DESC:TECHNICAL FIELD
The present invention is in relation to detection of pathogen infection in biological samples. More particularly, the present invention is in relation to detection of Mycoplasma pulmonis infection in mice. The invention discloses primer sequences corresponding to a conserved region of Mycoplasma pulmonis genome, allowing for the detection of Mycoplasma pulmonis in samples obtained from mice. The invention also provides a method and diagnostic kit for the detection, wherein the DNA extracted from biological sample is incubated with the kit components- Bst polymerase mix, primer mix, and molecular biology grade water, and the presence of the Mycoplasma pulmonis DNA is detected by photometry from for turbidity or visually by a simple colour reaction without use of any equipment.

BACKGROUND
It is well established that many rodent pathogens cause sub-clinical infections and significantly affect research. There are pathogen detection kits available to detect the presence of several pathogens, wherein kits are imported and expensive. In order to improve the quality and bring harmonization in the use of animals in research by educational institutions, pharmaceutical/biotechnology industries, and contract research organizations, animal health monitoring is absolutely necessary and highly relevant. In order to improve quality of the experimental animals used, a rapid and economical method of pathogen detection and related tool (kit) is the need of the hour. As such, sufficient and reliable information about animal health status has become even more important during the last decade with the rapid development and worldwide exchange of new genetically modified rodents, as well as the globalization of contract research. Unhealthy status could lead to irreproducible or repeated experiments, affecting the most important tenet of the use of these animals for research: reducing the numbers used to a minimum. Hence, standardisation of laboratory rodent health monitoring and detection of infection is pre-requisite in in-vivo studies. To assess the quality of animals used for scientific research, a proper health monitoring scheme is important to define the pathogen status of both individual animal and the population as a whole, detect infection as early as possible, and validate the efficiency of measures for the prevention of agent introduction. Systematic and scheduled laboratory testing is the most effective way to determine colony status and to prevent or detect influences on experiments.
Mycoplasma pulmonis is bacterium which lacks cell wall. It induces chronic pulmonary disease in laboratory mice, typically infecting the middle ear and nasopharynx of the rodent. Infection begins without any evident clinical signs, but as the disease progresses, snuffling, dyspnoea, weight loss, ruffled hair coat, hunched posture, reduced fertility and reluctance to move is observed in mice. As infection cannot be detected by physical examination especially in the initial stages, a routine detection of Mycoplasma pulmonis infection is to be carried out in the mice colony to keep a check on the infection. Sufficient and reliable information about animal health status has become even more important during the last decade with the rapid development and worldwide exchange of new genetically modified rodents, as well as the globalization of contract research. Unhealthy status could lead to irreproducible or repeated experiments, affecting the most important tenet of the use of these animals for research: reducing the numbers used to a minimum. To assess the quality of animals used for scientific research, a proper health monitoring scheme is important to define the pathogen status of both individual animal and the population as a whole, detect infection as early as possible, and validate the efficiency of measures for the prevention of agent introduction. Systematic and scheduled laboratory testing is the most effective way to determine colony status and to prevent or detect influences on experiments.
Detection of Mycoplasma pulmonis infection in mice is currently carried out by serological methods, cell culture and conventional PCR based technique. However, the conventional methods of detection of Mycoplasma pulmonis infection is time consuming, lack specificity, large sample required for the analysis and cross- contamination. Cassell et. al. in “Experimental Mycoplasma pulmonis infection in pathogen-free mice”; Am. J. Pathol. 1973; 72(1); p63–90, and Manabu Saito et.al.in “Strain difference of mouse in susceptibility to Mycoplasma pulmonis Infection”; Jap. J. Vet. Sci.,1978; Vol. 40; p697-705 describe Mycoplasma pulmonis infection in mice and detection by cell culturing and the pathological detection by Immuno fluorescence. It is a time-consuming method and there is high probability of cross contamination. It is not effective for a routine monitoring of the laboratory mice to keep a check on infections.
Nucleic acid amplification is an imperative molecular tool and is widely used in varied fields such as pharmaceuticals, forensics, pathogen detection, cloning, agriculture and the like. It is one of the most valuable tools virtually in all life science fields; including clinical medicine, in which detection of infectious diseases, genetic disorders and genetic traits is carried out.
Polymerase Chain Reaction (PCR) is the first nucleic acid amplification method. With the advancement of research, there have been several amplification methods invented, which include nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR) and Strand Displacement Amplification (SDA) apart from widely used polymerase chain reaction (PCR) based detection. To develop an economical and efficient amplification method is the need of the hour.
Patent document US4683202 discloses a process for amplifying specific nucleic acid sequence contained in a nucleic acid or mixture using PCR. PCR uses heat denaturation of double-stranded DNA to promote the next round of DNA synthesis. It involves multistep processes and it is expensive, hence it is not economical to have PCR based methods on a large scale.
3SR and NASBA eliminate heat denaturation by using a set of transcription and reverse transcription reactions to amplify the target sequence. Similarly, SDA eliminates the heat denaturation step in cycling DNA synthesis by employing a set of restriction enzyme digestions and strand displacement DNA synthesis with modified nucleotides as substrate. These methods can amplify target nucleic acids to a similar magnitude; all with detection limit of less than 10 copies and within an hour, but still have shortcomings. They require either a precision instrument for amplification or an elaborate method for detection of the amplified products due to poor specificity of target sequence selection. Despite the simplicity and the obtainable magnitude of amplification, the requirement for a high precision thermal cycler in PCR prevents this powerful method from being widely used, such as in private clinics as a routine pathogen detection tool.
On the other hand, NASBA and 3SR, which do not use thermal cycling, are compromised in specificity, resulting mainly from the necessity to use a relatively low temperature of 60-65°C for amplification. Patent GB2293238A discloses self-sustained sequence replication (3SR) for synthesising target nucleic acid sequence extra cellularly or within cells by replication and/or amplification and thereby extracting the amplified target sequence and carrying out gel electrophoresis followed by Southern or Northern blotting; and detecting the target sequence on the gel or blot. Thus, it requires an additional method due to poor specificity of target sequence selection.
SDA largely overcomes these shortcomings by using four primers and isothermal conditions for amplification, but still has limitation as increased backgrounds due to digestion of irrelevant DNA contained in the sample and the necessity to use expensive modified nucleotides as substrate. Although the use of multiple primers, such as in nested PCR and SDA, has improved amplification specificity for the target sequence, residual co-amplification of irrelevant sequences still causes a general setback in nucleic acid amplification, particularly for pathogen detection. Patent EP0628640 discloses a method for simultaneously amplifying two target nucleic acid sequences by Strand Displacement Amplification (SDA), as it uses multiple primers, hinders its usage in clinical detection.

