Abstract: The present disclosure relates to an architecture of energy redistribution that can sustain the increased formation of cofactors like NADH/NADPH and key metabolites like pyruvate that are implicated in the production of isobutanol through biotransformation.
1. A genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE, kivD, ilvG, pox B, udhA, did and mgsA or any combination thereof.
2. The genetically modified micro-organism as claimed in claim 1, wherein the micro¬organism is Escherichia coli strain BL21 or BL21 (DE3) or an Escherichia coli wherein ilvG gene is inactive.
3. The genetically modified micro-organism as claimed in claims 1 and 2, wherein Escherichia coli strain BL21 or BL21 (DE3) comprises activated ilvG gene for inhibiting valine induced feedback inhibition of ALS gene.
4. The genetically modified micro-organism as claimed in claim 1, wherein expression of the gene is altered to facilitate redistribution of energy for optimizing biochemical pathway for production of isobutanol.
5. The genetically modified micro-organism as claimed in claim 4, wherein the expression of the gene is altered by method selected from a group comprising knock out, overexpression and engineering of the gene or any combination of method thereof.
6. The genetically modified micro-organism as claimed in claims 4 and 5, wherein the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA, adhE, pox B, udhA, did and mgsA or any combination thereof; wherein the expression of the gene is altered by overexpressing als gene; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No.l.
7. The genetically modified micro-organism as claimed in claim 6, wherein the kivD gene is isolated from bacterium Lactococcus lactis and codon-optimized for Escherichia coli to obtain said sequence.
8. A process for obtaining a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE, kivD, ilvG, pox B, udhA, did and mgsA or any combination thereof, said process comprising altering expression of the genes by: a) knocking out a gene selected from a group comprising ackA, ldhA, adhE, pox B, udhA, did and mgsA or any combination thereof; or b) overexpressing als gene; or c) engineering of the codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1; or any combination of alterations thereof.
9. The process as claimed in claim 8, wherein the micro-organism is Escherichia coli strain BL21 or BL21 (DE3) or an Escherichia coli wherein ilvG gene is inactive.
10. The process as claimed in claim 8, wherein expression of the gene is altered to facilitate redistribution of energy for optimizing the biochemical pathway for production of isobutanol.
11. The process as claimed in claim 8, wherein the knocking out of the gene is carried out by method comprising acts of: a) growing phage on donor strain for packaging of genome fragment with antibiotic marker to obtain phage lysate; b) infecting recipient strain with the phage lysate to integrate the genome fragment by homologous recombination; and c) identifying the recipient strain through the antibiotic marker to confirm knocking out of gene to obtain single knock out.
12. The process as claimed in claim 8, wherein the knocking out of more than one of the genes is carried out by method comprising acts of: a) obtaining single knock out as claimed in claim 11; b) transforming the single knock out with plasmid expressing flippase employed in FLP-FRT system; c) excising gene flanked by the flippase to obtain a knock out of two genes or a double knock out; optionally d) conducting the step b) with the double knock out of step c) to obtain a knock out of three genes or a triple knock out.
13. A method for inducing redistribution of energy within a micro-organism, said method comprising act of altering expression of genes corresponding to biomolecules involved in biochemical pathway responsible for distribution of energy to induce the redistribution of energy.
14. The method as claimed in claim 13, wherein the method comprises acts of: a) identifying biochemical pathway responsible for distribution of energy within a microorganism; b) identifying biomolecule participating in said distribution of energy and the corresponding gene involved in the pathway of step a); c) altering expression of said genes to modulate the participation of said biomolecules for inducing said redistribution of energy.
15. The method as claimed as claim 13, wherein the micro-organism is Escherichia coli strain BL21 or an Escherichia coli wherein ilvG gene is inactive.
16. The method as claimed in claim 13, wherein the identification of the biochemical pathway and said biomolecules is carried out by conventional methods; and wherein the biomolecule is selected from a group comprising NADH, NAD, NADPH, NADP, ATP, ADP, GTP, GDP, FADH, FAD, Pyruvate, Ubiquinone and Acetyl CoA or any combination thereof.
17. The method as claimed in claim 13, wherein the gene involved in the biochemical pathway responsible for distribution of energy with the microorganism is selected from a group comprising ackA, ldhA, adhE, kivD, ilvG, pox B, udhA, did and mgsA or any combination thereof.
18. The method as claimed in claim 17, wherein the expression of the gene is altered by method selected from a group comprising knock out, overexpression and engineering of the gene or any combination of method thereof.
19. The method as claimed in claim 18, wherein the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA, adhE, pox B, udhA, did and mgsA or any combination thereof; wherein the expression of the gene is altered by overexpressing als gene; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1.
20. The method as claimed in 13, wherein said redistribution of energy results in sustainable biomass levels for production of isobutanol.
21. A method for producing isobutanol from a genetically modified micro-organism, said method comprising act of obtaining a genetically modified micro-organism comprising altered genes corresponding to biomolecules involved in biochemical pathway responsible for distribution of energy to induce the redistribution of energy for production of said isobutanol.
22. The method as claimed as claim 21, wherein the micro-organism is Escherichia Coli strain BL21 or BL21 (DE3) or an Escherichia coli wherein ilvG gene is inactive.
23. The method as claimed in claim 21, wherein the genetically modified micro-organism comprise altered genes, selected from a group comprising ackA, ldhA, adhE, kivD, ilvG, pox B, udhA, did and mgsA or any combination thereof.
24. The method as claimed in claim 21, wherein the redistribution of energy within the microorganism is induced by method as claimed in claim 13.
25. The method as claimed in claim 21, wherein the method enhances the production of the isobutanol when compared to the production of the isobutanol by wild type microorganism without said redistribution of energy.
TECHNICAL FIELD
The present disclosure relates to an architecture of energy redistribution that can sustain the increased formation of cofactors like NADH/NADPH and key metabolites like pyruvate that are implicated in the production of isobutanol through biotransformation.
BACKGROUND AND PRIOR ART OF THE DISCLOSURE
Butanol or butyl alcohol is a primary alcohol with a 4 carbon structure and the molecular formula of C4H9OH. There are four isomeric structures for butanol. The straight chain isomer with the alcohol functional group at the terminal carbon is also known as w-butanol or 1-butanol. The straight chain isomer with the alcohol at an internal carbon is sec-butanol or 2-butanol. The branched isomer with the alcohol at a terminal carbon is isobutanol, and the branched isomer with the alcohol at the internal carbon is tert-butanol; 2-methyl-2-propanol.
n-Butanol and isobutanol have limited solubility, while the other two isomers are fully miscible with water and hence less suitable as next-gen biofuel.
