Abstract: Title: A method for detection of Mouse hepatitis virus and kit thereof Abstract: The present invention is in relation to detection kit for the detection of Mouse Hepatitis Virus (MHV) infection in mouse by Loop Mediated Isothermal Amplification (LAMP). A synthetic nucleotide sequence is prepared which is identical to gene conserved in the Mouse Hepatitis Virus (MHV) genome, which is used in the Mouse Hepatitis Virus (MHV) detection kit for the detection of the MHV infection. The sample from the animal is incubated with the kit components and detected by photometry for turbidity or visually by a simple colour reaction using SYBR green dye without any equipment.
DESC:TECHNICAL FIELD
The present invention is in relation to detection of pathogen infection in biological samples. More particularly, the present invention is in relation to detection of Mouse Hepatitis Virus (MHV) in mice. The invention discloses primer sequences corresponding toa conserved region ofMouse Hepatitis Virus genome, allowing for the detection of Mouse Hepatitis Virus in samples obtained from mice. The invention also provides method and a diagnostic kit for the detection, wherein theribonucleic acid (RNA) extracted from biological sample from the animal is incubated with the kit components, reverse transcriptase mix, Bst polymerase mix, primer mix, and molecular biology grade water, and the presence of the RNA is detected by photometry for turbidity or visually by a simple colour reaction without any equipment.
BACKGROUND
It is well established that many rodent pathogens cause sub-clinical infections and significantly affect research. There are detection kits available to detect the presence of several pathogens, wherein kits are imported butare expensive. In order to improve the quality and bring harmonization in the use of animals in research by educational institutions, pharmaceutical/biotechnology industries, and contract research organizations, animal health monitoring is absolutely necessary and highly relevant. In order to improve quality of the experimental animals used, a rapid and economical method of pathogen detection and related tool (kit) is the need of the hour. As such, sufficient and reliable information about animal health status has become even more important during the last decade with the rapid development and worldwide exchange of new genetically modified rodents, as well as the globalization of contract research. Unhealthy status could lead to irreproducible or repeated experiments, affecting the most important tenet of the use of these animals for research: reducing the numbers used to a minimum. Hence, standardisation of laboratory rodent health monitoring and detection of infection is a pre-requisite forin-vivo studies. To assess the quality of animals used for scientific research, a proper health monitoring scheme is important to define the pathogen status of both individual animal and the population as a whole, detect infection as early as possible, and validate the efficiency of measures for the prevention of agent introduction. Systematic and scheduled laboratory testing is the most effective way to determine the health status of the animal colony and to prevent or detect influences on experiments.
Mouse Hepatitis Virus (MHV) is a RNA virus. It is contagious and influences biological responses, thus causing misinterpretation in research by affecting the immune system of the host organism. Mouse Hepatitis Virus (MHV) can remain dormant in the host organism for a long period. But, in MHV outbreak, the infection can be lethal wiping outwhole mouse colony and this outbreak can be a threat to other healthy animals. MHV infection makes the mice susceptible to various other pathogenic infection as the immune system is compromised by the infection.
Currently, MHV detection is carried out by enzyme-linked immunosorbent assay, immuno-enzyme assay, immunofluorescence assay and nucleic acid amplification technique. Nucleic acid amplification is an imperative molecular tool and is widely used in varied fields such as pharmaceuticals, forensics, pathogen detection, cloning, agriculture and the like. It is one of the most valuable tools virtually in all life science fields; including application-oriented fields such as clinical medicine, in which detection of infectious diseases, genetic disorders and genetic traits
Polymerase Chain Reaction(PCR) is the first nucleic acid amplification method. With the advancement of research, there are several amplification methods invented which include nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR) and Strand Displacement Amplification (SDA) apart from the widely used conventional polymerase chain reaction (PCR) based detection. To develop an economical and efficient amplification method is the need of the hour.
The limitations of conventional assays are lack of specificity, tedious processes, consumption of large amount of samples and reagents, and high assay cost. Stephen W. Barthold in Mouse Hepatitis Virus Infection, Liver, Mouse; “Digestive system”, 1997, Vol 3, pp 179-184 states about differential detection which is not specific and is not possible to detect in the initial stages of the infection.