SUMMARY OF INVENTION
The present invention provides a primer set to detect Mycoplasma pulmonis infection in mice, comprising primers from a) outer primer set comprising sequence ID 1, sequence ID 2 or a sequence complementary thereof and b) loop primer set comprising sequence ID 3, sequence. The present invention also provides a synthetic gene sequence comprising Sequence ID 5, a sequence complementary to Sequence ID 5, a plasmid containing sequence comprising Sequence ID 5 or a sequence complementary thereof as positive control. The present invention also provides an optimised method of detecting Mycoplasma pulmonis infection in mice in vitro. The method comprises steps of: i) providing sample taken from a subject requiring Mycoplasma pulmonis detection; ii) isolating nucleic acid from the sample; iii) providing any one primer set selected from primers comprising a) outer primer set comprising sequence ID 1, sequence ID 2 and a sequence complementary thereof and b) loop primer set comprising sequence ID 3, sequence ID 4 or a sequence complementary thereof and a DNA polymerase to a) the nucleic acid sample and b) positive control; iv) performing amplification reaction for a) the sample and the primer set; and b) positive control and the primer set; and v) comparing the results of the amplification reactions to identify presence of amplicon to determine the sample infected with Mycoplasma pulmonis. The present invention also provides a composition comprising primer set that comprises sequence ID 1, sequence ID 2, sequence ID 3 and sequence ID 4 for detecting Mycoplasma pulmonis. The present invention also provides a kit for detecting Mycoplasma pulmonis, comprising the primer set of sequence ID 1, sequence ID 2, sequence ID 3 and sequence ID 4, Bst Mix, molecular biology grade water, positive control and instruction manual.

