Abstract: ABSTRACT Title: A KIT AND METHOD FOR SIMULTANEOUS EXTRACTION OF DNA, RNA AND PROTEIN FROM ONE PLANT SAMPLE A kit for simultaneous extraction of nucleic acids and proteins from a single leaf sample of woody plants comprises extraction buffer, phenol; isopropanaol, Precipitation buffer for protein and a plant sample. The said kit extracts the biomolecules with an improved yield over those of the existing processes /kits rapidly in three hours and is thus is cost-effective. It was also demonstrated that the isolated DNA, RNA and protein are successfully used for genomics and proteomic analysis in tea plant which was verified by performing marker study, gene cloning, cDNA preparation, gene expression study and 2-DE. The said process yields high molecular weight DNA (>40 Kb) and good quality total RNA as indicated by ?260/?280 and ?260/?230 ratios.
Claims:We Claim:
1.A kit for simultaneous extraction of DNA, RNA and protein from one plant sample comprising :
(i) extraction buffer for DNA, RNA and protein comprising 150-250 mM, preferably 200mM Tris HCL, 20-30 g/L , preferably 25g/L SDS, 30-50mM preferably 40mM EDTA, 20-30% preferably 20% glycerol , the solution kept at 4oC;
(ii) phenol;
(iii) isopropanaol;
(iv) Precipitation buffer for protein comprising 0.08 to 0.15M preferably 0.1M ammonium acetate in cold methanol, storing the solution at -20oC .
2. A kit as claimed in claim 1 wherein said one plant sample source comprises tea leaf sample.
3. A process for simultaneous extraction of nucleic acids (DNA, RNA) and proteins from single plant source comprising:
(i) generating an aqueous phase and organic phase of plant source including step of grinding the plant source in liquid Nitrogen, extraction buffer comprising: 150-250 mM, preferably 200mM Tris HCL, 20-30 g/L , preferably 25g/L SDS, 30-50mM preferably 40mM EDTA, 20-30% preferably 20% , the solution kept at 4oC;and phenol to thereby generate separately (i) an aqueous phase (supernatant) for DNA and RNA extraction and (ii) an organic phase for protein extraction; and
(ii) to extract separately pellets of DNA and RNA providing two separate portions of said aqueous phase and adding to each of the thus separated aqueous phase isopropanol to obtain selectively and separately pellets of DNA and RNA therefrom; and to generate pellets of Protein mixing to said separated organic phase a precipitation buffer comprising of 0.08 to 0.15M preferably 0.1M ammonium acetate in cold methanol stored at -20oC and obtaining thereby the said desired pellets of protein.
4. A process as claimed in claim 3 wherein said step of generating an aqueous phase and organic phase of plant source comprises :
i) grinding 0.5 to 2.0gm preferably 1gm tea leaf tissue in liquid nitrogen and mixing with 1 to 3 ml preferably 2.5 ml extraction buffer and 1 to 3 ml preferably 2.5 ml tris buffered phenol (pH 7.9);
ii) incubating for 15-30 mins preferably 10 mins on ice;
iii) centrifuging at 4000-10000 rpm preferably 5500 rpm for 5-30 mins preferably 10 min at 40 C;
iv) separating the aqueous phase (supernatant) from the lower the organic phase;
v) isolating DNA and RNA separately from two parts of the said aq. phase and proteins from the said organic phase.
5. A process as claimed in anyone of claims 3 or 4 wherein said step of extracting separately pellets of DNA from said aqueous phase comprises :
(i) adding equal volumes of Isopropanol to said aqueous phase , centrifuging at 10,000-14,000 preferably 12000 rpm for , for 10-30min preferably 20mins RT;
(ii) wash pellet with ethanol;
(iii) drying pellets & dissolving in nuclease free water;
(iv) subjecting to RNase treatment at 370C, for 30 min - 2 h preferably 1hr;
(v)adding double volume of absolute alcohol + 1/20 volume 5M NaCl & incubating at -200C for 10min centrifuging at 10,000-14,000 rpm preferably 10000 rpm at 40C, for 5-30 mins preferably for 10 min;
(vi) washing pellet with ethanol; and
(vii) drying pellet & dissolve in nuclease free water.
6. A process as claimed in anyone of claims 3 or 4 wherein said step of extracting separately pellets of RNA from said aqueous phase comprises:
(i) adding equal volume of Isopropanol & 0.1 volume of Sodium acetate (pH 5.2) to said aqueous phase under 10,000-14,000 rpm preferably 14000 rpm at 40C for 5-30 min preferably 10 mins at RT;
(ii) washing pellet with ethanol;
(iii) drying the pellet & dissolving in RNase free water.