CN 104263850A discloses a method for detecting MHV type based on SNaPshot technology involving multiple PCR amplification steps, expensive PCR amplification reagents and primers. For a routine laboratory analysis this laborious method is not feasible. Patent GB2293238A discloses self-sustained sequence replication (3SR) for synthesising target nucleic acid sequence extracellularly or within cells by replication and/or amplification and thereby extracting the amplified target sequence and carrying out gel electrophoresis followed by Southern or Northern blotting; and detecting the target sequence on the gel or blot. Due to poor specificity of target sequence selection this method requires additional steps for confirmation of presence of virus.
Patent EP0628640 discloses a method for simultaneously amplifying two target nucleic acid sequences by Strand Displacement Amplification (SDA), which largely overcomes shortcomings of poor amplification specificity by using four primers and isothermal conditions for amplification. But the necessity to use expensive modified nucleotides as substrate and multiple primers for reaction makes the method tedious and expensive and hinders its use for clinical detection. Also, the method suffers from increased background due to digestion of irrelevant DNA contained in the sample and residual co-amplification of irrelevant sequences. Wang et.al. in “Diagnosis of mouse hepatitis virus contamination in mouse population by using nude mice and RT-PCR”; J.Molecular and Cellular Probes;Vol. 13, 1999, pp 29-33, describe a reverse transcription polymerase chain reaction (RT-PCR) based method to detect MHV in mouse.Use of 3SR and NASBA eliminate need of heat denaturation by using a set of transcription and reverse transcription reactions to amplify the target sequence. Similarly, SDA eliminates the heat denaturation step in cycling DNA synthesis by employing a set of restriction enzyme digestions and strand displacement DNA synthesis with modified nucleotides as substrate. These methods can amplify target nucleic acids to a similar magnitude; all with detection limit of less than 10 copies and within an hour. Despite the simplicity and the obtainable magnitude of amplification, the requirement for a high precision thermal cycler in PCR prevents this powerful method from being widely used, such as in private clinics as a routine pathogen detection tool. On the other hand, NASBA and 3SR, which do not use thermal cycling, are compromised in specificity, resulting mainly from the necessity to use a relatively low temperature of 60-65°C for amplification.
SUMMARY OF INVENTION
Accordingly the present invention provides A primer set for detection of Mouse Hepatitis Virus in a biological sample; comprising outer primer sets and loop primer set; wherein the outer primer set comprising Sequence ID1, Sequence ID 2 or a sequence complementary thereof and the loop primer set comprising Sequence ID3, Sequence ID 4 or a sequence complementary thereof or a combination thereof; a synthetic gene sequence comprising Sequence ID 5, a sequence complementary to Sequence ID 5, a plasmid containing sequence comprising Sequence ID 5 or a sequence complementary thereof as a positive control; a method of detecting Mouse Hepatitis Virus in biological sample in a single reaction tube, said method comprising steps: (a)isolating RNA from biological sample and adding to a reaction tube adding RNA samples to a reaction tube;(b)adding a pre-mixed amplification solution to the tube containing RNA to obtain a reaction mixture, wherein said pre-mixed amplification solution comprises: reverse transcriptase mix, one or more sets of primers of present invention and DNA polymerase, (c) incubating said reaction mixture; and (e) detecting the presence of at least one amplicon by visually observing color change or turbidity change to identify the presence of Mouse Hepatitis virus. A composition for detection of Mouse Hepatitis Virus, comprising the primer set of present invention as mentioned above and a kit for detection of Mouse Hepatitis Virusin a biological sample, comprising the primer set as mentioned above ; Bst polymerase mix; reverse transcriptase mix; positive control as comprising Sequence Id 5 or a sequence complementary thereof and an instruction manual.
BRIEF DESCRIPTION OF FIGURES
The features of the present invention can be understood in detail with the aid of appended figures. It is to be noted however, that the appended figures illustrate only typical embodiments of this invention and are therefore not to be considered limiting of its scope for the invention.
Figure 1: Schematic representation of standard procedure in LAMP assay; (1) Sample (2) RNA extracted (3) Amplification (3a) Preparation of master mix (3b) Addition of RNA samples (3c) LAMP amplification (3d) Colour Change observed (4) Detection
Figure 2: Schematic diagram of LAMP assay; (a) RNA from the sample, (b) primer mix, RT mix, Bst mix and MBGW (c) Ice box (d) Incubation in Thermocycler (e) Working SYBR solution by adding TE buffer (f) Fluorescent orange colour (Negative) and Fluorescent green colour (positive)
Figure 3: visual detection of lamp assay for various dilutions of positive control using SYBR dye.
