DESC:TECHNICAL FIELD
The present invention is in relation to detection of pathogen infection in biological samples. More particularly, the present invention is in relation to detection of Minute Virus of Mice (MVM) in mouse. The invention discloses primer sequences corresponding to a conserved region of Minute Virus of Mice genome, allowing for the detection of Minute Virus of Mice in samples obtained from mouse. The invention also provides method and a diagnostic kit for the detection, wherein the DNA extracted from biological sample from the animal is incubated with the kit components, Bst polymerase mix, primer mix, and molecular biology grade water, and the presence of the DNA is detected by photometry for turbidity or visually by a simple colour reaction without any equipment.

BACKGROUND
It is well established that many rodent pathogens cause sub-clinical infections and significantly affect research. There are pathogen detection kits available to detect the presence of several pathogens, wherein kits are imported and expensive. In order to improve the quality and bring harmonization in the use of animals in research by educational institutions, pharmaceutical/biotechnology industries, and contract research organizations, animal health monitoring is absolutely necessary and highly relevant. In order to improve quality of the experimental animals used, a rapid and economical method of pathogen detection and related tool (kit) is the need of the hour. As such, sufficient and reliable information about animal health status has become even more important during the last decade with the rapid development and worldwide exchange of new genetically modified rodents, as well as the globalization of contract research. Unhealthy status could lead to irreproducible or repeated experiments, affecting the most important tenet of the use of these animals for research: reducing the numbers used to a minimum. Hence, standardisation of laboratory rodent health monitoring and detection of infection is a pre-requisite forin-vivo studies. To assess the quality of animals used for scientific research, a proper health monitoring scheme is important to define the pathogen status of both individual animal and the population as a whole, detect infection as early as possible, and validate the efficiency of measures for the prevention of agent introduction. Systematic and scheduled laboratory testing is the most effective way to determine colony status and to prevent or detect influences on experiments.
Minute virus of mice (MVM) is a small non-enveloped virus belonging to the Parvoviridae family. It infects a large species of animals and insects, it is a prevalent infection in laboratory mice, thus creating major setbacks to in-vivo studies and biotherapeutic research.The virus gets transmitted from infected mice to healthy animals by faeces, urine and nasal secretions. It causes subclinical infection in adult rats or mice, but it majorly affects fetal development in mice or after birth resulting in severe damage to multiple organs. There are various studies on the pathogenicity of MVM. Lydia et.al. in “Coping with parvovirus infections in mice: health surveillance and control” Lab. Anim. (2012), Vol. 46(1) :14-23 give a detailed study on MVM infection in mice. This articlegives information on the infection, transmission and symptoms of the infection.
Nucleic acid amplification is an imperative molecular tool and is widely used in varied fields such as pharmaceuticals, forensics, pathogen detection, cloning, agriculture and the like. It is one of the most valuable tools virtually in all life science fields; including clinical medicine, in which detection of infectious diseases, genetic disorders and genetic traits is carried out.
Polymerase Chain Reaction (PCR) is the first nucleic acid amplification method. With the advancement of research, there have been several amplification methods invented, which include nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR) and Strand Displacement Amplification (SDA) apart from widely used polymerase chain reaction (PCR) based detection. To develop an economical and efficient amplification method is the need of the hour.
Bae et.al. in “Multiplex PCR for rapid detection of minute virus of mice, bovine parvovirus, and bovine herpesvirus during the manufacture of cell culture-derived biopharmaceuticals”; J. Biotechnology and Bioprocess Engineering (2010), Vol.15 :1031–1037, describe the multiplex PCR assay for detecting MVM and the other viruses in cell culture-derived biopharmaceuticals. Chinese hamster ovary (CHO) cells are considered for the detection studies of MVM. The main limitation of PCR based method is that it is highly expensive and there are chances of cross contamination when done for large number of samples as it is a multi step process. There is no specific rapid detection technique in the prior art for the detection of MVM in mice.
Patent document US4683202 discloses a process for amplifying specific nucleic acid sequence contained in a nucleic acid or mixture using PCR. PCR uses heat denaturation of double-stranded DNA to promote the next round of DNA synthesis. It involves multistep processes and it is expensive, hence it is not economical to have PCR based methods on a largescale.
3SR and NASBA eliminate heat denaturation by using a set of transcription and reverse transcription reactions to amplify the target sequence. Similarly, SDA eliminates the heat denaturation step in cycling DNA synthesis by employing a set of restriction enzyme digestions and strand displacement DNA synthesis with modified nucleotides as substrate. These methods can amplify target nucleic acids to a similar magnitude; all with detection limit of less than 10 copies and within an hour, but still have shortcomings. They require either a precision instrument for amplification or an elaborate method for detection of the amplified products due to poor specificity of target sequence selection. Despite the simplicity and the obtainable magnitude of amplification, the requirement for a high precision thermal cycler in PCR prevents this powerful method from being widely used, such as in private clinics as a routine pathogen detection tool.
On the other hand, NASBA and 3SR, which do not use thermal cycling, are compromised in specificity, resulting mainly from the necessity to use a relatively low temperature of 60-65°C for amplification. Patent GB2293238A discloses self-sustained sequence replication (3SR) for synthesising target nucleic acid sequence extracellularly or within cells by replication and/or amplification and thereby extracting the amplified target sequence and carrying out gel electrophoresis followed by Southern or Northern blotting; and detecting the target sequence on the gel or blot. Thus, it requires an additional method due to poor specificity of target sequence selection.
SDA largely overcomes these shortcomings by using four primers and isothermal conditions for amplification, but still has limitation as increased backgrounds due to digestion of irrelevant DNA contained in the sample and the necessity to use expensive modified nucleotides as substrate. Although the use of multiple primers, such as in nested PCR and SDA, has improved amplification specificity for the target sequence, residual co-amplification of irrelevant sequences still causes a general setback in nucleic acid amplification, particularly for pathogen detection. Patent EP0628640 discloses a method for simultaneously amplifying two target nucleic acid sequences by Strand Displacement Amplification (SDA), as it uses multiple primers, hinders its usage in clinical detection.

