strain CTX-M1 probe in drug resistant E.coli NCIM-2571
Voltage
(V) Current
(µA) Voltage
(V) Current
(µA) Voltage
(V) Current
(µA) Voltage
(V) Current
(µA)
0.19 -13 0.19 -19.9 0.18 -21.24 0.15 -21
0.21 -17 0.21 -21.7 0.17 -20.04 0.17 -23

FIG. 4A illustrates cyclic voltammetry data that show oxidation reduction cycles depicting pattern of positivity of 16s RNA probes in term of reduction current in culture of UTI strain and blood and urine. This data is further provided in Table 3 that depicts the Voltage range and highest reduction current of 16s RNA probes in, culture of UTI strain and blood and urine.
Table 3: 16S RNA probes in UTI Culture, Blood and Urine
Culture Blood Urine
Voltage
(V) Current
(µA) Voltage
(V) Current
(µA) Voltage
(V) Current
(µA)
0.19 -19.9 0.20 -19.9 0.17 -14.2
0.21 -21.7 0.21 -16.12 0.19 -17.23

FIG. 4B illustrates cyclic voltammetry data that show oxidation reduction cycles of an infection biosensor having specificity of infection probes corresponding to rfb gene and 16sRNA. It was observed in FIG. 4B that the cyclic voltammetry pattern shows positivity in term of highest reduction current in UTI strain of E.coli whereas CTX -M-1 probe gives negative result in form of blank line.
Thus, in summary, two independent E-coli sensors were developed.
i. E. coli Infection sensor
(A) E.coli (UTI) sensor: UTI sensor targets 16s-RNA gene and gave positive result in biological sample, which predicts UTI infection in acute leukemia as well as patients with other diseases (as shown in FIGs. 3A, 3B, 4A and 4B)
(B) E.coli (haemorrhagic diarrhoea) sensor: E-coli sensor can targets rfb gene to detect bloody diarrhoea, which can predict presence of O157 antigen in biological sample and thus can predict the haemorrhagic diarrhoea in acute leukemia patients as well as patients with other diseases (as shown in FIG. 3C).
Hence developing infection sensor could be a helpful tool for physician, as the sensor indicating positive for 16s RNA results would suggest UTI infection whereas rfb gene positivity in biological sample would enable prediction of haemorrhagic diarrhoea in acute leukemia as well as other diseases. In general, the sensor of the present infection can enable detection of species-specific infection caused by E. coli.
Example 3 - E. coli Drug resistant Sensor:
Extended Spectrum ß-Lactamases (ESBLs) can hydrolyse monobactams (such as aztreonam), most third-generation cephalosporins (such as cefotaxime, ceftriaxone, and ceftazidime) and, in some cases, even fourth-generation cephalosporins (such as cefepime and cefpirome), hence emerged as the most prominent ESBLs worldwide.
A drug resistant sensor of ESBL (extended-spectrum ß-lactamase) producing E. coli was developed using (Cephalosporinase)- CTX-M1 gene specific probe, which target several class of antibiotics. ESBL producing E. coli drug resistant strain NCIM-2571 strain was purchased from NCL ( National chemical Laboratory) Pune, India and it was grown in incubator overnight at 37° C in presence of antibiotics i.e. Cefotaxime 10µg/ml, Rifampicin 50µg/ml, Ciprofloxacin 1µg/ml, Trimethoprim 0.5 µg/ml, ceftazidime and aztreonam as per standard guideline. There is horizontal transfer of blaCTX-M genes, mediated by plasmids and/or mobile elements, contributes to the dissemination of CTX-M enzymes to our community and hospital environments. ESBL production was confirmed using cefotaxime (CTX), ceftazidime (CAZ), and cefepime (FEP) alone and in combination with clavulanic acid (CLA) as per clinical and laboratory standards institute (CLSI) guidelines. The experimental results as obtained by cyclic voltammetry is as provided in FIG. 5 and in Table 4 below.
Table 4: CTX-M1 gene specific probes results in ESBL producing E.coli drug resistant strain NCIM-2571 strain culture
Voltage (V) Current(µA)
0.16 -23
0.17 -26
0.18 -20
0.16 -28
0.15 -28
Blank 0.18 0.002