The generation of biofuel through biotransformation is an emerging field that is certain to play a pre-eminent role in the coming years. With the rapidly depleting global fossil fuel reservoirs it is seen that whole cell biocatalysis is proving to be the best bet at manufacturing alternative biofuel like ethanol. However it is now accepted that isobutanol is a better choice as the replacement/addon biofuel in comparison to ethanol. It has a higher energy content than ethanol, enabling better fuel economy.
Also, Isobutanol requires no infrastructure modifications for transport and use because, unlike ethanol, isobutanol is not hygroscopic and is not corrosive to motor engines. It should also be noted that Isobutanol can be blended with gasoline at higher ratios (16%) as compared to ethanol (10%), increasing both the green footprint of the blend and the market.
There is an extensive history in the production of butanol through microbial fermentation.
ABE fermentation method- as the name suggests is a method used for the production of Acetone, Butanol (n-butanol) and Ethanol. The source used during this fermentation procedure is starch and this fermentation takes place under anaerobic conditions.
In 1861, Pasteur produced Butanol by biological means for the first time. In 1905, Schardinger produced Acetone in a similar manner. In 1911, Fernbach's used starch for the production of n-butanol.
Industrial exploitation of ABE fermentation started in 1916 with Charles Weizmann's isolation of Clostridium acetobutylicum. These solvents are produced in a ratio of 3-6-1, or 3 parts Acetone, 6 parts Butanol and 1 part Ethanol. The bacterium Clostridium acetobutylicum and Clostridium beijerinkii were used to produce these fuels in a moderate industrial scale. ABE fermentation however, lost out due to profitability factor when compared to the production of these solvents from petroleum. As such there are no currently operating ABE plants. During the 1950s and 1960s, ABE fermentation was replaced by petroleum chemical plants. Due to different cost structures, ABE Fermentation was viable in South Africa until the early 1980s, with the last plant closing in 1983. Butanol due to its high energy density came to the fuel map about three decades ago. However, there was a choice to subsidize either Ethanol or Butanol and due to the production efficiency the choice was Ethanol.
The key hurdles for n-butanol production were:
1. Use of Clostridium acetobutylicum for Butanol production.
• Clostridium acetobutylicum is a slow growing bacteria.
• It is not easy to genetically manipulate and improve the strain.
2. Use of ABE fermentation process:-Production of Acetone, Butanol and Ethanol in the ratio 6:3:1.ABE fermentation process yield only 1.3 gallon Butanol/bushel of corn, where as yeast fermentatiqn produces 2.5 gallon of Ethanol/bushel of corn.
3. Butanol is toxic to Clostridium acetobutylicum at the threshold level of 1-2%, thus hindering higher yield.
4. Poor distillation process:-Boiling point of n-butanol is around 118°C which is even higher than that of water. Thus its distillation is energy inefficient.
In the post genomic era, the use of systems biology and heterologous gene expression has ushered a revival in "biobutanol". Atsumi et.al (2008), Nature, 451, 86 - 90; showed that just integration of the Elrich pathway into the branched chain amino acid pathway of E.coli was sufficient to generate isobutanol in E.coli under non-fermentative conditions. In a subsequent publication it was shown that only the addition of the heterologous gene KIVD (ketoisovalerate decarboxylase) from L.lactis was required as the conversion of ISOBUTYRALDEHYDE to ISOBUTANOL could be efficiently carried by the yqhD, one of the six native alcohol dehydrogenase present in E.coli [Atsumi et.al (2010), Appl Microbial. Biotech 85, 651 - 657].
The major drawback of the publication by Atsumi et al is that to generate isobutanol, in addition to several knock outs, the entire valine synthesis pathway that includes three genes are overexpressed. However, it is well known that as more number of genes are altered, the bacterium becomes unstable. Therefore, the aim of the instant disclosure is to address such limitations in the art by providing a self-sustaining balanced system.
STATEMENT OF THE DISCLOSURE:
Accordingly, the present disclosure relates to a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE, kivD, als, pox B, udhA, did and mgsA or any combination thereof; a process for obtaining a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE, kivD, als, pox B, udhA, did and mgsA or any combination thereof, said process comprising altering expression of the genes by a) knocking out a gene selected from a group comprising ackA, ldhA, adhE, pox B, udhA, did and mgsA or any combination thereof or b) overexpressing als gene or c) engineering of the codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1 or any combination of alterations thereof; a method for inducing redistribution of energy within a micro-organism, said method comprising act of altering expression of genes corresponding to biomolecules involved in biochemical pathway responsible for distribution of energy to induce the redistribution of energy; and a method for producing isobutanol from a genetically modified micro-organism, said method comprising act of obtaining a genetically modified micro-organism comprising altered genes corresponding to biomolecules involved in biochemical pathway responsible for distribution of energy to induce the redistribution of energy for production of said isobutanol.
BRIEF DESCRIPTION OF THE ACCOMPANYING FIGURES
In order that the disclosure may be readily understood and put into practical effect, reference will now be made to exemplary embodiments as illustrated with reference to the accompanying drawings. The figures together with a detailed description below, are incorporated in and form part of the specification, and serve to further illustrate the embodiments and explain various principles and advantages, in accordance with the present disclosure where:
W: wild type E.coli (with ALS gene feedback inhibited),
Ml: ackA gene deleted in E.coli
M2: IdhA gene deleted in E.coli
M3: adhE gene deleted in E.coli
M4: E.coli with ALS gene without feedback inhibition.
In this disclosure, E.coli indicates E.coli K-12 where ilvG gene is inactive, and M4- the E.coli gene where ilvG gene (that confers ALS to function without feedback inhibition) is active is represented by E.coli BL21
Figure 1A: shows the principal metabolic structure of E.coli and the pathway blocks that are involved in this disclosure.
Figure IB: shows the details of the pathways that convert pyruvate to a-ketoisovalerate and thereon to the three important products -viz - pantothenate , L-Valine and L-Leucine , all of which play important role in microorganism growth and cell maintenance.