SUMMARY OF INVENTION
The invention provides a primer set for detection and identification of Minute Virus of mice; selected from sequences comprising Sequence ID 1, Sequence ID 2, Sequence ID 3 and Sequence ID 4. The invention also provides asynthetic gene sequence comprising Sequence ID 5 corresponding to a conserved region of Minute Virus of mice as a positive control. The invention also provides a synthetic gene sequence comprising Sequence ID 5 corresponding to a conserved region of Minute Virus of mice as a positive control. The invention also provides a method of detection and identification of Minute Virus of mice infection. The method comprises steps of: a) obtaining test DNA from biological sample; b) performing amplification of reaction mixture comprising primer set of present invention, DNA polymerase mix, dNTPs and test DNA; c) performing amplification of reaction mixture comprising primer set of present invention, DNA polymerase mix, dNTPs and positive control of present invention; and d) analyzing the presence of at least one amplicon to detect Minute Virus of mice infection. The invention also provides acomposition for detecting and identifying Minute Virus of Mice in a biological sample, comprising the primer set of present invention.The invention also providesa kit for detecting and identifying Minute Virus of Mice in a biological sample, comprising the primer set and positive control of the present invention; Bst polymerase mix; molecular biology grade water and an instruction manual.
BRIEF DESCRIPTION OF FIGURES
The features of the present invention can be understood in detail with the aid of appended figures. It is to be noted however, that the appended figures illustrate only typical embodiments of this invention and are therefore not to be considered limiting of its scope for the invention.
Figure 1: Gel picture showing PCR amplification product corresponding to VP1 region of length 220bp of Minute Virus of Mice in positive control plasmid.
Figure 2: Schematic representation of standard procedure in LAMP assay; (1) Sample (2) DNA extracted (3) Amplification (3a) Preparation of master mix (3b) Addition of DNA samples (3c) LAMP amplification (3d) Colour change observed (4) Detection.
Figure 3: Schematic diagram of LAMP assay; (a) DNA from the sample, (b) primer mix, Bst mix and MBGW (c) Ice box (d) Incubation in Thermocycler (e) Working SYBR solution by adding TE buffer (f) Fluorescent orange colour (Negative) and Fluorescent green colour (positive).
Figure 4: Visual detection of LAMP assay for various dilutions of positive control utilizing SYBR dye to estimate limit and accuracy of detection using the Kit ion of LAMP assay for various dilutions utilizing SYBR dye to estimate limit and accuracy of detection using the Kit.
Figure 5: Detection assay for Minute Virus of Mice from clinical samples wherein, (a) is Negative control, (b) is Sample, and (c) is Positive control.
Figure 6: shows gel pictures of PCR products (220bp) employing LAMP outer primers for clinically positive and clinically negative samples.
SEQUENCE LISTING
Nucleic acid sequences listed herein or in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases. In at least some cases, only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
Sequence ID: 1-4 are nucleic acid sequences of exemplary Minute Virus of Mice detection primers.
Sequence ID: 5 is nucleic acid sequences of exemplary synthetic gene corresponding to conserved region of Minute Virus of Mice.
DETAILED DESCRIPTION OF INVENTION
The embodiments herein and the various features of the proposed system are explained more fully with reference to the non-limiting embodiments that are illustrated in the accompanying drawings and detailed in the following description. The illustrations used herein are intended to merely facilitate an understanding of ways in which the embodiments herein may be prescribed and further to enable those skilled in the art to practice the embodiment herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein.