Figure 4: shows visual detection of Mouse Hepatitis Virus using LAMP assay of clinically positive (a,b,c), positive control (d) and clinically negative samples (e) from the field.
Figure 5: Shows gel pictures of PCR products (220 bp) employing LAMP outer primers for clinically negative samples (Lane 1) and clinically positive (Lane 3).
SEQUENCE LISTING
Nucleic acid sequences listed herein or in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases. In at least some cases, only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
Sequence ID: 1-4 are nucleic acid sequences of exemplary Mouse Hepatitis Virus detection primers.
Sequence ID: 5is nucleic acid sequences of exemplary synthetic gene corresponding to conserved region of Mouse Hepatitis Virus.
DETAILED DESCRIPTION OF INVENTION
Unless otherwise noted, technical terms are used according to conventional usage.
Definitions of common terms in molecular biology may be found in Lewin's Genes X, ed. Krebs et al, Jones and Bartlett Publishers, 2009 (ISBN 0763766321); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341); and George P. Rédei, Encyclopedic Dictionary of Genetics, Genomics, Proteomics and Informatics, 3rd Edition, Springer, 2008 (ISBN: 1402067534).
The following explanations of terms and methods are provided to better describe the present disclosure and to guide those of ordinary skill in the art to practice the present disclosure. The singular forms "a," "an," and "the" refer to one or more than one, unless the context clearly dictates otherwise. For example, the term "comprising a nucleic acid molecule" includes single or plural nucleic acid molecules and is considered equivalent to the phrase "comprising at least one nucleic acid molecule." As used herein, "comprises" means "includes." Thus, "comprising A or B," means "including A, B, or A and B," without excluding additional elements.
Although methods and materials similar or equivalent to those described herein can be used to practice or test the disclosed technology, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting. The embodiments herein and the various features of the proposed system are explained more fully with reference to the non-limiting embodiments that are illustrated in the accompanying drawings and detailed in the following description. The illustrations used herein are intended to merely facilitate an understanding of ways in which the embodiments herein may be prescribed and further to enable those skilled in the art to practice the embodiment herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein.
The present invention is in relation to a primer set for detection of Mouse Hepatitis Virus in a biological sample; comprising outer primer sets and loop primer set; wherein the outer primer set comprising Sequence ID1, Sequence ID 2 or a sequence complementary thereof and the loop primer set comprising Sequence ID3, Sequence ID 4 or a sequence complementary thereof or a combination thereof.
The present invention is in relation to a synthetic gene sequence comprising Sequence ID 5, a sequence complementary to Sequence ID 5, a plasmid containing sequence comprising Sequence ID 5 or a sequence complementary thereof as a positive control.
The present invention is in relation to a method of detecting Mouse Hepatitis Virus in biological sample in a single reaction tube, said method comprising steps:
a. isolating RNA from biological sample and adding to a reaction tube adding RNA samples to a reaction tube;
b. adding a pre-mixed amplification solution to the tube containing RNA to obtain a reaction mixture, wherein said pre-mixed amplification solution comprises: reverse transcriptase mix, one or more sets of primers of mentioned above and DNA polymerase.
c. incubating said reaction mixture; and
d. detecting the presence of at least one amplicon by visually observing color change or turbidity change to identify the presence of Mouse Hepatitis virus.
In an embodiment of present invention, the biological sample comprises one or more of whole blood, plasma, serum, lymph, urine, saliva, tears, nasopharyngeal secretions and tissue extracts from lymph nodes, spleen, and lung.
In another embodiment of present invention, the ratio of outer to loop primers is 1:2.
In still another embodiment of present invention, DNA polymerase is Bst polymerase.
In yet another embodiment of present invention, incubation of the reaction mixture is carried out at a) 42°C for 30 minutes followed by b) at temperature range of 60°C to 63 °C for 50 minutes to 60 minutes.
In yet another embodiment of present invention, said detection of at least one amplicon is indicated by change in fluorescent emission wavelength of the said reaction mixture, by change in turbidity of the said reaction mixture or appearance of a ladder-like electrophoresis pattern during the process of agarose gel electrophoresis.