BRIEF DESCRIPTION OF FIGURES
The features of the present invention can be understood in detail with the aid of appended figures. It is to be noted however, that the appended figures illustrate only typical embodiments of this invention and are therefore not to be considered limiting of its scope for the invention.
Figure 1: PCR verification of positive control.
Figure 2: Schematic representation of standard procedure of assay; (1) Sample (2) DNA extracted (3) Amplification (3a) Preparation of master mix (3b) Addition of DNA samples (3c) LAMP amplification (3d) Colour change observed (4) Detection
Figure 3: Schematic diagram of assay; (a) DNA from the sample, (b) primer mix, Bst mix and MBGW (c) Ice box (d) Incubation in Thermocycler (e) Working SYBR solution by adding TE buffer (f) Fluorescent orange colour (Negative) and Fluorescent green colour (positive)
Figure 4: Visual detection of LAMP assay for various dilutions of positive control utilizing SYBR dye to estimate limit and accuracy of detection using the Kit ion of LAMP assay for various dilutions utilizing SYBR dye to estimate limit and accuracy of detection using the Kit.
Figure 5: Shows visual detection of Mycoplasma pulmonis for the sample from field by assay using Kit. Sample 1, 2 and 3 are clinically positive, 4th microfuge tube has positive control and 5th microfuge tube has negative control.
Figure 6: shows gel pictures of PCR products (280bp) employing LAMP outer primers for clinically positive and clinically negative samples. Lane M is100 bp DNA ladder, Lane 1 and 2 are Positive sample, Lane 3 is Negative sample and Lane 4 is negative control.

SEQUENCE LISTING
Nucleic acid sequences listed herein or in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases. In at least some cases, only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
Sequence ID: 1-4 are nucleic acid sequences of exemplary Mycoplasma pulmonis detection primers.
Sequence ID: 5 is nucleic acid sequences of exemplary synthetic gene corresponding to conserved region of Mycoplasma pulmonis.