Figure 2A: shows Isobutanol flux related to the growth for different levels of sustained Isobutanol production. The inherent limitation of the als gene in Ecoli-K12 is that it is inhibited by L-Valine. Thus as an example as the cell is under growth in the computational model related to growth with L-Valine inhibition of the als gene the maximum sustainable level predicted by the model is a flux level of about 0.18658 mole units/sec and this mark off sets the limit of isobutanol production by the wild type K-12 with a kivD engineered for conversion to isobutanol. This step is limited to 0.046 mole units/sec in this example computation from the model. It is to be noted that these numbers are not absolute but related and normalizable from a laboratory perspective when this prediction is calibrated against lab measurements of isobutanol production. The wild type curve (blue curve) in FIG-2A clearly shows zero isobutanol production as more isobutanol is attempted to be routed through the pathway. This follows from the prediction that as the biomass build up is compromised by isobutanol production which starts to shunt pyruvate, a level would be reached that the minimal energy needs of the cell for growth and maintenance are not met and thus the cell dies and so isobutanol goes down to zero. An ackA knockout improves the availability of pyruvate and thus growth is still sustained at an isobutanol pull on pyruvate to the extent of 0.25 mole/mole conversion on glucose in this example of the computational model. This reduction in growth with increasing levels of isobutanol synthesis is in FIG-2B.
Figure 2B: shows the decrease in cell growth as isobutanol pull is increased in the computational model. The ackA knocked out strain improves growth for the same isobutanol production.
Figure 2C: The graphical plots in this figure illustrate from the computational model the predicted dynamic shifts in the Pyruvate to L-Valine, Pyruvate to L-Leucine, and Pyruvate to Pantonoate, along with Pyruvate to Isobutanol pathways as shown in FIG- IB. These four pathways divide at the a-ketoisovalerate stage. Increase in Isobutanol production tends to decrease the three other pathways, momentarily releasing the inhibition on als. This feedback inhibition limits to the amount of Acelolactate that can be formed from pyruvate. The computational model enables one to compute this acetolactate synthesis threshold which cannot be overcome as long as the als L-Valine inhibition is in force. Thus any synthesis of acetolactate over and above this threshold of 0.18658, in this example, computations would need engineering of a suitable als gene that would allow more acetolactate synthesis concomitant with increase in pyruvate availability and the required electron carrier NADPH.
Figure 2D: This figure illustrates the computational results if ackA is deleted ensuring that the intermediary production of Acetyl-CoA is not funnelled into Acetate production (Refer FIG-1A to the central positioning of Acetyl-CoA in the pathway structure forming the forking point to Acetate synthesis and possible feed into the TCA cycle which has the pathways to generate electron carriers - NADH and NADPH). In turn this availability of Acetyl-CoA is shuttled into the TCA cycle and ensures that the metabolic machinery increase the availability of pyruvate as illustrated in FIG-2D. The increased TCA cycle metabolization increases availability of the electron carrier NADPH that is necessary to feed into the pyruvate to keto-isovalerate section and a further need in the conversion of Isobutyraldehyde to isobutanol in FIG-1.
Figure 2E: shows the dynamics of Oxygen usage during growth and oxygen steadily goes down as growth gets reduced with increase attempt to synthesize Isobutanol.
Figure 3A: shows the plasmid pUC57
Figure 3B: shows multiple cloning site on the plasmid pUC57
Figure 4: shows the plasmid pUCKl
Figure 5: shows verification study for double knock out using colony PCR with ackA and adhE primers. Lane 1 and 2- ackA without Kan cassette (about 755 bps) with ackA primers, Lanes 5 and 7- adhE with Kan cassette with adhE primers (1900 bps), Lane 12- NEB 1 kb ladder (sizes in base pairs indicated).
Figure 6: shows verification study for triple knock out using colony PCR with ldhA primers. Lanes 1,2,4- ldhA with the Kan cassette amplified with ldhA primers (2.023 bps), lane 3-Gene ruler 1 kb marker (sizes are given next to the gel picture).
DETAILED DESCRIPTION OF THE DISCLOSURE
The present disclosure relates to a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA [SEQ ID No. 4], ldhA [SEQ ID No. 7], adhE [SEQ ID No. 6], kivD [SEQ ID No. 1], ilvG, pox B [SEQ ID No. 5], udhA [SEQ ID No. 10], did [SEQ ID No. 8] and mgsA [SEQ ID No. 9] or any combination thereof.
In an embodiment of the present disclosure, the micro-organism is Escherichia coli strain BL21 or BL21 (DE3) or an Escherichia coli wherein ilvG gene is inactive.
In another embodiment of the present disclosure, Escherichia coli strain BL21 or BL21 (DE3) comprises activated ilvG gene for overcoming valine induced feedback inhibition of ALS gene.
In yet another embodiment of the present disclosure, expression of the gene is altered to facilitate redistribution of energy for optimizing biochemical pathway for production of isobutanol.
In still another embodiment of the present disclosure, the expression of the gene is altered by method selected from a group comprising knock out, overexpression and engineering of the gene or any combination of method thereof.
In still another embodiment of the present disclosure, the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA, adhE, pox B, udhA, did and mgsA or any combination thereof; wherein the expression of the gene is altered by overexpressing als gene; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1.
In still another embodiment of the present disclosure, the kivD gene is isolated from bacterium Lactococcus lactis and codon-optimized for Escherichia coli to obtain said sequence.
The present disclosure, also relates to a process for obtaining a genetically modified micro¬organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE, kivD, als, pox B, udhA, did and mgsA or any combination thereof, said process comprising altering expression of the genes by:
a) knocking out a gene selected from a group comprising ackA, ldhA, adhE, pox B, udhA, did and mgsA or any combination thereof; or
b) overexpressing als gene; or
c) engineering of the codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1; or any combination of alterations thereof.
In an embodiment of the present disclosure, the micro-organism is Escherichia coli strain BL21 or BL21 (DE3) or an Escherichia coli wherein ilvG gene is inactive.
In another embodiment of the present disclosure, expression of the gene is altered to facilitate redistribution of energy for optimizing the biochemical pathway for production of isobutanol.
In yet another embodiment of the present disclosure, the knocking out of the gene is carried out by method comprising acts of:
a) growing phage on donor strain for packaging of genome fragment with antibiotic marker to obtain phage lysate;
b) infecting recipient strain with the phage lysate to integrate the genome fragment by homologous recombination; and
c) identifying the recipient strain through the antibiotic marker to confirm knocking out of gene to obtain single knock out.
In still another embodiment of the present disclosure, the knocking out of more than one of the genes is carried out by method comprising acts of:
a) obtaining single knock out as above;
b) transforming the single knock out with plasmid expressing flippase employed in FLP-FRT system;
c) excising gene flanked by the flippase to obtain a knock out of two genes or a double knock out; optionally
d) conducting the step b) with the double knock out of step c) to obtain a knock out of three genes or a triple knock out.
The present disclosure also relates to a method for inducing redistribution of energy within a micro-organism, said method comprising act of altering expression of genes corresponding to biomolecules involved in biochemical pathway responsible for distribution of energy to induce the redistribution of energy.