ESBL is an enzyme having an ability to hydrolyse the ß-lactam ring of broad-spectrum ß-lactams such as oxyimino-cephalosporins including cefotaxime, ceftriaxone, and ceftazidime (third generation cephalosporins). ESBL species contain transferrable plasmid containing antimicrobial resistance gene. CTX-M1-gene is also plasmid mediating antimicrobial resistance gene. As indicated in the table 4 and FIG. 5, positive results for CTX-M gene for ESBL producing E. coli in blood or urine sample of patients enables to check the drug resistance in acute leukemia patients having for several class of antibiotics i.e. Cefotaxime, Rifampicin, Ciprofloxacin, Trimethoprim. In short, the multi-drug resistant (MDR) bacteria can be easily detected with CTX-M1 gene specific sensor-based test and hence a physician, who uses the sensor/system of the present disclosure can immediately start treatment within a short duration such as 2 hours after receiving the sample without waiting for duration of 3-5 days, as usually required in conventional testing techniques like PCR and culture.
Specificity of sensor to E-coli:
The specificity of the sensor/probe to E. Coli was also evaluated as provided in Table 5, which shows the specificity of 16 RNA probe positivity various in E. coli strain. As observed in Table 2, except E-coli, other bacterial species such as Klebsiella Pneumonia and Pseudomonas Aeruginosa and drug resistant E.coli display no prominent peaks at the specific voltages, whereas E. coli strain showed positivity in terms of highest reduction current. This indicates the precision and selectively/specificity of the E. Coli.
Table 5: Specificity analysis
Klebsiella Pneumonia Pseudomonas Aeruginosa E. Coli DH-a E.coli-(MTCC-4296, Serotype 06:K2:H1) E. Coli -O-157 Gastric infection) CTX-M probe in ESBL producing E.coli strain NCIM-2571
V µA V µA V µA V µA V µA V µA
0.13 -3 0.21 -0.003 0.18 -23 -0.17 -24 0.18 -21.24 0.22 0.08
0.13 -7 0.2 -0.001 0.17 -20 0.19 -20 0.17 -20.04 0.01 0.02

[00060] While the foregoing describes various embodiments of the invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof. The scope of the invention is determined by the claims that follow. The invention is not limited to the described embodiments, versions or examples, which are included to enable a person having ordinary skill in the art to make and use the invention when combined with information and knowledge available to the person having ordinary skill in the art.

ADVANTAGES OF THE PRESENT DISCLOSURE
[00061] The present disclosure provides a detecting system comprising a DNA biosensor for identifying E. coli infection as well as antibiotic resistance in patients with acute leukaemia.
[00062] The present disclosure provides a detecting system capable of simultaneously detecting infection as well as antibiotic resistance in a given sample in shorter duration, for example less than 2 hours, which, cannot be achieved by existing modality such as culture, microscopy, PCR, MALDI, sequencings NGS. The DNA biosensor system in accordance with the present disclosure is rapid, economical, sensitive and specific to target nucleic acid of a specific gene, robust, portable and capable of being used as a point of care device.