Those skilled in the art will be aware that the invention described herein is subject to variations and modifications other than those specifically described. It is to be understood that the invention described herein includes all such variations and modifications. The invention also includes all such steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.
Definitions
For convenience, before further description of the present invention, certain terms employed in the specification, example and appended claims are collected here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person of skill in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below.
The articles “a”, “an” and “the” are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
The terms “comprise” and “comprising” are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as “consists of only”.
Throughout this specification, unless the context requires otherwise the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated element or step or group of element or steps but not the exclusion of any other element or step or group of element or steps.
The term “including” is used to mean “including but not limited to”. “Including” and “including but not limited to” are used interchangeably.
The term “biological sample” refers to small samples of a research participant’s urine, blood, serum, tissue, or other sample from the body that are used in health research. It includes but is not limited to from the group consisting of serum, plasma, urine, pleural-peritoneal effusion, synovial fluid, cerebrospinal fluid, amniotic fluid, supernatant of a cell culture, and cell lysate.
The term “nucleotide sequence” means the order in which nucleotides are situated in a chain relative to one another.
The present invention provides a method of detection of Minute Virus of Mice (MVM) in mice bysimple, rapid, cost effective single tube method without requiring any sophisticated detection equipment at any stage usingloop mediated isothermal amplification (LAMP).
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the disclosure, the preferred methods, and materials are now described. All publications mentioned herein are incorporated herein by reference.
The invention provides nucleotide primers, specifically to amplify the VP1 region of length 220 bp; for detection and quantification of the said virus.
One aspect of the invention is a primer set for detection and identification of Minute Virus of mice; selected from sequences comprising Sequence ID 1, Sequence ID 2, Sequence ID 3 and Sequence ID 4. The primers are designed according to the LAMP primer designing principals to the conserved target region using online LAMP primer design software, Primer explorer V4/primer explorer V5 of Eiken Chemicals (https://primerexplorer.jp/e/). The primer set is selected from a group comprising outer primer and loop (inner) primer.
Based on bioinformatics analysis of the available sequence of Minute virus of Mice on public databases, portions of conserved regions of Capsid encoding gene is selected. Capsid protein self-assembles to form an icosahedral capsid with a T=1 symmetry, about 22 nm in diameter, and consisting of 60 copies of two size variants of the capsid proteins, VP1 and VP2, which differ by the presence of an N-terminal extension in the minor protein VP1. VP1 is expected to serve as a lipolytic enzyme to breach the endosomal membrane during entry into host cell and might contribute to virus transport to the nucleus. VP1 is therefore a house keeping gene having conserved encoding DNA region. Therefore, conserved VP1 encoding genome region is selected as identification target for detection of Minute virus of mice infection.
Another aspect of inventions is a synthetic gene sequence comprising Sequence ID 5 corresponding to a conserved region of Minute Virus of mice as a positive control. The conserved region encoding VP1 genes is designed to a synthetic gene which is used as positive control. This synthetic gene is highly specific and sensitive to the four designed primers.
LAMP is a nucleic acid amplification technique wherein the control for the detection of Minute Virus of Mice (MVM) in mice is prepared by cloning synthetic gene into a plasmid. Any high copy number cloning plasmid with this gene can be used to generate a positive control plasmid and amplified using appropriate host.