In an embodiment of the present disclosure, the method comprises acts of:
a) identifying biochemical pathway responsible for distribution of energy within a microorganism;
b) identifying biomolecule participating in said distribution of energy and the corresponding gene involved in the pathway of step a);
c) altering expression of said genes to modulate the participation of said biomolecules for inducing said redistribution of energy.
In another embodiment of the present disclosure, the micro-organism is Escherichia coli strain BL21.
In yet another embodiment of the present disclosure, the identification of the biochemical pathway and said biomolecules is carried out by conventional methods; and wherein the biomolecule is selected from a group comprising NADH, NAD, NADPH, NADP, ATP, ADP, GTP, GDP, FADH, FAD, Pyruvate, Ubiquinone and Acetyl CoA or any combination thereof.
In still another embodiment of the present disclosure, the gene involved in the biochemical pathway responsible for distribution of energy with the microorganism is selected from a group comprising ackA, ldhA, adhE, kivD, als, pox B, udhA, did and mgsA or any combination thereof.
In still another embodiment of the present disclosure, the expression of the gene is altered by method selected from a group comprising knock out, overexpression and engineering of the gene or any combination of method thereof.
In still another embodiment of the present disclosure, the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA, adhE, pox B, udhA, did and mgsA or any combination thereof; wherein the expression of the gene is altered by overexpressing als gene; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1.
In still another embodiment of the present disclosure, said redistribution of energy results in sustainable biomass levels for production of isobutanol.
The present disclosure further relates to a method for producing isobutanol from a genetically modified micro-organism, said method comprising act of obtaining a genetically modified micro-organism comprising altered genes corresponding to biomolecules involved in biochemical pathway responsible for distribution of energy to induce the redistribution of energy for production of said isobutanol.
In an embodiment of the present disclosure, the micro-organism is Escherichia Coli strain BL21 or BL21 (DE3) or an Escherichia coli wherein ilvG gene is inactive.
In another embodiment of the present disclosure, the genetically modified micro-organism comprise altered genes, selected from a group comprising ackA, ldhA, adhE, kivD, als, pox B, udhA, did and mgsA or any combination thereof.
In yet another embodiment of the present disclosure, the redistribution of energy within the microorganism is induced by method as above.
In still another embodiment of the present disclosure, the method enhances the production of the isobutanol when compared to the production of the isobutanol by wild type microorganism without said redistribution of energy.
In the present disclosure, FIG-1A shows the principal metabolic structure of E.coli and the pathway blocks that are involved in this disclosure. FIG-IB shows the details of the pathways that convert pyruvate to a-ketoisovalerate and thereon to the three important products -viz - pantothenate, L-Valine and L-Leucine, all of which play important role in microorganism growth and cell maintenance. The disclosures contained in this disclosure centers around the additional engineered pathway including the additional gene kivD to enable conversion of a-keto-isovalerate to Isobutanol.
In an embodiment of the present disclosure, it is evident from FIG IB that in addition to the enzyme levels, the concentration of metabolites, pyruvate and cofactors NADH/NADPH are central to the yield of isobutanol. However, these metabolites and cofactors are vital for the survival of any microorganism, and its depletion in the cell causes a reduction in the energy levels with concomitant reduction in growth rate and hence will in turn affect the product yield. Thus, a sustainable flow of energy is what is required for synthesis of chemicals through biotransformation.
The requirement for constant supply of energy is a common factor for any application of microorganisms for a synthetic process. A redistribution of energy is required within the cell to ensure a sustainable supply of intermediates for synthesis of the desired product. The ensuing cellular processes, as do most others, utilize energy molecules ATP, NADH and NADPH. This load of extra energy usage causes the growth rate of the cell to fall drastically thus jeopardizing the entire aim of synthesizing these molecules economically. The solution of this problem is in the generation of a self sustaining balanced system. This is done through an in-silico simulation of a computational model of the microbial cell and from the results of the simulation which estimate what engineering re-construction of the strain is needed (gene deletions and over-expressions in specific sections of the microbial pathways in the cell) so that possible strains that have the simultaneous capability of growth and yield of the product viz. isobutanol is identified and subsequently constructed.
Any heterologous expression, where a foreign molecule (protein or metabolite) is produced in a microorganism like E.coli, where the energy supply is tightly regulated, requires a redistribution of the internal metabolites for optimal production of the foreign molecule. In a cell, high energy is generally associated with Acetyl Coenzyme A, ATP, NADH and NADPH. In the present embodiment for every molecule of isobutanol produced through the Elrich pathway two molecules of NADPH is utilized (Figl). Elrich pathway describes the catabolism of branched chain amino acids (leucine, valine, isoleucine); aromatic amino acids (tryptophan, tyrosine, phenylalanine) and sulphur containing amino acids (methionine). The catabolism leads to the production of fusel acids and fusel alcohols.
To maximize the isobutanol, one needs to optimize the production pathways with the competing energy intensive pathways such that the yield is maximized. This optimization is done through the in-silico platform prediction where a computational model of the microorganism is used to predict the pathway(s) to be modified in order to get maximum yield of the foreign molecule from a given carbon source as the feed and concurrently maintain sufficient growth of the microorganism colony so that the modified pathways are able to sustain the energy requirements of the foreign molecule. Such an optimized strain
structure is then constructed and the constructed strain(s) are used in the laboratory to perform the in-vitro studies.
The major drawbacks of some prior arts existing in the field of isobutanol generation are employing several knock outs, in addition to overexpressing the entire valine synthesis pathway that includes several genes. However, it is well known that as more number of genes are altered the bacterium becomes unstable. In order to overcome these drawbacks the present disclosure employs E.coli which is fast growing, can be genetically manipulated with ease and is targeted towards production of iso-butanol which in contrast to n-butanol can be easily evaporated. However, the toxicity of iso-butanol to E.coli is still a stumbling block for producing it beyond the toxic limit which is 0.5 to 1%.
In an embodiment of the present disclosure, the aforementioned limitations are further addressed, whereby different E.coli strains (of the E.coli B genre) are taken up which have the feedback independent ilvG gene inserted in the wild type E.coli K12. This is in contrast to the E.coli K12 (wild type), where the ilvG gene is deleted. Thus, the necessity of overexpressing the entire pathway is bypassed and the number of gene alterations are significantly reduced in the instant disclosure.
The present disclosure also relates to generating an in-silico E-coli model or platform.
In an embodiment of the present disclosure, predictive power of the in-silico platform in E.coli is experimentally validated.