7. A process as claimed in anyone of claims 3 or 4 wherein said step of extracting the protein from said organic phase comprises:
(i) adding to said organic phase 3 volume Precipitation buffer and incubating for 1-5h preferably for 3 hrs;
(ii) pelleting down at 5000-10000 rpm preferably 5500rpm under 5500rpm, for 5-30 mins preferably 10min, at 40C;
(iii) washing pellet with precipitation solution;
(iv) drying pellet & dissolving in rehydration buffer.
8. An extraction buffer for DNA, RNA and protein extraction from plant sources including tea comprising:(150-250) mM preferably 200mM Tris HCL, (20-30) g/LSDS preferably 25g/L SDS, 30-50 mM preferably 40mM EDTA, 20-30% preferably 20% the solution kept at 4oC.
9. Precipitation buffer for protein extraction from plant sources including tea comprising of 0.08 to 0.15 M preferably 0.1M ammonium acetate in cold methanol , storing the solution at -20oC.
Dated this the 1st January,2018 Anjan Sen
Of Anjan Sen & Associates
(Applicants Agent)
, Description:FIELD OF THE INVENTION:
The present invention is directed to a kit and method for simultaneous extraction of nucleic acids and proteins from leaf tissue. More specifically the present invention provides the kit and process for isolation of DNA, RNA and proteins from a single leaf tea sample. The isolated DNA,RNA and proteins are used successfully for genomics and proteomic analysis in tea plant . Advantageously the said process is rapid, energy saving ,cost effective and thus finds application in the study of molecular markers, gene expression study, and protein profiling at a given time and state of given tissue sample..
BACKGROUND OF THE INVENTION:
Tea [Camellia sinensis (L.) O. Kuntze] is one of the most important plantation crops in the world in general and India in particular. Beside its complex genetic makeup due to open cross pollination, large genome (4.0 Gigabases) (Tanaka et al. 2006, Journal of the Remote Sensing Society of Japan, 101:1-7) and absence of developed genetic tools, limited information are available on tea molecular biology in the era of “omics”. Even the tea genome is yet to be sequenced completely. The plant is reported to have lots of health benefits (Wierzejska 2014, Epidemiol (Review) 68 (3): 501–6, 595–9. PMID 25391016). Tea plant being under tremendous pressures FROM biotic and abiotic stress, many molecular mechanisms hidden inside need to be deciphered at the earliest. This necessitates the need for a molecular tool to study the genomics, transcriptomics and proteomics in order to update tea molecular biology involving the isolation of good quality DNA, RNA and protein . There are protocols available to isolate DNA and RNA from tea plant (Mondal et al., 2000; Journal of plantation crops, 28 (1): 30-34; Das et al., 2013 Indian Journal of Biotechnology, 12(1): 129-132). However the available methods are mostly for individual isolation of DNA, RNA, or proteins. Since their simultaneous isolations are often hindered by inadequate availability of samples there is requirement for separate techniques for their isolation . These processes are time taking . Hence is a requirement to extract DNA, RNA and protein simultaneously to study molecular markers, gene expression study, and protein profiling at a given time and state of given tissue sample.
A fast and a dependable method for simultaneous extraction of DNA, RNA and protein from a single sample is required especially for very limited sample source. Furthermore, in simultaneous extraction from the same sample for genomic, transcriptomic and proteomic analyses, statistical correlation study is more advantageous due to tissue homogeneity.There are a few reports about simultaneous extraction of DNA, RNA and protein from a single biological sample. Coombs et al. 1990 (Anal. Biochem, 188, 338–343) and Grzendowski et al. (2009 Proteomics, 9, 4985–4990) have successfully isolated DNA, RNA, and protein simultaneously from human tumor cells but the protocol require 2–3 days to complete. Dumas-Gaudot et al. 2004 (Proteomics, 4, 451–453) have established protocol for simultaneous of proteins and RNA from M. truncatula. Besides time consuming (1-2 days for completion), the method cannot be applied for DNA isolation. Coombs et al (1990) protocol requires maximum of 150,000g and more than 4 days of duration. Grzendowski et al (2009) protocol requires maximum of 32,000 rpm and 16 hours.
Trizol reagent is readily used to isolate DNA, RNA and protein. But the reagent is rarely used to isolate proteins for 2-DE analysis due to the interference of polysaccharides and secondary metabolites in plants. In plants, a few number of sample buffers have been prepared for 2-DE analysis of proteomes, but these buffers cannot be used for DNA and RNA isolation.