A composition for detection of Mouse Hepatitis Virus, comprising the primer set of present invention mentioned above.
The present invention is in relation to a kit for detection of Mouse Hepatitis Virusin a biological sample, comprising the primer set mentioned above ; Bst polymerase mix; reverse transcriptase mix; positive control and an instruction manual.
The present invention provides a method for detection of Mouse Hepatitis Virus (MHV) a simple and economical single tube method.
In an aspect of the present disclosure, there is provided a set of primers having sequence as set forth in Sequence ID NO: 1, Sequence ID NO: 2, Sequence ID NO: 3 and Sequence ID NO: 4, and combinations thereof for use in detection of Mouse Hepatitis Virus in a biological sample.The invention provides nucleotide primers, specifically to amplify the Capsid region of length 220 bp; for detection and quantification of the said virus. All primers are designed according to the LAMP primer designing principals and the primer design software Primer explorer V4/primer explorer V5of Eiken Chemicals (https://primerexplorer.jp/e/).
In an aspect of the present disclosure, there is provided a synthetic gene sequence corresponding to conserved region of Capsid protein encoding genes having sequence as set forth in Sequence ID NO: 5 to be used as positive control for use in detection of Mouse Hepatitis Virus in a biological sample.
The conserved gene region used in the present invention is capsid gene region of length 220 bp. Capsid gene region is used as target region for detection because it is essential protein to enclose the genetic material of the virus, and certain stretches of its sequence are conserved to serve this functionality. Since, the complete genome sequence of Mouse Hepatitis Virusis not available; based on bioinformatics analysis of the available sequence on public databases, capsid gene is selected.
In an aspect of the present disclosure, method of detecting Mouse Hepatitis Virus in biological samples using LAMP assay is provided. Loop mediated isothermal amplification (LAMP) is a nucleic acid amplification technique which uses a single temperature incubation and thereby abstaining the need for expensive thermal cyclers. LAMP is a single tube technique for the amplification of RNA/DNA. The single tube assay carried out in the present invention is simpler and faster than multistep processes and it also eliminates false positives which may arise due to contamination from previous reactions. LAMP can be combined with a reverse transcription step to allow the detection of RNA. The sample from the animal is incubated with the kit components. Detection of amplification product is done either by photometry for turbidity which is produced by increased quantity of magnesium pyrophosphate in the reaction mixture/solution or visually by a simple colour reaction using SYBR green dye without any equipment. Assay is done using the primer sets of Sequence ID NO: 1, Sequence ID NO: 2, Sequence ID NO: 3, Sequence ID NO: 4 and Sequence ID NO: 5 by following steps comprising: a ) isolating RNA from the biological sample; a) adding RNA samples to a reaction tube; b) adding a pre-mixed LAMP solution to the tube containing RNA creating a reaction mixture, wherein said pre-mixed LAMP solution comprising: reverse transcriptase mix, one or more sets of LAMP primers and Bst DNA polymerase; c) incubating said reaction mixture for a period of time; and d) detecting presence of said at least one amplicon by visually observing colour change or turbidity change.
The RNA extracted from the biological sample using available conventional methods is used as test sample. The biological sample comprises but is not limited to one or more of whole blood, plasma, serum, lymph, urine, saliva, tears, nasopharyngeal secretions and tissue extracts from lymph nodes, spleen, and lung. The RNA extraction is done manually using methods comprising phenol/chloroform extraction, a solid phase method silica spin-column absorption, and isopycnic gradient centrifugation or using commercially available RNA extraction kits, including Roche column extraction kit.
The positive control for the detection of Mouse Hepatitis Virus (MHV) is prepared by cloning synthetic gene into a plasmid.
In an aspect of the present disclosure, a detection kit is developed comprisingprimer set according of present invention; Bst polymerase mix; reverse transcriptase mix; and an instruction manual. A rapid detection kit using LAMP technique is developed for the detection of Mouse hepatitis virus (MHV). RNA sample from the animal is incubated with the kit components and detected by photometry for turbidity or visually by a simple colour reaction using SYBR green dye without any equipment.