In another embodiment of the present disclosure, the in-silico model is demonstrated with an ackA knockout, overexpression or replacement of als gene, knock out of other related genes such as poxB adhE, ldhA, did, mgsA and udhA.
The present disclosure also relates to synthesizing a codon optimized kivD gene sequence and cloning the said sequence into plasmid puc57, to obtain a cloned plasmid named pucKl.
The present disclosure also relates to generating an in-vitro E.coli model.
In an embodiment of the present disclosure, the in-vitro model comprising E.coli single knock outs are generated by way of PI transduction system using PI lysate and FLP-FRT system.
In another embodiment of the present disclosure, double and triple knock outs are also generated using the PI transduction protocol.
In yet another embodiment of the present disclosure, E.coli comprising the gene knock outs and genes overexpressed are grown in a suitable medium, followed by kivD gene expression which is induced when the cell O.D reaches 0.4 to 0.8, preferably 0.6. Further, the cells so produced are checked for iso-butanol production.
Further, it is important to note that the present disclosure utilizes biological material which is available in the prior art and in public domain, and which has been suitably modified to arrive at the instant disclosure. Although the E. coli BL21 strain has not been sequenced till date, a closely related variant, E.coli BL21(DE3) has been. The two strains are represented as follows:
• BL21
E. coli B F- dcm ompT hsdS(rB- mB-) gal [malB+]K-12(XS)
• BL21(DE3)
E. coli B F- ompT gal dcm Ion hsdSB(rB- mB-) A.(DE3 [lad lacUV5-T7 gene 1 indl sam7 nin5])
It is thus clear that E. coli BL21 (DE3) is an E. coli B strain with DE3, i.e., a X prophage carrying the T7 RNA polymerase gene and laclq. In the said E. coli BL21 (DE3), transformed plasmids containing T7 promoter driven expression are repressed until IPTG induction of T7 RNA polymerase from a lac promoter.
Thus, basically the T7 RNA polymerase has been inserted into E.coli BL21 to construct the strain BL21 (DE3). The T7 RNA polymerase gene sequence is provided as SEQ ID No.l.
However, since the aspects of the present disclosure do not require a T7 promoter driven expression, or an IPTG inducible system, the T7 RNA polymerase gene sequence is not required by the genetically modified E. coli obtained in the present disclosure. However, even when such T7 RNA polymerase gene sequence is not required for the aspects of the instant disclosure, it is also noted that the presence of such T7 RNA polymerase gene sequence will not adversely affect the aspects of the instant disclosure in any manner.
Thus, the genetically modified organism obtained in the present disclosure is a genetically modified E. coli BL21. In other words, for the purposes of sequence identity, the said genetically modified organism is BL21 (DE3) minus the T7 RNA polymerase gene sequence is provided as SEQ ID No. 1.
However, having said the above, it is understood to a person skilled in the art that all the aspects of the present disclosure will be applicable to both E. coli BL21, as well as E. coli BL21 (DE3) strains.
Further, it is also important to note that the knocking out of genes within the purview of the instant disclosure requires deletion of the entire gene sequence, from start codon to the respective stop codon, and re-joining the remaining sequence in order to obtain a knocked-out sequence. Hence, since the native form of the microorganism strain is known [as mentioned above], and since the sequences of the genes to be knocked out is also provided, a person skilled in the art will have no problem in carrying out the procedure of the instant disclosure and to arrive at the final genetically modified organism of the instant disclosure.
Similarly, the overexpression and engineering of the genes within the purview of this disclosure requires overexpression and/or inserting specific genes within a native form of the microorganism strain. Such specific genes are provided in the instant disclosure and hence, a person skilled in the art will have no problem in carrying out the procedure of the instant disclosure and to arrive at the final genetically modified organism of the instant disclosure.
A more complete understanding can be obtained by reference to the following specific examples, which are provided for purposes of illustration only and are not intended to limit the scope of the disclosure.
EXAMPLES
Example 1;
E.coli in-silico Platform-
The present disclosure is at the cusp of in-silico simulating whole cell functioning and its response to internal and external perturbations at the molecular and kinetic detail. Such an in-silico model is a computational model of the E.coli. With the genome of a number of organisms sequenced and nearly entire metabolic pathway constructed in chemical detail, what remains is the dovetailing of the kinetic to the static pathway platform. The first simulation of the bacterium E.coli computational model is successfully demonstrated with the platform of the present disclosure. In this platform the control of the enzymatic and pathway functioning is simulated by interconnecting the behaviour of each enzyme in the pathway translating as an ability to sustain a rate of reaction flow with the necessary regulation parameters that provide the cross-talk between these enzymes as feedback and feed forward mechanisms, controlling growth from a given carbon source. This computational mathematical framework, built by using intercellular enzyme concentration and other control parameters responds in a similar fashion to perturbations the way the natural system in question would. This type of modelling has the ability to solve systems comprising of unlimited number (in thousands) of simultaneous control pathways interconnected in a complex way and able to maintain stoichiometry and provide a test platform for a given carbon source of a given mole quantity. The predictive power of this platform in E.coli is experimentally validated. Enzymes in a number of pathways including TCA, Glycolytic, Glyoxylate bypass, Branched chain amino acid synthesis, CoA biosynthesis, Nucleotide Biosynthesis and Nicotinamide Biosynthesis pathway are evaluated. Enzymes in pathways that are either vulnerable or relatively immune to inhibition of a specific type are delineated and experimentally corroborated. The disclosure herein show an example set of computations in usage of this computational model for isobutanol production from Glucose and the carbon source and the predicted changes that need to be done in re-engineering this organism to enable higher isobutanol yields and limits of mole to mole conversion of glucose to isobutanol.
In-Silico results-
Collated as in FIG 2A, 2B, 2C, 2D and 2E. The computational model predicts that to get E.coli to synthesize reasonable quantity of Isobutanol a dual strategy needs to be undertaken:
1. Make gene deletion individually or two at a time with the aim of increasing pyruvate availability. The model in this embodiment is demonstrated for an ackA knockout.
2. With a possible overexpression / replacement of the ah gene to sustain the increased pyruvate flow with a concomitant increase in NADPH availability. The model in this embodiment employs an E.coli BL21 strain which possesses the intact ilvG gene (responsible for the feedback independent ALS).
3. In another embodiment the computational model makes it possible to knock out other related genes like poxB and udhA with the aim to increasing pyruvate and NADPH availability.