Extraction of DNA, RNA, and proteins individually is a time-taking and laborious process. Most of the perennial plant species like tea is recalcitrant to tissue culture and takes lot of time for growth in tissue culture media. Therefore, the researcher needs to perform molecular biology from a very limited in-vitro tissue samples.
Hence there is still a need for a simpler energy saving and rapid process to isolate DNA, RNA and proteins simultaneously and effectively, which can be used for proteomic, transcriptomic, and genomic studies in other tree plant species.
OBJECT OF THE INVENTION:
It is thus the basic object of the present advancement to provide for a kit for simultaneous extraction of nucleic acids and proteins from plant sample.
It is thus another object of the present invention to provide a kit for simultaneous isolation of DNA, RNA and proteins from a single leaf sample.
Yet another object of the present invention is provide a rapid, energy saving and cost effective process for simultaneous isolation of DNA, RNA and proteins from a limited supply of biological resource.
A further object of the present invention is to provide a kit for simultaneous extraction of biomolecules with improved yield of the biomolecules and maintaining the quality of the biomolecules.
A still further object of the present invention is to provide the isolated DNA, RNA and protein for successful use for genomics and proteomic analysis in tea plant.
SUMMARY OF THE INVENTION:
Thus according to the basic aspect of the present invention there is provided a kit for
A kit for simultaneous extraction of DNA, RNA and protein from one plant sample comprising :
(i) extraction buffer for DNA, RNA and protein comprising 150-250 mM, preferably 200mM Tris HCL, 20-30 g/L , preferably 25g/L SDS, 30-50mM preferably 40mM EDTA, 20-30% preferably 20% glycerol , the solution kept at 4oC;
(ii) phenol;
(iii) isopropanaol;
(iv) Precipitation buffer for protein comprising 0.08 to 0.15 M preferably 0.1M ammonium acetate in cold methanol, storing the solution at -20oC .
Another aspect of the present invention provides a kit wherein said one plant sample source comprises tea leaf sample.
Yet another aspect of present invention relates to a process for simultaneous extraction of nucleic acids (DNA, RNA) and proteins from single plant source comprising:
(i) generating an aqueous phase and organic phase of plant source including step of grinding the plant source in liquid Nitrogen, extraction buffer comprising: 150-250 mM, preferably 200mM Tris HCL, 20-30 g/L , preferably 25g/L SDS, 30-50mM preferably 40mM EDTA, 20-30% preferably 20% , the solution kept at 4oC;and phenol to thereby generate separately (i) an aqueous phase (supernatant) for DNA and RNA extraction and (ii) an organic phase for protein extraction; and
(ii) to extract separately pellets of DNA and RNA providing two separate portions of said aqueous phase and adding to each of the thus separated aqueous phase isopropanol to obtain selectively and separately pellets of DNA and RNA therefrom; and to generate pellets of Protein mixing to said separated organic phase a precipitation buffer comprising of 0.08 to 0.15M preferably 0.1M ammonium acetate in cold methanol stored at -20oC and obtaining thereby the said desired pellets of protein.
A further aspect of the present invention provides a process wherein said step of generating an aqueous phase and organic phase of plant source comprises :
i) grinding 0.5 to 2.0 gm preferably 1gm tea leaf tissue in liquid nitrogen and mixing with 2 to 3.5 ml preferably 2.5 ml extraction buffer and 2 to 3.5 ml preferably 2.5 ml tris buffered phenol (pH 7.9);
ii) incubating for 15-30 mins preferably 10 mins on ice;
iii) centrifuging at 4000-10000 rpm preferably 5500 rpm for 5-30 mins preferably 10 min at 40 C;
iv) separating the aqueous phase (supernatant) from the lower the organic phase;
v) isolating DNA and RNA separately from two parts of the said aq. phase and proteins from the said organic phase.
In another aspect, the present invention provides a process wherein said step of extracting separately pellets of DNA from said aqueous phase comprises :
(i) adding equal volumes of Isopropanol to said aqueous phase , centrifuging at 10,000-14,000 preferably 12000 rpm for , for 10-30min preferably 20mins RT;
(ii) wash pellet with ethanol;
(iii) drying pellets & dissolving in nuclease free water;
(iv) subjecting to RNase treatment at 370C, for 30 min - 2 h preferably 1hr;
(v) adding double volume of absolute alcohol + 1/20 volume 5M NaCl & incubating at -200C for 10min centrifuging at 10,000-14,000 rpm preferably 10000 rpm at 40C, for 5-30 mins preferably for 10 min;
(vi) washing pellet with ethanol; and
(vii) drying pellet & dissolve in nuclease free water.