The DNA polymerase that may be used in a reaction is a polymerasederived from a thermophilic microorganism, in particular, a polymerase lacking a 5'-> 3' exonuclease function. Non-limiting examples of the DNA polymerase include the Bacillus stearothermophilus (Bst) DNA polymerase, the Thermus, thermophilus (Tth) DNA polymerase, the Thermus aquaticus (Taq)DNA polymerase, the Thermococcus litoralis DNA polymerase, the Pyrococcusfuriosus (Pfu) DNA polymerase, and the Bacillus caldotenax DNA polymerase.
Non-limiting examples of reverse transcriptases that may be used in a reaction include the moloney murine leukemia virus (MMLV) reverse transcriptase and the avian myeloblastosis virus (AMV) reverse transcriptase.
This LAMP kit has the potential to be used as a simple screening assay in the laboratory animal facility or at the point of care by clinicians. In order to improve quality of the experimental animals used this rapid and economical detection kit will be highly useful.
Experimental
Example 1. RNA isolation from the biological sample
RNA is extracted from rat tissue using trizol method and Roche column-based extraction method, according to manufactures protocol.60 ng/µl -350 ng/µl of the test RNA with purity range of 260/280 of 1.10 to 1.96 is used for conducting experiments.
Example 2. Primer design and synthesis
A set of four primers comprising two outer and two inner primers that recognize distinct regions spanning over 220bp conservedCapsid regionof the Mouse hepatitisviruscorresponding to the genome position was designed usingPrimer Explorer software of Eiken Chemicals (https://primerexplorer.jp/e/). The two outer primers were designated as Forward Outer (F3) (Sequence ID NO: 1), Backward Outer (B3) (Sequence ID NO: 2) Forward loop primer (FIP) (Sequence ID NO: 3) and Backward loop primer (BIP) (Sequence ID NO: 4).
Outer Primers
Sequence ID NO: 1
F3
5’GGACTCCAAACAAGCAGTG3’
Sequence ID NO: 2
B3
5’TTTGGTGGGTTCATCAGC3’
Loop Primers
Sequence ID NO: 3
FIP
5’TCCAAGTTTTAACATTTCAGAGCCTGGGAGCAGTGTTTTGGAAAGAGAG3’
Sequence ID NO: 4
BIP
5’CCATTCTTGCAGAGTTGGCTGGGCCAGAATTCTTTTTTGACCAATT3’
Suitably purified primers are obtained from a commercial source. The primers are reconstituted and diluted to the final concentration of 10. Suitably purified primers are obtained from a commercial source (Eurofins). The primers are reconstituted and diluted to the final concentration of 10 pmole. The outer primers and inner primers are mixed in the ratio 1:2 to prepare respective primer mixes.
Table 1: Primer details
Sequence ID Type of Primer
(outer/inner/loop) Sequence name Sequence details
1 Outer F3 5’GGACTCCAAACAAGCAGTG3’
2 Outer B3 5’TTTGGTGGGTTCATCAGC3’
3 Inner FIP 5’TCCAAGTTTTAACATTTCAGAGCCTGGGAGCAGTGTTTTGGAAAGAGAG3’
4 Inner BIP 5’CCATTCTTGCAGAGTTGGCTGGGCCAGAATTCTTTTTTGACCAATT3’
Example 3. Designing of synthetic gene
A synthetic gene is constructed constituting the specified lengths as mentioned in the primer designing and synthesis and cloned in single plasmid pT-NOT. This plasmid is used as control for detection of MHV.The sequence of synthetic gene corresponding to conserved region of capsid of length 220bp is given below.
Sequence ID NO: 5
ttataagagtgattggcgtccgtacgtacctctcaactctaaaactcttgtagtttaaatctaatctaaa ctttataaacggcacttcctgcgtgtccatgcccgcgggcctggtcttgtcatagtgctgacatttgtgg ttccttgactttcgttctctgccagtgacgtgtccattcggcgccaggagcccacccataggttgcataatggcaaaga
The amplified and purified plasmid of concentration 35 ng/µl and purity range of 260/280 of 1.9 is used as positive control.
Example 4. Assay Kit Preparation for detection of Mouse hepatitis virus
The kit components include RT mix, Bst Mix, primer mix, molecular biology grade water and positive control DNA. Each reaction uses 15 µL of Bst Mix, 1 µL of primer mix, 5 µL of molecular biology grade water and 4 µL of positive control DNA. Accordingly, appropriate volumes of vials for each component can be customised according to number of reactions for which the kit is to be used. The kit should be stored at 4ºC.Storage at –20ºC may extend shelf life.