4. In another embodiment of the computational model, this list of possible knockouts of additional genes like adhE, IdhA, did and tngsA are predicted to yield better conversion of glucose to isobutanol within the possible limits computed and illustrated in FIG-2A,2B,2C and 2D
Example 2:
Heterologous expression of KIVD from L.lactis:
In the present disclosure the KIVD (keto isovalerate decarboxylase) is codon optimized from L.lactis. It is known that there is a bias for usage of the degenerate codon among each organism. The codon for the highly expressed genes are different from the moderate and low/lesser expressed genes. The concentration of tRNA in the cell is directly proportional to the codon usage (Ikemura, T. (1981) J. Mol. Biol. 146,1-21; Dong, H., Nilsson, L. and Kurland,C.G. (1996) J. Mol. Biol. 260,649-663; Kane, J.F. (1995) Curr.Opin. Biotechnol. 6, 494-500.) Thus, keeping the amino acid of the gene unchanged, modification of the codon is carried out to suit the maximal expression of the gene. In order to have the gene under a strong promoter, the gene is cloned downstream of the pTrc Promoter without the lac operator sequence.
The sequence of the synthetic gene construct is given below.
CODON OPTIMISED kivD: [SEQ ID NO: 1] THE GENE STARTS FROM THE SECOND LINE
GAATTCGAGCTGTTTACGaTTAATCATCCGGCTCGrAIHATCTGTGGTCACACAGGAAACAGACC ATGTATACCGTGGGCGACTATCTGCTGGACCGTCTGCATGAACTGGGCATTGAAGAAATCTTTGGCGTG 1"7
The -10 and -35 promoter sequence is in bold and italic. The start codon ATG and stop codon TAA is in bold.
In an embodiment of the present disclosure, the entire sequence is cloned in the plasmid pUC57.The clone is named pUCKl.
In another embodiment of the present disclosure, the plasmid pUC57 is 2710 bp in length and is a derivative of pUC19. pUC57 MCS (multiple cloning site) contains 6 restriction sites with protruding 3'-ends, which are resistant to E.coli exonuclease III. This vector is designed for cloning and generating ExoIII deletions. The exact position of genetic elements is shown on the map- Figure 3 (termination codons included). DNA replication initiates at position 890 (+/- 1) and proceeds in indicated direction. The bla gene nucleotides 2510-2442 (compl. strand) code for a single peptide.
pUC 57 Sequence (wild type):
[SEQ ID NO: 2]
tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccggga gcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactg agagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgc aactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgg gtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattcgagctcggtacctcgcgaatgcatctagatatcgg atcccgggcccgtcgactgcagaggcctgcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcac aattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgct cactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgg gcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatac ggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccg cgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacag gactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcct ttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtg cacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccact ggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggcta cactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaac caccgctggtagcggtggtttrtttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacg gggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaatta aaaatgaagtittaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgat ctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgca atgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtc ctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttg ccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatc ccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatg
Synthesized kivD in puc57 (cloned vector with gene of interest kivD- pucKl) - 4428 bp; [SEP ID NO: 31
The promoter sequence (-10) TATAAT and -35 (TTACGA), the start codon (ATG) for KIVD and its stop codon (TAA) are marked in bold.
Example 3:
Kcoll in-vitro model:
Protocol for PI transduction-
To move portions of E.coli genome from one variant to another, PI transduction offers a simple methodology. In brief, phage is first grown on a donor strain during which host genome fragments of about 100kb along with selectable antibiotic markers when present are packaged in them resulting as a phage lysate. This lysate is used to infect recipient strains that would incorporate into their chromosomes foreign bacterial DNA by means of homologous recombination. The selection markers aid the tracking of transduced fragments of DNA. (Thomason,L.C.,Costantino.N,and Court D.L (2001) E.coli Genome Manipulation by PI Transduction, in Current Protocols in Molecular Biology,John Wiley & Sonsjnc.)
Methodology for making the PI lvsate-About 5ml culture of donor strain is grown at about 37°C in LB (Luria Broth), with about 0.2% glucose, about 5mM CaC12 is thereafter added to make the culture barely turbid. Thereafter, about 10 microlitres PI vir (phage titre of 109-1010) is added and continued to incubate at about 37°C with good aeration until lysis occurs. Further, the debris are centrifuged out and lysate is filtered using about 0.45 uM filter and stored at about 4°C.
Carrying out the PI Transduction-
Recipient strain is grown overnight. About 5ml culture is centrifuged at about 2000-3000 x g and resuspended in about 2.5ml of PI solution (10mM CaC12 + 5mM MgS04). Thereafter, about 100 microlitres of these cells is mixed in PI with about 1, 10, and 100 microlitres of phage lysate in different tubes and a control is included without phage lysate. This mixture is further incubated for about 20 minutes at about 37°C. To the obtained mixture, about 200 microlitres of 1M Na-citrate and about 1ml LB is added and incubated for about 1 hour at about 37°C. Thereafter, the cells are centrifuged, resuspend in about 100 microlitres LB and plated on selective plates containing 5mM Na-Citrate. Thereafter, single colonies are streaked out on fresh selective plates with 5mM Na-Citrate. Transduction with the new gene fragment if confirmed by PCR.
Aim behind generating multiple knockouts:
Multiple knockouts are generated to reduce competition for common substrates, lessen unnecessary by-product formation, for the successful regeneration of essential cofactors and most importantly to drive the metabolic flux towards our desired product formation.
In the present disclosure, the prime focus is on generating a knockout of 3 genes in BL21 strain namely ackA (which prevents formation of acetyl phosphate and acetate from pyruvate), adhE (codes for alcohol dehydrogenase which would act on acetyl CoA and prevents further action on acetaldehyde. This in-turn increases the production of ethanol. By knocking out adhE, ethanol levels are reduced), and ldhA (which would prevent glycolytic flux from pyruvate towards lactate).
In an embodiment of the present disclosure, additional knockouts of other related genes such as poxB and udhA with the aim to increasing pyruvate and NADPH availability and knockout of genes such as did and mgsA with the aim to yield better conversion of glucose to isobutanol within the possible limits computed and illustrated in FIG-2A, 2B, 2C and 2D are also carried out with the procedure as aforementioned.
Eliminating Antibiotic resistance gene:
The single gene knockout strains that are part of the Keio collection (Baba et al 2006. paper and Datsenko & Wanner , 2000) are obtained from E.coli Genetic Resources at Yale CGSC. To make double gene knockouts, it is essential to remove the Kanamycin marker cassette. A simple strategy involving the use of FLP-FRT system is engineered into the knockouts of the Keio collection.
pCP20, a temperature sensitive plasmid that expresses a flippase is transformed into a knockout and incubated overnight at 30°C with ampicillin (30ug/ml).When colonies from this are grown under permissible temperatures, the flippase recognizes the FRT sites that flank the kanamycin cassette and excises it out, leaving a marker less knockout. The plasmid is eliminated by selecting the knockouts on antibiotic free conditions at 43°C.