Yet another aspect of invention is a method of detection and identification of Minute Virus of mice infection. The method comprises steps of: a) obtaining test DNA from biological sample; b) performing amplification of reaction mixture comprising primer set of present invention, DNA polymerase mix, dNTPs and test DNA; c) performing amplification of reaction mixture comprising primer set of present invention, DNA polymerase mix, dNTPs and positive control of present invention; and d) analysing the presence of at least one amplicon to detect Minute Virus of mice infection.
In one embodiment of the present invention biological sample is selected from a group comprising whole blood, plasma, serum, lymph, urine, saliva, tears, ornasopharyngeal secretions, tissues sections and fecal samples.
The DNA extraction method to isolate DNA from biological sample comprises but is not limited to trizol extraction, phenol/chloroform extraction, phenol/chloroform plus CTAB extraction, and commercially available DNA extraction kits, including Roche column extraction kit.
The DNA polymerase that may be used in a reaction is a polymerase derived from a thermophilic microorganism, in particular, a polymerase lacking a 5'-> 3' exonuclease function. Non-limiting examples of the DNA polymerase include the Bacillus stearothermophilus (Bst) DNA polymerase, the Thermus, thermophilus (Tth) DNA polymerase, the Thermus aquaticus (Taq) DNA polymerase, the Thermococcus litoralis DNA polymerase, the Pyrococcusfuriosus (Pfu) DNA polymerase, and the Bacillus caldotenax DNA polymerase. For exemplary purpose Bst polymerase has been used in this invention. However, the optimum results are obtained by using the Bst Mix of the kit of the present invention. Bst Mix is a ready-to-use cocktail containing all components, except primers and template, for the amplification and detection of DNA using LAMP reaction.
In yet another embodiment of present invention, DNA polymerase is Bst polymerase.
In yet another embodiment of present invention, amplification is performed by incubating the reaction mixture at temperature range of 60?C to 65?C for 50 to 60 minutes.
In yet another embodiment of present invention, the analysis of presence of atleast one amplicon is done by measuring one or more of colour change or turbidity increase of the reactants.
In yet another embodiment of present invention, detection of at least one amplicon is indicated by change in fluorescent emission wavelength of the reaction mixture or by change in turbidity of the reaction mixture or appearance of a ladder-like electrophoresis pattern during the process of agarose gel electrophoresis.
Another aspect of the invention is acomposition for detecting and identifying Minute Virus of Mice in a biological sample, comprising the primer set of present invention. The outer primer and loop primer are mixed in a fixed ratio to form a mixture suitable for optimum amplification.
Another aspect of the invention is a kit for detecting and identifying Minute Virus of Mice in a biological sample, comprising the primer set and positive control of the present invention; Bst polymerase mix; molecular biology grade water and an instruction manual.
A rapid detection kit using LAMP technique is developed for the detection of Minute Virus of Mice. In the kit according to the present invention, a primer set consisting of four primers, which are suitable for components used in a LAMP reaction except for a template and are suitable for the minute virus of mice to be detected, may be provided separately or in one tube.
The DNA sample from the animal is incubated with the kit components as per the instructions provided. Detection of amplification product is done by either by photometry for turbidity which is produced by increased quantity of Magnesium pyrophosphate in the reaction mixture/solution or visually by a simple colour reaction using SYBR green dye. This LAMP kit has the potential to be used as a simple screening assay in the laboratory animal facility or at the point of care by clinicians.