Another aspect of the present invention relates to a process wherein said step of extracting separately pellets of RNA from said aqueous phase comprises:
(i) adding equal volume of Isopropanol & 0.1 volume of Sodium acetate (pH 5.2) to said aqueous phase under 10,000-14,000 rpm preferably 14000 rpm at 40C for 5-30 min preferably 10 mins at RT;
(ii) washing pellet with ethanol;
(iii) drying the pellet & dissolving in RNase free water.
In another aspect, the present invention provides a process wherein said step of extracting the protein from said organic phase comprises:
(i) adding to said organic phase 3 volume Precipitation buffer and incubating for 1-5h preferably for 3 hrs;
(ii) pelleting down at 5000-10000 rpm preferably 5500rpm under 5500rpm, for 5-30 mins preferably 10min, at 40C;
(iii) washing pellet with precipitation solution;
(iv) drying pellet & dissolving in rehydration buffer.
In a further aspect, present invention relates to an extraction buffer for DNA, RNA and protein extraction from plant sources including tea comprising 150-250 mM preferably 200mM Tris HCL, (20-30) g/LSDS preferably 25g/L SDS, 30-50 mM preferably 40mM EDTA, 20-30% preferably 20% glycerol. The the solution was kept at 4oC.
Yet another aspect of the present invention relates to a precipitation buffer for protein extraction from plant sources including tea comprising of 0.08 to 0.15 M preferably 0.1M ammonium acetate in cold methanol ,storing the solution at -20oC
DETAILED DESCRIPTION OF THE INVENTION:
The invention is thus basically targeted at the kit and process for simultaneous extraction of DNA, RNA and proteins from a single plant source essentially a leaf of woody plants selected from tea ( Genus Camellia; Family Theaceae) such as Assam type tea plant, China type tea plant and Assam-China hybrid tea plant).
The said kit provides a rapid and simple isolation of the biomolecules and is of tremendous help for performing molecular biology works in perennial, recalcitrant tissue culture plants and endangered plant species where the sample source is very limited.
The said kit and process of the present advancement yield high molecular weight DNA (>40 Kb) and good quality total RNA as indicated by ?260/?280 and ?260/?230 ratios (Sambrook et al., 1989; Molecular Cloning: A Laboratory Manual, 2nd ed, Nolan C (ed), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Henry, 1997 Practical Applications of Plant Molecular Biology, 1st ed, Chapman and Hall, London). The genomic DNAs isolated were intact and were not shared. The total RNA was not contaminated with genomic DNA and clearly showed the integrity of the extracted samples by the presence of intact 18S and 28S rRNA. The nucleic acids and protein yields were also good enough to start molecular biological experiments. The said kit adds on merits over other methods and kits tested in comparison in terms of yield and quality of biomolecules. Furthermore, it was also important to attain these objectives in the shortest possible time.
Hence the said kit is an efficient and improved kit than the existing /conventional processes developed by Coombs et al (1990) and Grzendowski et al (2009) in terms of total time taken and a lower centrifugation speed .
The extraction buffer used in the present advancement consists of 150-250 mM Tris HCl, preferably 200mM ,20-30 g/LSDS preferably 25g/L, 30-50 mM EDTA preferably , 4mM EDTA and 20-30% Glycerol preferable 20%. The solution is kept at 4 °C. Precipitation buffer was made of 0.1 M (0.08 to 0.15) ammonium acetate in cold methanol and stored at -20 °C.
The details of the invention, its objects and advantages are explained hereunder in greater detail in relation to the following non-limiting accompanying figures and examples:
Brief description of The Accompanying Figures:
Figure 1 illustrates by way of a flow diagram the steps isolation of DNA,RNA and Proteins from a single tea leaf .
Figure 2 is an illustration of Extraction of DNA. a) Genomic DNA isolated from tea leaf samples following different protocols: Lane 1: CTAB/NaCl Protocol; Lane 2: Present protocol; Lane 3: HiPura A Kit:M: uncut ?DNA( 100ng, approx 48Kb. b) Restriction digestion of tea genomic DNA with Eco RI and Hind III . Lane 1 Eco RI; Lane 2: Hind III: M1: 100 bp ladder; M2: 1 Kb ladder. c) PCR amplification of tea genomic DNA taking SSR primer . Lane 1: present method; Lane 2: CTAB/NaCl Method; M1,100 bp ladder.
Figure 3 illustrates Extraction of RNA and its analysis. a) Total RNA isolated from tea leaf samples following different protocols. Lane 1: RNaqueous kit; Lane 2:present protocol; Lane 3: Guidance HCl. b) M2: 100 bp ladder; c) PCR amplification of partial sequence of Camellia sinensis putative early light induced protein 2 gene taking 1 genomic DNA; 2 complimentary DNA;M1: 1Kb ladder: M2: Low range of DNA ruler.