Table 2: Bst mix composition
Bst enzyme (8 units) 1.0 micro litre
Buffer (10 x) 2.5 micro litre
dNTPS 10mM 1.0 micro litre
Table 3: RT mix composition
RT enzyme 100 units 0.5 micro litre
RT buffer 2.5 micro litre
Table 4 : Components per reaction
Components Volume in µL
RT Mix 4.0
BstMix 15.0
Respective primer mix 1.0
Plasmid contain gene 5.0
Total Volume 25.0
The primer mix is provided according to the details provided below:
Stock concentration Working concentration
Outer primers 100 pico mol 10 pico mol
Loop primers 200 pico mol 20 pico mol
Example 5. Setting up LAMP Reaction
The kit components from the box are removed and placed on ice or at -20°C in mini cooler. The components (except enzymes) are thawed and the contents are spun down.A LAMP mix is prepared in separate tubes for positive and negative controls. A standard LAMP reaction is setup using 15 µL of Bst polymerase mix, 1 µL of respective primer mix, 4 µL of RT mix and 5 µL of extracted RNA/Positive Control/MBGW. This mixture is incubated at 420C for 30 min and 630C for 60 min. After incubation, working SYBR dye of concentration(1: 10,000) is prepared and 1 µL of SYBR dye is added to the reaction tubes. Finally, results are visualized directly or analysed under UV at 254 nm wavelength. Schematic representation of standard procedure in LAMP assay is given in Figure 1; wherein(1) samples are collected;(2) RNA is extracted from the collected sample; (3) amplification of the RNA is done for easy detection, firstly by (3a) preparation of master mix; (3b) addition ofRNA samples and then;(3c) LAMP amplification is carried out thus giving required (3d) colour change which can be easily observed; (4) Detection is done visually or by colorimetry.
A LAMP reaction is setup using 15 µL of Bst polymerase mix, 1 µL of primer mix, 4 µL of RT mix and 5 µL of template. This mixture is incubated at 420C for 30 min and 630C for 60 min. After incubation working SYBR dye is prepared and 1 µL of SYBR dye is added to the reaction tubes.Finally, results are visualized directly or analysed under UV at 254 nm.
A schematic diagram of LAMP assay is given in Figure 2 wherein (a) Template RNA is prepared from the sample; (b) Primer mix, RT mix, Bst mix and MBGW is taken out from the kit; (c) Reaction mixture is prepared at 4°C placing all the reagents on ice bath; (d) Thermocycler or a dry bath is used to incubate the mixture at 63°C for 60 minutes; (e) Working SYBR solution of concentration 0.75 X is prepared by adding Tris EDTA buffer into SYBR vial; (f) Visual observation of colour change in the vial or at 254 nm wherein fluorescent orange colour represent a negative result and fluorescent green colour represent a positive result.
Example 5. Interpretation of LAMP assay
A fluorescent green colour or orange colour appears in the tube as given in Figure 1 and Figure 2.Fluorescent green colour indicates positive reaction or presence of Mouse hepatitis virus and orange colour indicates negative reaction or absence of Mouse hepatitis virus. The positive control and test sample is compared against a negative control tube without presence of nucleic acid. The LAMP assay specifically amplifies the RNA of MHV
Example 6. Sensitivity and specificity of LAMP assay using the Kit
To establish the detection limit of the LAMP assay, serial dilutions of plasmid that is quantified by measuring the optical density at 260 nm are tested and compared with the results for a real-time PCR assay. Assay was done at 65 °C for 2 min. FAM channel reading was done after every two minutes. The detection for 60-minute reaction is done using ESE Quant LAMP machine as well as in electrophoresis analysis (Supporting Figures: Gel picture please provide). The reaction is also observed by the naked eye as SYBR green dye is used (Figure 3).
From the figure, the limit of detection is 6.25 copies/ul. Positivity at further dilutions is not 100%, or the colour is faint. However, the detection limit for the LAMP reaction is found to be 20 copies for a 60-minute reaction in ESE Quant LAMP machine as well as in electrophoresis analysis using the kit of present invention.