Experimental
Example 1. Isolation of DNA
DNA is isolated from the tissues or faecal samples by trizol method or Roche column-based extraction methodfor Minute Virus of Mice. DNA in the concentration range of 30ng/µl- 3 µg/µl of purity range with 260/280 of 1.10 to 1.96 is used for conducting experiments.

Example 2. Primer design and synthesis
Primers corresponding to VP1 gene region are selected as identifier site and primers for the said gene are designed using Primer Explorer software of Eiken Chemicals (https://primerexplorer.jp/e/). The primer selected are:
Outer Primers-:
F3: Sequence ID 1
5’GCTTACTCTGATGAAGTTTTGG 3’
B3: Sequence ID 2
5’ TCCCATTCCATGTCCTCG 3’
Loop Primers-:
FIP: Sequence ID 3
5’CCATTGAGCTGAACATCTTCATTTTACAACCAACTGGTTAAAAGAGA 3’
BIP: Sequence ID 4
5’ TCGGATGGAATAGTTACAAAAAGGATAGTTTCCGCTCCTCGTT3’

HPLC purified primers are ordered in 50 nmole scale from a commercial source, Eurofins. The primers are reconstituted and diluted with Tris EDTA buffer.to the final concentration of 10 pmole. The outer primers and loop primersare mixed in the ratio 1:2 to prepare respective primer mixes.
Example 3. Design of synthetic gene
A synthetic gene is constructed constituting the 220 bp corresponding to conserved regions of VP1 and cloned in single plasmidcloned in single high copy number plasmid pT-NOT Vector which is then amplified in E.coli Topp10 F` host strain. This plasmid is used as positive control for detection for detection of Minute Virus of Mice.Gel picture showing a PCR product (220 bp) is given in Figure 1 along with the negative control and 50 bp ladder.

Example 4. Kit Preparation for detection of Minute Virus of mice in vitro
A rapid detection kit using LAMP technique is developed for the detection of Leptospirosis in Mice. The kit components comprise: primer set of Sequence ID 1, Sequence SEQ ID 2, Sequence ID 3 and Sequence ID 4, Bst Mix; molecular biology grade water and an instruction manual. Each reaction uses 15 µL of Bst Mix, 1 µL of primer mix, 5 µL of molecular biology grade water and 4 µL of positive control DNA. Accordingly, appropriate volumes of vials for each component can be can be customized according to number of reactions for which the kit is to be used. The kit should be stored at 4ºC. Storage at –20ºC may extend shelf life. The kit components, Bst mix composition and primer mix is provided according Table 1, Table 2 and Table 3.
Table 1: Kit components
Components Volume in µL
Bst Mix 15.0
Primer mix 1.0
MBGW 4.0
Plasmid contain gene 5.0
Total Volume 25.0

Table 2: Bst mix composition
Bst enzyme (8 units) 1.0 micro litre
Buffer (10 x) 2.5 micro litre
dNTPS 10mM 1.0 micro litre

Table 3: Primer mix composition
Stock concentration Working concentration
Outer primers 100 pico mol 10 pico mol
Loop primers 200 pico mol 20 pico mol