Figure 4 illustrates extraction of proteins and its analysis. a) 10% SDS-PAGE analysis of protein isolated from tea leaf sample following twodifferent protocols. Lane 1: Present protocol; Lane 2: Phenol protocol. b) 2 DE gel of protein profile extracted by two different methods from tea leaf sample. The protein samples after its extraction were separated on a 4-7 linear pH gradient in the first dimension and second dimension run by resolving 10% SDS-PAGE. Gels were visualized by staining with Coomassie Brilliant Blue R-250 . AX: Present protocol; BY: Phenol protocol.
Biological material Used : Plant material: TV6 vegetative clone of tea was collected from New Botanical Area, Tocklai Tea Research Institute (Tea Research Association), Jorhat, Assam. Tender leaf samples consisting of two leaves and a bud were used for the experiments.
Example 1: Process for simultaneous isolation of DNA, RNA and proteins from a single leaf
Extraction buffer for DNA, RNA and protein: The extraction buffer consists of 200mM Tris HCL, 25g/L SDS, 40mM EDTA, 20% Glycerol. Kept at 4oC.
Precipitation buffer for protein: Precipitation buffer was made of 0.1M ammonium acetate in cold methanol stored the solution at -20oC.
The process of extraction is illustrated in the flow chart of Figure 1.
One gram of tea leaf tissue was grinded in liquid nitrogen and transferred into a tube containing 2.5 ml of extraction buffer and 2.5 ml of tris buffered phenol (pH 7.9), vortexed and incubated on ice for 10 min. Centrifuged at 5500 rpm at 4oC for 10min. The aqueous phase (supernatant) were collected in a fresh tube and processed further for DNA/RNA isolation while the lower organic phase was processed for protein extraction. The supernatant was divided into two for isolating DNA and RNA separately.
i) DNA extraction: Equal amount of isopropanol was added to the aqueous supernatant. The tube were inverted for several times and centrifuged at 12000 rpm for 20 min at RT. The supernatant was discarded and the pellet was washed with 70% ethanol followed by 100% ethanol. The pellet was air dried and dissolved in nuclease free water. Then the DNA was treated with 2µl of DNase free RNase (10 mg/ ml) and incubated for 1 hr at 37 oC. Double volume of chilled absolute alcohol and 1/20 volume of 5 M NaCl were added and incubated at -20oC for 10min then centrifuged at 10000 rpm at 4oC for 10 min., washed with double volume of chilled 70% ethanol and centrifuged at 10000 rpm at 4oC for 10 min. The pellet was air dried and dissolved in nuclease free water. The extracted DNA was resolved in agarose gel stained with ethidium bromide and quantified spectrophotometrically.
ii) RNA extraction: The aqueous supernatant was taken in a tube and was added equal volume of isopropanol & 0.1 volume of Na acetate (pH 5.2). The tube was inverted for several times and incubated for 10 min at RT, then centrifuged at 14000 rpm for 10 min at 4oC. The supernatant was discarded and the pellet was washed with 70% ethanol. The pellet was dried and dissolved in RNase free water.
iii) Protein extraction: The lower organic phase was transferred to a new tube for protein extraction. Three volume of precipitation buffer was added and mixed gently by inverting the tube. The tube was incubated for at least 3 hour at -20°C. Proteins were finally pellet down by centrifugation 5500 rpm for 10 min at 4°C. The pellet was washed twice with precipitation solution. Dried the pellet and dissolved in rehydration buffer (Bio-Rad). Isolated protein was estimated according to the Bradford method.
EXAMPLE 2: Assessment of DNA isolation protocol for genomic analysis
and analysis of extracted DNA tested for its downstream application with restriction digestion, PCR for molecular marker analysis
The DNA pellets were dissolved in molecular grade water for instantaneous downstream processing. But for prolong storage the pellets need to be dissolved in TE (10:1) buffer in order to check hydrolysis of the samples. After DNA extraction from tea leaf the DNA samples were taken for electrophoresis in 1% agarose gel stained with ethidium bromide. The present protocol yielded high molecular weight and good quality DNA. The genomic DNAs isolated were intact and were not shared during the extraction process as shown in Figure 2a. The extracted DNA was quantified using a spectrophotometer, and ?260/?280 and ?260/?230 ratios were calculated to check for their purity. The ?260/?280 ratio was greater than 1.8 and the ?260/?230 ratio was greater than 2.0, indicating the purity of the extracted DNA by the present advancement. DNA yield was found to be the highest (548 µg per gram of fresh plant material) compared to HiPurA kit (456 µg/g tissue) and CTAB/NaCl (432 µg/g tissue) as shown in Table 1, sufficient for most of the molecular techniques. Qualitatively and quantitatively the present extraction protocol was found to be the best compared to other two methods.