RNA isolated from MHV positive animals is used as template for LAMP set up and also cDNA synthesis by outer reverse primer and PCR using two LAMPouter primers. LAMP positive samples are also positive with two rounds of PCR employing LAMP outer primers. PCR amplified products are gel eluted (Figure 4) and sent for sequencing. The sequence of amplified product is confirmed by Basic Local Alignment Search Tool to be the target gene thus confirming the accuracy of LAMP reaction.
Example 7. Validation of assay LAMP kit for detection of Sendai Virus
ALAMP kit for Mouse Hepatitis Virus is prepared and validated using both clinically positive and clinically negative samples from the field.Itis also validated using positive control samples obtained from Central Institute for Experimental Animals, ICLAS Monitoring Centre, Japan. 3 batches with different batch sizes are checked for the consistent performance of the kit (figure 4 and figure 5). 3 batches with different batch sizes are checked for the consistent performance of the kit (Table 1, Table 2 and Table 3).
Table 5: Batch 1
KIT MHV Batch 01 LAMP ELISA
Sample 1 Positive Positive
Sample 2 Negative Negative
Sample 3 Positive Positive
Sample 4 Positive Positive
Sample 5 Negative Negative
Sample 6 Positive Positive
Sample 7 Negative Negative
Sample 8 Positive Positive
Sample 9 Negative Negative
Sample 10 Positive Positive
Sample 11 Positive Positive
Sample 12 Negative Negative
Table 6:Batch 2
KIT MHV Batch 02 LAMP ELISA
Sample 1 Positive Positive
Sample 2 Negative Negative
Sample 3 Positive Positive
Sample 4 Negative Negative
Sample 5 Positive Positive
Sample 6 Positive Positive
Sample 7 Negative Negative
Sample 8 Positive Positive
Sample 9 Positive Positive
Sample 10 Negative Negative
Sample 11 Positive Positive
Sample 12 Negative Negative
Table 7: Batch 3
KIT MHV Batch 03 LAMP ELISA
Sample 1 Positive Positive
Sample 2 Negative Negative
Sample 3 Positive Positive
Sample 4 Positive Positive
Sample 5 Negative Negative
Sample 6 Positive Positive
Sample 7 Negative Negative
Sample 8 Positive Positive
Sample 9 Positive Positive
Sample 10 Negative Negative
Sample 11 Positive Positive
Sample 12 Positive Positive
The results suggest that the assays performed using the primers and the kit of present invention are in line with the expansive ELISA method.
This kit is found to be highly specific for MHV. A standard LAMP kit comprises Bst polymerase mix, respective primer mix, RT mix, extracted RNA/Positive Control and molecular biology grade water. The rapid detection kit using LAMP technique for the detection of MHVis economical and highly specific, which will be very helpful in systematic and scheduled laboratory testing, a most effective way to determine colony status and to prevent or detect influences on experiments.
,CLAIMS:WE CLAIM:
1. A primer set for detection of Mouse Hepatitis Virus in a biological sample; comprising outer primer sets and loop primer set; wherein the outer primer set comprising Sequence ID1, Sequence ID 2 or a sequence complementary thereof and the loop primer set comprising Sequence ID3, Sequence ID 4 or a sequence complementary thereof or a combination thereof.
2. A synthetic gene sequence comprising Sequence ID 5, a sequence complementary to Sequence ID 5, a plasmid containing sequence comprising Sequence ID 5 or a sequence complementary thereof as a positive control.
3. A method of detecting Mouse Hepatitis Virus in biological sample in a single reaction tube, said method comprising steps:
a. isolating RNA from biological sample and adding to a reaction tube adding RNA samples to a reaction tube;
b. adding a pre-mixed amplification solution to the tube containing RNA to obtain a reaction mixture, wherein said pre-mixed amplification solution comprises: reverse transcriptase mix, one or more sets of primers of claim 1 and DNA polymerase.
c. incubating said reaction mixture; and
d. detecting the presence of at least one amplicon by visually observing color change or turbidity change to identify the presence of Mouse Hepatitis virus.
4. The method according to claim 3 wherein the biological sample comprises one or more of whole blood, plasma, serum, lymph, urine, saliva, tears, nasopharyngeal secretions and tissue extracts from lymph nodes, spleen, and lung.
5. The method as claimed in claim 3 wherein the ratio of outer to loop primers is 1:2.
6. The method as claimed in claim 3 wherein DNA polymerase is Bst polymerase.
7. The method as claimed in claim 3 wherein incubation of the reaction mixture is carried out at a) 42°C for 30 minutes followed by b) at temperature range of 60°C to 63 °C for 50 minutes to 60 minutes.