Example 5. Assay procedure using the kit
Schematic representation of standard procedure in LAMP assay is given in Figure 2; wherein (1) samples are collected; (2) DNA is extracted from the collected sample; (3) Amplification of the DNA is done for easy detection, firstly by (3a) preparation of master using Bst mix, and primer mix ; (3b) addition of test samples and then;(3c) LAMP amplification is carried out thus giving required (3d) colour change which can be easily observed; (4) Detection is done visually or by colorimetry.
The components (except enzymes) are thawed and the contents are spun down (if necessary). A LAMP mix is prepared in separate tubes for test sample, a positive and a negative control. A positive LAMP reaction is setup using 15 µL of Bst Mix, 1 µL of primer mix, 5 µL of molecular biology grade water and 4 µL of positive control DNA. A negative LAMP reaction is setup using 15 µL of Bst Mix, 1 µL of primer mix, 9 µL of molecular biology grade water.
A test LAMP reaction assay is setup using 15 µL of Bst Mix, 1 µL of primer mix, 5 µL of molecular biology grade water (MBGW) and 4 µL of extracted DNA template. All the reaction mixtures are incubated at 63°C for 60 min. After incubation, SYBR dye of concentration 1:10000 is prepared and 1 µL of SYBR dye is added to the reaction tubes. Finally, results are visualised directly or analysed under UV at 254 nm.
A schematic diagram of LAMP assay is given in Figure 3 wherein (a) Template DNA is prepared from the sample; (b) Primer mix, Bst mix and molecular biology grade water is taken out from the kit; (c) Reaction mixture is prepared at 4°C placing all the reagents on ice bath; (d) Thermocycler or a dry bath is used to incubate the mixture at 63°C for 60 minutes; (e) Working SYBR solution is prepared by adding TE buffer into SYBR vial and mixed well; and (f) Visual observation of colour change in the vial or at 254 nm.
Example 6. Interpretation of result of assay using kit
The LAMP assay specifically amplifies the DNA of Minute Virus of Mouse. The monitoring of gene amplification is carried out with naked eye visual inspection. Following amplification, the tubes are inspected for white turbidity through naked eye after a pulse spin to deposit the precipitate in the bottom of the tube. The inspection for amplification is also performed through observation of colour change following addition of 0.5µl of SYBR. In Figure 4, LAMP for Minute Virus of Mice wherein (a) negative control (b) sample (c) positive control.
Negative Control: Orange colour indicates absence of Minute virus of mice.
Test Sample:Fluorescent green colour indicates positive reaction i.e. presence of Minute virus in the test sample and orange colour indicates negative reaction i.e. absence of Minute virus in the test sample.
Positive control:Fluorescent green colour indicates positive reaction and therefore presence of atleast one amplicon of Minute virus of mice
Example 7. Sensitivity and specificity of LAMP assay using the Kit
To establish the detection of limit of the LAMP assay, serial dilutions of plasmid that had been quantified by measuring the optical density at 260 nm are tested and compared with the results for a real-time PCR assay done in-house.
Assay for dilutions up to 2X101 is done in duplicates and for lower dilutions is performed in triplicates. The results of detection are compared with the results for a real-time PCR assay done in-house.
From the figure 4, the limit of detection is 6.25 copies/ul. Positivity at further dilutions is not 100%, or the colour is faint. However, the detection limit for the LAMP reaction is found to be 20 copies for a 60-minute reaction in ESE Quant LAMP machine as well as in electrophoresis analysis using the kit of present invention.
DNA isolated from Minute virus of Mice positive animals is used as template for LAMP set up and also cDNA synthesis by outer reverse primer and PCR using two lamp outer primers. LAMP positive samples are also positive with two rounds of PCR employing LAMP outer primers. PCR Amplified products are gel eluted and sent for sequencing. The sequence of the amplified product when aligned using basic Sequence Alignment Search Toolconfirms the target gene thus confirming the accuracy of LAMP reaction. The gel eluted PCR product (220bp) is given in Figure 6.
Example 8. Validation of assay LAMP kit for detection of Minute virus of mice
The kit for Minute Virus of Miceis validated using both clinically positive and clinically negative samples from the field (Figure 5 and 6).3 batches with different batch sizes obtained from different animals are checked for the consistent performance of the kit (Table 4, Table 5 and Table 6).
Table 4-Batch 1
KIT MVM Batch 01 LAMP ELISA
Sample 1 Positive Positive
Sample 2 Negative Negative
Sample 3 Positive Positive
Sample 4 Negative Negative
Sample 5 Negative Negative
Sample 6 Positive Positive
Sample 7 Negative Negative
Sample 8 Positive Positive