Methodology for obtaining triple knockout-
ackA knockout is first generated as aforementioned. Thereafter, pCP20 DNA is transformed into BL21 ackA knockout and plated overnight in the presence of ampicillin at about 30°C. The following day a few colonies are grown in different snap-cap tubes in the presence of antibiotic ampicillin at about 30°C till they reach an OD of about 0.6. The colonies are then transferred to about 37°C for about 2 hours. These colonies are then diluted into fresh LB and left at about 43 °C without ampicillin for about 4 hours. The colonies so diluted are replica plated on LB, Kan30 (30ug/ml) and AmplOO (lOOug/ml) plates. If the colonies grow only on LB plates, then it means we are able to successfully flip out Kan cassette and can proceed for second knockout after verifying with colony PCR.
Following the above mentioned PI transduction protocol an adhE donor and ackA recipient without Kan cassette is used to generate a double knockout. This is verified with colony PCR with ackA and adhE primers (figure 5). Again as before Kan cassette from adhE is flipped out and ldhA is brought in to make it a BL21 ackA, adhE, ldhA triple knockout. Again verification is done by colony PCR with ldhA primers (figure 6).
Example 4: Experimental Results;
Various E.coli strains of the K12 and BL21 genre are transformed with the plasmid pucKl. Some of these strains have deletions in the genes such as ackA, adhE and ldhA. These strains are grown in standard minimal M9 media (details in Table 1 below). The expression of the KIVD gene is induced when the cell O.D. reaches about 0.6. The inducer IPTG is added at a concentration of about 0.1 mM. The induction is terminated at about 24 hours and the isobutanol produced is measured by using head space gas chromatograph (Agilent) and /or by HPLC using Aminex column.
Gas Chromatography Protocol-Bio-fuel analysis workflow:
Sample into HS
Headspace (Thermostat, pressure, injecf)GC analysis using Elite column
FID detection
Data analysis
Report generation
Experimental conditions-
Each sample (lmL) is transferred into head space sample vial and the GC-FID runs are
performed using the following conditions.
GC conditions-
Column used: ELITE5 (0.25mm X 30m)
Gradient conditions: (Total run time: 10 min) at 50 degree Celsius held for 4 min and 140
degree Celsius at 30 degree per minute.
Carrier gas: Helium at flow rate of lml/min
Inlet temperature: 125 degrees
FID conditions-
Detector temperature: 280degree
Gases used:
Zero air- 450ml/min
Hydrogen- 45ml/min.
Experiments and data analvsis-
RT and area under the curve for standard alcohols at different known concentrations (ppm) are measured and standard curves are plotted. Thereafter RT of standard alcohols are compared with unknown sample. Then the area under each peak is measured for alcohols requested and the areas obtained from unknown samples are fitted with standard plots to calculate the concentration (ppm) of alcohols in the test samples
HPLC analysis of isobutanol-
The cell supernatants that are harvested after 24 hours are spun down at 14300 g to eliminate floating debris and cells and the supernatant is taken and diluted if necessary to inject into the column.
Conditions involved for the HPLC analvsis-
Aminex HPX-87H column, 300*7.8 mm, mobile phase 5mM H2S04, combined column temperature 55°C, RID detector at 50°C.
The areas obtained from unknown samples are fitted with standard plots to calculate the concentration (ppm) of alcohols in test samples. Side metabolites like acetate, lactate, formate, pyruvate, succinate and glucose are also eluted at various retention times in the Aminex column and are quantitated against standard graphs.
The constituents of the media and the isobutanol yields are mentioned below in Table 1 and Table 2 respectively.
Minimal media (M9 composition)
1 litre of M9 minimal media (Complete) contains:
From the Table 2 above, it can be deciphered that the wild type E.coli BL21 (M4 strain) has low activity of ackA, and therefore its deletion has no effect in the overall iso-butanol production as this gene is downregulated. While in E.coli kl2 (wild (W) strain) the ackA level are high, its deletion is not enough to divert the flux towards isobutanol production and hence there is no increase in iso-butanol production, when ackA is knocked out. The activities of adhE and ldhA genes are high in the M4 strain and therefore their deletion along with the presence of ilvG gene gives significant increase levels of isoB production.
W: wild type E.coli (with ALS gene feedback inhibited),
M1: ackA gene deleted in E. coli
M2: ldhA gene deleted in E.coli
M3: adhE gene deleted in E.coli
M4: E.coli with ALS gene without feedback inhibition.
We claim:
1. A genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE, kivD, ilvG, pox B, udhA, did and mgsA or any combination thereof.
2. The genetically modified micro-organism as claimed in claim 1, wherein the micro¬organism is Escherichia coli strain BL21 or BL21 (DE3) or an Escherichia coli wherein ilvG gene is inactive.
3. The genetically modified micro-organism as claimed in claims 1 and 2, wherein Escherichia coli strain BL21 or BL21 (DE3) comprises activated ilvG gene for inhibiting valine induced feedback inhibition of ALS gene.
4. The genetically modified micro-organism as claimed in claim 1, wherein expression of the gene is altered to facilitate redistribution of energy for optimizing biochemical pathway for production of isobutanol.
5. The genetically modified micro-organism as claimed in claim 4, wherein the expression of the gene is altered by method selected from a group comprising knock out, overexpression and engineering of the gene or any combination of method thereof.
6. The genetically modified micro-organism as claimed in claims 4 and 5, wherein the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA, adhE, pox B, udhA, did and mgsA or any combination thereof; wherein the expression of the gene is altered by overexpressing als gene; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No.l.
7. The genetically modified micro-organism as claimed in claim 6, wherein the kivD gene is isolated from bacterium Lactococcus lactis and codon-optimized for Escherichia coli to obtain said sequence.
8. A process for obtaining a genetically modified micro-organism comprising altered genes, selected from a group comprising ackA, ldhA, adhE, kivD, ilvG, pox B, udhA, did and mgsA or any combination thereof, said process comprising altering expression of the genes by:
a) knocking out a gene selected from a group comprising ackA, ldhA, adhE, pox B, udhA, did and mgsA or any combination thereof; or
b) overexpressing als gene; or
c) engineering of the codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1; or any combination of alterations thereof.
9. The process as claimed in claim 8, wherein the micro-organism is Escherichia coli strain BL21 or BL21 (DE3) or an Escherichia coli wherein ilvG gene is inactive.