CLAIMS:1. A DNA biosensor based system for identifying a strain of Escherichia coli (E. coli) in a sample for detection of an infection and antimicrobial resistance caused by the strain of E. coli in a patient with acute leukaemia, said system comprising:
a set of hybridization probes comprising at least one capture probe and at least one detector probe,
wherein the capture probe comprises a first oligonucleotide sequence that is a single-stranded oligonucleotide tagged with biotin and the detector probe comprises a second oligonucleotide sequence that is a single-stranded oligonucleotide tagged with fluorescein; and
wherein each of the first oligonucleotide sequence and the second oligonucleotide sequence are single-stranded oligonucleotides that may complimentary to each strand of a pair of strands in a target nucleic acid sequence of a gene corresponding to the strain of E. coli,
wherein each of the first oligonucleotide sequence and the second oligonucleotide sequence are capable of independently hybridizing with each strand of said pair of strands of target nucleic acid sequence obtained after cell lysis of E. coli,
wherein if said target nucleic acid sequence corresponding to the strain of E. coli is present in the sample, the independent hybridization occurs that forms a three-dimensional complex between said target nucleic acid and the set of hybridization probes, and
2. The system as claimed in claim 1, wherein the formation of the three-dimensional complex is detected by one or more working electrodes by the oxidation-reduction process that enables generation of an electrical signal for identifying the strain of E. coli in the sample in the detection of the infection and antimicrobial resistance caused by the strain of E. coli in the patient with acute leukaemia,
wherein said one or more working electrodes are carbon-based working electrodes that are screen printed on a paper, wherein said working electrodes are capable of undergoing an oxidation-reduction process and are functionalized by coating with at least one protein compound selected from streptavidin and avidin, wherein the electrical signal is measured with a potentiometer or a potentiostat arrangement.
3. The system as claimed in claim 1, wherein said system is used for identifying antibiotic resistant strain selected from wild strain, pathogenic strain and an extended spectrum beta-lactamase (ESBL) producing strains of E.coli.
4. The system as claimed in claim 1, wherein the set of hybridization probes are capable probes capable of individually hybridizing to 16S rRNA of pathogenic E. coli strain MTCC 4296 (UTI strain) wherein said probes are used to identify UTI infection and discriminate from the pathogenic and drug-resistant E. coli strains.
5. The system as claimed in claim 1, wherein the set of hybridization probes are capable individually hybridizing to a target nucleic acid sequence of rfb-E gene of E. coli O157:H7 strain and identifying the pathogenic E. coli strain to detect the infection.
6. The system as claimed in claim 1, wherein the set of hybridization probes are capable of individually hybridizing to any of the target nucleic acid sequence of the gene selected from CTX-M, in extended spectrum beta-lactamase (ESBL) producing E. coli resistant to antibiotics selected from cephalosporins belonging to one to four classes, fluoroquinolones, and monobactam in detection of multi-drug resistance.
7. The system as claimed in claim 1, wherein said target nucleic acid sequence corresponds to a DNA or a plasmid, wherein the first oligonucleotide sequence and the second oligonucleotide sequence can have a sequence selected from CTGCGGGTAACGTCAATGAGCAAA corresponding to 16s RNA, CTATTACTACAGGTGAAGGTGGAAT corresponding to rfb gene, and GGCATTGATTAACACAGCAGATAA corresponding to CTX-M gene.
8. The system as claimed in claim 1, wherein said first oligonucleotide sequence is a single-stranded oligonucleotide tagged with biotin at 5-’ end of the oligonucleotide, and wherein said second oligonucleotide sequence is a single-stranded oligonucleotide tagged with fluorescein at 3’- end of the oligonucleotide.
9. The system as claimed in claim 1, wherein said capture probe is localized on said one or more working electrodes by conjugation interaction between said protein functionalized to working electrode, wherein the detection of the sample for identifying the strain of E. coli is done in a time duration in the range of 1 minute to 120 minutes, and wherein the sample is a biological fluid selected from blood, urine and other biological fluids of a body, and wherein the detection of the formation of the three-dimensional complex is done by using one or more reagents selected from any or a combination of anti-fluorescein monoclonal Fab fragment, horseradish peroxidase, a buffer and detection reagents.
10. A kit for identifying a strain of Escherichia coli (E. coli) in a sample in DNA-based detection of an infection and antimicrobial resistance caused by the strain of E. coli in a patient with acute leukaemia, said kit comprising:
any or a combination of one or more carbon-based working electrodes screen printed on a paper, a panel of hybridization probes and one or more reagents,
wherein said panel of hybridization probes comprising capture probes and detector probes complementary to and capable of hybridizing to a target nucleic acid sequences of a gene for identification of the infection caused by any of a wild strain, pathogenic strain and ESBL producing strains of E.coli, and
wherein said one or more reagents are selected from any or a combination of streptavidin, biotin, Anti-Fluorescein-POD, Fab fragments from sheep, a buffer (PBS-Phosphate buffer saline) and detection reagents including 3,3´, 5,5´-tetramethylbenzidine (TMB) stabilized substrate for horseradish peroxidase.