Table 1: Comparative analysis of DNA yield obtained from tea leaf samples after following different extraction protocols.
Protocol ?260/ ?280 ± SE ?260/ ?230 ± SE DNA concentration,
µg/µL ± SE DNA yield,
µg/g tissue ± SE
Present 1.94 ±0.05 2.07 ±0.08 0.274 ±0.03 548 ±23
HiPurA 1.82 ±0.05 2.65 ±0.06 0.228 ±0.015 456 ±21
CTAB/NaCl 1.83 ±0.03 2.33 ±0.03 0.216 ±0.02 432 ±28
Restriction analysis of genomic DNA: DNA was restricted by EcoR I and Hind III using 1.5 U/mg of DNA. The reaction mixture was incubated at 37°C overnight. Digested DNA was separated on 1 % agarose gel, stained with ethidium bromide, and observed under UV light. The DNA preparations were successfully used for restriction analysis with EcoRI and HindIII restriction endonucleases (Figure 2b) clearly showing that the DNA samples can be used for southern hybridization technique.
PCR Amplification with SSR primers: PCR amplification reaction was carried out in a 10 µl reaction mixture comprising of 1X PCR buffer, 1 unit of Taq DNA polymerase, 0.2mM dNTPs, 1.5mM MgCl2, 10µM primer and 20-50 ng of genomic DNA. Thermal cycling was performed in Eppendorf Veriti Thermal Cycler. PCR profile was initial denaturation for 5 mins at 94°C, followed by 35 cycles of 30 s at 94°C, 30s annealing temperature, 1 min at 72°C and a final extension of 7 mins at 72°C. PCR product was resolved by electrophoresis on 3 % agarose gel stained with ethidium bromide. Figure 2c also showed about successful PCR amplification with SSR primers making the genomic DNA isolated eligible for molecular marker studies. The extracted DNAs were also used as a template in PCR for partial amplification of genes for C. sinensis putative early light induced protein. Figure 2c showed the presence of desired single band size amplification representing that the extracted DNA can be used for gene cloning studies.
EXAMPLE 3: Assessment of RNA isolation protocol for gene expression and analysis of extracted RNA tested for its downstream application with reverse transcription
The total RNA extracted from tea leaf was initially examined by electrophoresis method. The total RNA was not contaminated with genomic DNA and clearly showed the integrity of the extracted samples by the presence of intact 18S and 28S rRNA (Figure 3a). Further quantitative and qualitative analysis of the RNA samples were performed in a spectrophotometer (BioPhotometer, Eppendorf) and the result is described in Table 2.
Table 2: Comparative analysis of RNA yield obtained from tea leaf samples after following different extraction protocols.
Protocol ?260/ ?280 ± SE ?260/ ?230 ± SE RNA concentration,
µg/µL ± SE RNA yield,
µg/g tissue ± SE
Present 1.91 ±0.08 2.84 ±0.07 0.122 ±.013 244 ±22
RNaqueous 2.01 ±0.03 2.18 ±0.07 0.187 ±0.017 374 ±25
Guanidine-HCl 1.89 ±0.05 2.67 ±0.08 0.110 ±0.011 220 ±23
Even though the total RNA yield was lower (244 µg/g fresh leaf tissue) than RNA aqueous kit (374 µg/g tissue) but was higher than conventional guanidine-HCl method (220 µg/g tissue). The present method has given the comparative best result in terms of quality as indicated by ?260/?280 and ?260/?230 ratios (Table 2).
Reverse transcription of RNA to complementary DNA: SMART cDNA Library Construction Kit (Clontech, Palo Alto, CA, USA) was used to synthesize cDNA following manufacturer’s instruction. Total RNA samples isolated were reverse transcribed to produce complementary DNAs (Figure 3b) and then were used as templates for gene cloning studies in PCR for partial amplification of C. sinensis putative early light induced protein gene.
Successful amplification of desired DNA part taking cDNA was noticed as single bands on agarose gel (Figure 3c) which confirms the applicability of the RNA preparation for downstream studies.
EXAMPLE 4: Downstream application of extracted DNA and RNA in gene cloning.