8. The method as claimed in claim 3, wherein said detection of at least one amplicon is indicated by change in fluorescent emission wavelength of the said reaction mixture, by change in turbidity of the said reaction mixture or appearance of a ladder-like electrophoresis pattern during the process of agarose gel electrophoresis.
9. A composition for detection of Mouse Hepatitis Virus, comprising the primer set according to claim 1.
10. A kit for detection of Mouse Hepatitis Virusin a biological sample, comprising the primer set according to claims 1; Bst polymerase mix; reverse transcriptase mix; positive control according to claim 2 and an instruction manual.
| # | Name | Date |
|---|---|---|
| 1 | 201841039217-STATEMENT OF UNDERTAKING (FORM 3) [16-10-2018(online)].pdf | 2018-10-16 |
| 2 | 201841039217-SEQUENCE LISTING(PDF) [16-10-2018(online)].pdf | 2018-10-16 |
| 3 | 201841039217-SEQUENCE LISTING [16-10-2018(online)].txt | 2018-10-16 |
| 4 | 201841039217-PROVISIONAL SPECIFICATION [16-10-2018(online)].pdf | 2018-10-16 |
| 5 | 201841039217-FORM 1 [16-10-2018(online)].pdf | 2018-10-16 |
| 6 | 201841039217-DRAWINGS [16-10-2018(online)].pdf | 2018-10-16 |
| 7 | 201841039217-DECLARATION OF INVENTORSHIP (FORM 5) [16-10-2018(online)].pdf | 2018-10-16 |
| 8 | 201841039217-FORM-26 [17-11-2018(online)].pdf | 2018-11-17 |
| 9 | Correspondence by Agent_Power of Attorney_26-11-2018.pdf | 2018-11-26 |
| 10 | 201841039217-Proof of Right (MANDATORY) [03-01-2019(online)].pdf | 2019-01-03 |
| 11 | Correspondence by Agent_Proof of Right_08-01-2019.pdf | 2019-01-08 |
| 12 | 201841039217-SEQUENCE LISTING (.txt) [15-10-2019(online)].txt | 2019-10-15 |
| 13 | 201841039217-FORM 18 [15-10-2019(online)].pdf | 2019-10-15 |
| 14 | 201841039217-DRAWING [15-10-2019(online)].pdf | 2019-10-15 |
| 15 | 201841039217-CORRESPONDENCE-OTHERS [15-10-2019(online)].pdf | 2019-10-15 |
| 16 | 201841039217-COMPLETE SPECIFICATION [15-10-2019(online)].pdf | 2019-10-15 |
| 17 | 201841039217-FER.pdf | 2022-03-24 |
| 18 | 201841039217-OTHERS [22-09-2022(online)].pdf | 2022-09-22 |
| 19 | 201841039217-FER_SER_REPLY [22-09-2022(online)].pdf | 2022-09-22 |
| 20 | 201841039217-CORRESPONDENCE [22-09-2022(online)].pdf | 2022-09-22 |
| 21 | 201841039217-CLAIMS [22-09-2022(online)].pdf | 2022-09-22 |
| 22 | 201841039217-FORM-26 [28-09-2022(online)].pdf | 2022-09-28 |
| 23 | 201841039217-Correspondence_Power of Attorney_29-09-2022.pdf | 2022-09-29 |
| 24 | 201841039217-US(14)-HearingNotice-(HearingDate-22-08-2023).pdf | 2023-07-20 |
| 25 | 201841039217-US(14)-ExtendedHearingNotice-(HearingDate-13-09-2023).pdf | 2023-08-30 |
| 26 | 201841039217-Correspondence to notify the Controller [30-08-2023(online)].pdf | 2023-08-30 |
| 27 | 201841039217-Written submissions and relevant documents [21-09-2023(online)].pdf | 2023-09-21 |
| 28 | 201841039217-Annexure [21-09-2023(online)].pdf | 2023-09-21 |
| 29 | 201841039217-PatentCertificate25-09-2023.pdf | 2023-09-25 |
| 30 | 201841039217-IntimationOfGrant25-09-2023.pdf | 2023-09-25 |
| 1 | SearchHistoryE_23-03-2022.pdf |