10. The process as claimed in claim 8, wherein expression of the gene is altered to facilitate redistribution of energy for optimizing the biochemical pathway for production of isobutanol.
11. The process as claimed in claim 8, wherein the knocking out of the gene is carried out by method comprising acts of:
a) growing phage on donor strain for packaging of genome fragment with antibiotic marker to obtain phage lysate;
b) infecting recipient strain with the phage lysate to integrate the genome fragment by homologous recombination; and
c) identifying the recipient strain through the antibiotic marker to confirm knocking out of gene to obtain single knock out.
12. The process as claimed in claim 8, wherein the knocking out of more than one of the genes is carried out by method comprising acts of:
a) obtaining single knock out as claimed in claim 11;
b) transforming the single knock out with plasmid expressing flippase employed in FLP-FRT system;
c) excising gene flanked by the flippase to obtain a knock out of two genes or a double knock out; optionally
d) conducting the step b) with the double knock out of step c) to obtain a knock
out of three genes or a triple knock out.
13. A method for inducing redistribution of energy within a micro-organism, said method comprising act of altering expression of genes corresponding to biomolecules involved in biochemical pathway responsible for distribution of energy to induce the redistribution of energy.
14. The method as claimed in claim 13, wherein the method comprises acts of:
a) identifying biochemical pathway responsible for distribution of energy within a microorganism;
b) identifying biomolecule participating in said distribution of energy and the corresponding gene involved in the pathway of step a);
c) altering expression of said genes to modulate the participation of said biomolecules for inducing said redistribution of energy.
15. The method as claimed as claim 13, wherein the micro-organism is Escherichia coli strain BL21 or an Escherichia coli wherein ilvG gene is inactive.
16. The method as claimed in claim 13, wherein the identification of the biochemical pathway and said biomolecules is carried out by conventional methods; and wherein the biomolecule is selected from a group comprising NADH, NAD, NADPH, NADP, ATP, ADP, GTP, GDP, FADH, FAD, Pyruvate, Ubiquinone and Acetyl CoA or any combination thereof.
17. The method as claimed in claim 13, wherein the gene involved in the biochemical pathway responsible for distribution of energy with the microorganism is selected from a group comprising ackA, ldhA, adhE, kivD, ilvG, pox B, udhA, did and mgsA or any combination thereof.
18. The method as claimed in claim 17, wherein the expression of the gene is altered by method selected from a group comprising knock out, overexpression and engineering of the gene or any combination of method thereof.
19. The method as claimed in claim 18, wherein the expression of the gene is altered by knocking out of the gene selected from a group comprising ackA, ldhA, adhE, pox B, udhA, did and mgsA or any combination thereof; wherein the expression of the gene is altered by overexpressing als gene; and wherein the expression of the gene is altered by engineering of codon optimized ketoisovalerate decarboxylase (KIVD) sequence set forth as SEQ ID No. 1.
20. The method as claimed in 13, wherein said redistribution of energy results in sustainable biomass levels for production of isobutanol.
21. A method for producing isobutanol from a genetically modified micro-organism, said method comprising act of obtaining a genetically modified micro-organism comprising altered genes corresponding to biomolecules involved in biochemical pathway responsible for distribution of energy to induce the redistribution of energy for production of said isobutanol.
22. The method as claimed as claim 21, wherein the micro-organism is Escherichia Coli strain BL21 or BL21 (DE3) or an Escherichia coli wherein ilvG gene is inactive.
23. The method as claimed in claim 21, wherein the genetically modified micro-organism comprise altered genes, selected from a group comprising ackA, ldhA, adhE, kivD, ilvG, pox B, udhA, did and mgsA or any combination thereof.
24. The method as claimed in claim 21, wherein the redistribution of energy within the microorganism is induced by method as claimed in claim 13.
25. The method as claimed in claim 21, wherein the method enhances the production of the isobutanol when compared to the production of the isobutanol by wild type microorganism without said redistribution of energy.
| # | Name | Date |
|---|---|---|
| 1 | 2068-CHE-2012 FORM-13 25-05-2012.pdf | 2012-05-25 |
| 2 | Form-5.pdf | 2012-06-01 |
| 3 | Form-3.pdf | 2012-06-01 |
| 4 | Form-1.pdf | 2012-06-01 |
| 5 | Drawings.pdf | 2012-06-01 |
| 6 | 2068-CHE-2012 CORRESPONDENCE OTHERS 31-07-2012.pdf | 2012-07-31 |
| 7 | 2068-CHE-2012 POWER OF ATTORNEY 31-07-2012.pdf | 2012-07-31 |
| 8 | 2068-CHE-2012 FORM-1 31-07-2012.pdf | 2012-07-31 |
| 9 | 2068-CHE-2012 SEQUENCE LISTING 23-05-2013.pdf | 2013-05-23 |
| 10 | 2068-CHE-2012 FORM-9 23-05-2013.pdf | 2013-05-23 |
| 11 | 2068-CHE-2012 FORM-5 23-05-2013.pdf | 2013-05-23 |
| 12 | 2068-CHE-2012 FORM-3 23-05-2013.pdf | 2013-05-23 |
| 13 | 2068-CHE-2012 FORM-2 23-05-2013.pdf | 2013-05-23 |
| 14 | 2068-CHE-2012 FORM-18 23-05-2013.pdf | 2013-05-23 |
| 15 | 2068-CHE-2012 FORM-1 23-05-2013.pdf | 2013-05-23 |
| 16 | 2068-CHE-2012 DRAWINGS 23-05-2013.pdf | 2013-05-23 |
| 17 | 2068-CHE-2012 DESCRIPTION (COMPLETE) 23-05-2013.pdf | 2013-05-23 |
| 18 | 2068-CHE-2012 CORRESPONDENCE OTHERS 23-05-2013.pdf | 2013-05-23 |
| 19 | 2068-CHE-2012 CLAIMS 23-05-2013.pdf | 2013-05-23 |
| 20 | 2068-CHE-2012 ABSTRACT 23-05-2013.pdf | 2013-05-23 |
| 21 | 2068-CHE-2012 FORM-3 30-05-2013.pdf | 2013-05-30 |
| 22 | 2068-CHE-2012 CORRESPONDENE OTHERS 30-05-2013.pdf | 2013-05-30 |
| 23 | 2068-CHE-2012-FER.pdf | 2017-12-27 |
| 24 | 2068-CHE-2012-AbandonedLetter.pdf | 2018-07-11 |
| 1 | SEARCHREPORT2068_13-12-2017.pdf |