For gene cloning studies C. sinensis putative early light induced protein was considered. Partial sequence of gene fragments were amplified both from genomic DNA and cDNA by PCR in a 10µl reaction mixture containing 1X PCR buffer, 1.25 mM MgCl2, 0.5 mM dNTPs, 1 U Platinum Taq DNA polymerase, 0.5 µM of each gene specific primer (as described in Table 3) and 50-100 ng DNA or cDNA.
Table 3: Primers used for PCR of Camellia sinensis putative early light induced protein 2 gene (GQ461359.1).
Template Gene specific primers (5’ to 3’) Annealing temp.
(°C) Amplicon size (bp)
gDNA
F: TTGTTACCGTTGATCTCTGTCTT
R: TGACAAACTCAGTGAAAGCCAAT 55
1851
cDNA F: TAAGCACCAAATTCTCTGAC
R: TTTGAATAGAGGTACCAAAGA 48 212
The amplification condition started with an initial denaturation step at 94°C for 5 min, followed by 35 cycles of 94°C for 30 sec, optional annealing temperature (as described in Table 3) for 30 sec, and 72°C for 30 sec plus a ?nal extension at 72°C for 7 min. The PCR product was resolved on 1 % (w/v) agarose gel stained with ethidium bromide by electrophoresis.
EXAMPLE 5: Assessment of protein extraction protocol for proteomic analysis
The protein after extraction from tea leaf was estimated by Bradford method. Readings was taken in a spectrophotometer (BioPhotometer, Eppendorf). The present protein extraction protocol has given higher protein yield (1054 µg per gram of fresh leaf tissue) than the phenol method (898 µg per gram of fresh leaf tissue) as shown in Table 4.
Table 4: Comparative analysis of protein yield obtained from tea leaf samples after following two extraction protocols.
Protocol Protein concentration,
µg/µL ± SE Protein yield,
µg/g tissue ± SE
Present 0. 527±0.07 1054 ±43
Phenol 0.449 ±0.06 898 ±48
The protein profile in protein pool was checked by 10% SDS-PAGE before going to 2DE which showed good result by resolving the different polypeptide on a gel (Figure 4a).
The extracted protein was then taken to perform two dimensional gel electrophoresis ( 2-DE with the help of Ready Prep 2-D Starter Kit (Bio-Rad, USA) following manufacturer’s instruction.
First dimension - IEF: Isoelectric focusing (IEF) was done on Bio-Rad Ready Strip IPG strips, 7 cm, pH 4-7, which was rehydrated with 65 µg/125 µL protein for 16 hrs. The rehydration solution was poured into a well in the rehydration tray and the IPG strip were placed on it in such a way that the gel side was down onto the sample. The well was then filled with mineral oil to provide prefect condition for rehydration and to avoid strip drying and sample precipitation. Rehydration of the strip was followed by isoelectric focussing with Bio-Rad PROTEAN IEF cell at 20°C, using a gradually increasing voltage (250-10,000) initially and then reaching 14,000 volt/hr. After completion of IEF, the IPG strips were equilibrated with equilibration buffer I (supplied with the kit) and equilibration buffer II (supplied with the kit) for 10- 15 minutes each.
Second dimension- SDS PAGE: IPG strips were then transferred onto 10% SDS polyacrylamide gel vertical slab (Bio-Rad Mini- PROTEAN 3 and Mini-PROTEAN Dodeca TM) and run the electrophoresis at 200 Volt constant for 40 min.
Staining and scanning of 2-D electrophoresis gel: After completion of the second dimension of 2-D electrophoresis, the protein profile was visualized by staining the gel with Coomassie Brilliant Blue R-250. Using the image scanner (Bio-Rad Gel Doc TM EZ imager), the gel was scanned at 300 dpi.
Isoelectric focusing was successfully done on IPG strips and followed by 10% SDS-PAGE. The different banding patterns of protein were resolved by staining the gel with Coomassie Brilliant Blue R-250 which showed that there was more separation of protein spots in recent protocol compared to phenol extraction method (Figure 4b). More number of proteins spots was seen in the present method due to the removal of the contaminating nucleic acids which form streaks on the gel . This also enhances protein yield and spot resolution.
Another merit of simultaneous extraction technique is particularly at the proteomic level where the proteins will be almost devoid of DNA and RNA contamination since protein is extracted from the lower organic phase after the extraction of DNA and RNA from the upper aqueous phase is completed.