Table 5-Batch 2
KIT MVM Batch 02 LAMP ELISA
Sample 1 Positive Positive
Sample 2 Negative Negative
Sample 3 Positive Positive
Sample 4 Negative Negative
Sample 5 Negative Negative
Sample 6 Positive Positive
Sample 7 Negative Negative
Sample 8 Positive Positive

Table 6-Batch 3
KIT MVM Batch 03 LAMP ELISA
Sample 1 Positive Positive
Sample 2 Negative Negative
Sample 3 Positive Positive
Sample 4 Negative Negative
Sample 5 Negative Negative
Sample 6 Positive Positive
Sample 7 Negative Negative
Sample 8 Positive Positive

The results suggest that the assays performed using the primers and the kit of present invention are in line with the expansive ELISA method.
A single tube technique for the amplification of DNA, single temperature incubation and specific primers for the amplification of Minute Virus of Mice (VP1 region of length 220bp) in the present invention makes the whole process highly efficient and economical by abstaining the need for expensive thermal cyclers. The single tube assay carried out in the present invention is simpler and faster than multistep processes and it also eliminates false positives which may arise due to contamination from previous reactions. The present invention can be useful in in-vivo studies and standardisation of laboratory rodent health monitoring and detection of infection with high precision and cost-effectively.
,CLAIMS:We claim:
1. A primer setfor detection and identification of Minute Virus of mice; selected from sequences comprising Sequence ID 1, Sequence ID 2, Sequence ID 3 and Sequence ID 4.
2. A synthetic gene sequence comprising Sequence ID 5 corresponding to a conserved region of Minute Virus of mice as a positive control.

3. A method of detection and identification of Minute Virus of mice infection, the method comprising steps of:
a) obtaining test DNA from biological sample;
b) performing amplification of reaction mixture comprising primer set of claim 1, DNA polymerase mix, dNTPs and test DNA;
c) performing amplification of reaction mixture comprising primer set of claim 1, DNA polymerase mix, dNTPs and positive control of claim 2; and
d) analyzing the presence at least one amplicon to detect Minute Virus of mice infection.
4. The method as claimed in claim 3 wherein biological sample is selected from a group comprising whole blood, plasma, serum, lymph, urine, saliva, tears, ornasopharyngeal secretions, tissues sections and fecal samples.
5. The method as claimed in claim 3 wherein DNA polymerase is Bst polymerase.

6. The method as claimed in claim 3 whereinamplification is performed by incubating the reaction mixture at temperature range of 60?C to 65?C for 50 to 60 minutes.
7. The method as claimed in claim 3 whereinthe analysis of presence of atleast one amplicon is done by measuring one or more of color change or turbidity increase of the reactants.

8. The method as claimed in claim 3, wherein said detection of at least one amplicon is indicated by change in fluorescent emission wavelength ofthe reaction mixture or by change in turbidity of the reaction mixture or appearance of a ladder-like electrophoresis pattern during the process of agarose gel electrophoresis.

9. A composition for detecting and identifying Minute Virus of Mice in a biological sample, comprising the primer set according to claim 1.
10. A kit for detecting and identifying Minute Virus of Mice in a biological sample, comprising the primer set according to claim 1; Bst polymerase mix; molecular biology grade water; a positive control according to claim 2 and an instruction manual.