For any molecular application of isolated genomic DNA, total RNA or protein the yield, integrity, stability, and purity of samples are utmost importance which determines the applicability of the isolation protocol employed. The present advancement thus provides a process for simultaneous extraction of DNA, RNA, and proteins from a limited sample source (single tea leaf sample). The isolated biomolecules are successfully used for genomic and proteomic analysis. This is the ?rst report of simultaneous extraction of DNA, RNA, and proteins from tea leaf tissue. The present advancement avoids use of costly chemicals or expensive kits for isolating DNA, RNA and protein and hence is cost-effective .
| Section | Controller | Decision Date |
|---|---|---|
| 15 | SHARANA GOUDA | 2023-12-07 |
| 15 | SHARANA GOUDA | 2024-04-24 |
| # | Name | Date |
|---|---|---|
| 1 | 201831000081-IntimationOfGrant24-04-2024.pdf | 2024-04-24 |
| 1 | 201831000081-STATEMENT OF UNDERTAKING (FORM 3) [01-01-2018(online)].pdf | 2018-01-01 |
| 2 | 201831000081-FORM 1 [01-01-2018(online)].pdf | 2018-01-01 |
| 2 | 201831000081-PatentCertificate24-04-2024.pdf | 2024-04-24 |
| 3 | 201831000081-NBA Approval Submission [23-04-2024(online)].pdf | 2024-04-23 |
| 3 | 201831000081-DRAWINGS [01-01-2018(online)].pdf | 2018-01-01 |
| 4 | 201831000081-Written submissions and relevant documents [05-12-2023(online)].pdf | 2023-12-05 |
| 4 | 201831000081-COMPLETE SPECIFICATION [01-01-2018(online)].pdf | 2018-01-01 |
| 5 | 201831000081-FORM 18 [21-02-2018(online)].pdf | 2018-02-21 |
| 5 | 201831000081-Correspondence to notify the Controller [21-11-2023(online)].pdf | 2023-11-21 |
| 6 | 201831000081-US(14)-HearingNotice-(HearingDate-22-11-2023).pdf | 2023-09-26 |
| 6 | 201831000081-Proof of Right (MANDATORY) [28-03-2018(online)].pdf | 2018-03-28 |
| 7 | 201831000081-FORM-26 [28-03-2018(online)].pdf | 2018-03-28 |
| 7 | 201831000081-FER.pdf | 2021-10-18 |
| 8 | 201831000081-OTHERS [07-05-2021(online)].pdf | 2021-05-07 |
| 8 | 201831000081-CLAIMS [07-05-2021(online)].pdf | 2021-05-07 |
| 9 | 201831000081-COMPLETE SPECIFICATION [07-05-2021(online)].pdf | 2021-05-07 |
| 9 | 201831000081-FER_SER_REPLY [07-05-2021(online)].pdf | 2021-05-07 |
| 10 | 201831000081-COMPLETE SPECIFICATION [07-05-2021(online)].pdf | 2021-05-07 |
| 10 | 201831000081-FER_SER_REPLY [07-05-2021(online)].pdf | 2021-05-07 |
| 11 | 201831000081-CLAIMS [07-05-2021(online)].pdf | 2021-05-07 |
| 11 | 201831000081-OTHERS [07-05-2021(online)].pdf | 2021-05-07 |
| 12 | 201831000081-FER.pdf | 2021-10-18 |
| 12 | 201831000081-FORM-26 [28-03-2018(online)].pdf | 2018-03-28 |
| 13 | 201831000081-Proof of Right (MANDATORY) [28-03-2018(online)].pdf | 2018-03-28 |
| 13 | 201831000081-US(14)-HearingNotice-(HearingDate-22-11-2023).pdf | 2023-09-26 |
| 14 | 201831000081-Correspondence to notify the Controller [21-11-2023(online)].pdf | 2023-11-21 |
| 14 | 201831000081-FORM 18 [21-02-2018(online)].pdf | 2018-02-21 |
| 15 | 201831000081-COMPLETE SPECIFICATION [01-01-2018(online)].pdf | 2018-01-01 |
| 15 | 201831000081-Written submissions and relevant documents [05-12-2023(online)].pdf | 2023-12-05 |
| 16 | 201831000081-DRAWINGS [01-01-2018(online)].pdf | 2018-01-01 |
| 16 | 201831000081-NBA Approval Submission [23-04-2024(online)].pdf | 2024-04-23 |
| 17 | 201831000081-FORM 1 [01-01-2018(online)].pdf | 2018-01-01 |
| 17 | 201831000081-PatentCertificate24-04-2024.pdf | 2024-04-24 |
| 18 | 201831000081-STATEMENT OF UNDERTAKING (FORM 3) [01-01-2018(online)].pdf | 2018-01-01 |
| 18 | 201831000081-IntimationOfGrant24-04-2024.pdf | 2024-04-24 |
| 1 | strategy_81E_17-11-2020.pdf |