DETAILED DESCRIPTION OF INVENTION
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Lewin's Genes X, ed. Krebs et al., Jones and Bartlett Publishers, 2009 (ISBN 0763766321); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341); and George P. Rédei, Encyclopedic Dictionary of Genetics, Genomics, Proteomics and Informatics, 3rd Edition, Springer, 2008 (ISBN: 1402067534).
The following explanations of terms and methods are provided to better describe the present disclosure and to guide those of ordinary skill in the art to practice the present disclosure. The singular forms "a," "an," and "the" refer to one or more than one, unless the context clearly dictates otherwise. For example, the term "comprising a nucleic acid molecule" includes single or plural nucleic acid molecules and is considered equivalent to the phrase "comprising at least one nucleic acid molecule." As used herein, "comprises" means "includes." Thus, "comprising A or B," means "including A, B, or A and B," without excluding additional elements.
Although methods and materials similar or equivalent to those described herein can be used to practice or test the disclosed technology, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting. The embodiments herein and the various features of the proposed system are explained more fully with reference to the non-limiting embodiments that are illustrated in the accompanying drawings and detailed in the following description. The illustrations used herein are intended to merely facilitate an understanding of ways in which the embodiments herein may be prescribed and further to enable those skilled in the art to practice the embodiment herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein.
One aspect of invention is a primer set to detect Mycoplasma pulmonis infection in mice, comprising primers from a) outer primer set comprising sequence ID 1, sequence ID 2 or a sequence complementary thereof and b) loop primer set comprising sequence ID 3, sequence ID 4 and a sequence complementary thereof.
For the synthesis of primers, nucleic acid synthesizer selected from different manufactures may be used and different type of products may be commissioned by related genetic companies. Loop mediated isothermal amplification (LAMP) is a nucleic acid amplification technique which uses a single temperature incubation and thereby abstaining the need for expensive thermal cyclers.
Another aspect of the invention a synthetic gene sequence comprising Sequence ID 5, a sequence complementary to Sequence ID 5, a plasmid containing sequence comprising Sequence ID 5 or a sequence complementary thereof as positive control. Based on bioinformatics analysis of the available sequence on public databases, p1 gene is selected.P1 gene is the main adhesin essential for adherence of Mycoplasma pulmonis to its host cell. By doing bioinformatics analysis, portions of this gene have been found to be conserved across various strains of the virus.
The synthetic gene is amplified using the primers and post confirmation by sequencing and BLAST, are cloned into a suitable high copy number plasmid and multiple copies of the plasmid is generated in a corresponding suitable host cell. This synthetic gene is used as a positive control for detection of said virus using Loop Mediated Isothermal Amplification (LAMP) assay.
LAMP is a single tube technique for the amplification of DNA. The single tube assay carried out in the present invention is simpler and faster than multistep processes and it also eliminates false positives which may arise due to contamination from previous reactions.
Another aspect of the invention is an optimised method of detecting Mycoplasma pulmonis infection in mice in vitro. The method comprises steps of: i) providing sample taken from a subject requiring Mycoplasma pulmonis detection; ii) isolating nucleic acid from the sample; iii) providing any one primer set selected from primers comprising a) outer primer set comprising sequence ID 1, sequence ID 2 and a sequence complementary thereof and b) loop primer set comprising sequence ID 3, sequence ID 4 or a sequence complementary thereof and a DNA polymerase to a) the nucleic acid sample and b) positive control; iv) performing amplification reaction for a) the sample and the primer set; and b) positive control and the primer set; and v) comparing the results of the amplification reactions to identify presence of amplicon to determine the sample infected with Mycoplasma pulmonis.
The DNA extracted from the biological sample using available conventional methods is used as test sample.
In one embodiment of the present invention the biological sample comprises but is not limited to one or more of whole blood, plasma, serum, lymph, urine, saliva, tears, nasopharyngeal secretions and tissue extracts from lymph nodes, spleen, and lung. The DNA extraction method comprises but is not limited to trizol extraction, phenol/chloroform extraction, phenol/chloroform plus CTAB extraction, and commercially available DNA extraction kits, including Roche column extraction kit.
The DNA polymerase that may be used in a reaction is a polymerase derived from a thermophilic microorganism, in particular, a polymerase lacking a 5'-> 3' exonuclease function. Non-limiting examples of the DNA polymerase include the Bacillus stearothermophilus (Bst) DNA polymerase, the Thermus, thermophilus (Tth) DNA polymerase, the Thermusaquaticus (Taq) DNA polymerase, the Thermococcus litoralis DNA polymerase, the Pyrococcusfuriosus (Pfu) DNA polymerase, and the Bacillus caldotenax DNA polymerase. For exemplary purpose Bst polymerase has been used in this invention.
In another embodiment of present invention, the DNA polymerase is Bst Polymerase.
Any commercially available DNA Polymerases can be used for the amplification using the primers of present invention. To obtain the optimum results are obtained by using Bst polymerase, the in house produced Bst Mix is used in the present invention. Bst Mix is a ready-to-use cocktail containing all components, except primers and template, for the amplification and detection of DNA using LAMP reaction.
In another embodiment of present invention, the ratio of outer to loop primers is 1:2.
In yet another embodiment of present invention, amplification is performed by incubation at temperature range of 60°C to 63 °C for 50 minutes to 60 minutes.
In yet another embodiment of present invention, comparison of results of the LAMP reaction is performed by measuring one or more of colour change or turbidity.
In yet another embodiment of present invention, the identification of presence of amplicon is by observing change in fluorescent emission wavelength of the reaction mixture, by change in turbidity of the reaction mixture or appearance of a ladder-like electrophoresis pattern during the process of agarose gel electrophoresis.
Another aspect of the invention is a composition comprising primer set that comprises sequence ID 1, sequence ID 2, sequence ID 3 and sequence ID 4 for detecting Mycoplasma pulmonis.
Another aspect of the invention is a kit for detecting Mycoplasma pulmonis, comprising the primer set of sequence ID 1, sequence ID 2, sequence ID 3 and sequence ID 4, Bst Mix, molecular biology grade water, positive control and instruction manual.

A diagnostic kit using LAMP technique is developed for the detection of Mycoplasma pulmonis infection in mice. The DNA sample from the animal is incubated with the kit components. Detection of amplification product is done by either by photometry for turbidity which is produced by increased quantity of Magnesium pyrophosphate in the reaction mixture/solution or visually by a simple colour reaction using SYBR green dye without any equipment. The LAMP kit has the potential to be used as a simple screening assay in the laboratory animal facility or at the point of care by clinicians. Highly specific primers for the amplification of Mycoplasma pulmonis P1 gene of length 280bp is used in this invention.

Experimental
Example 1. Isolation of DNA
DNA is isolated from the mice tissues especially from lung for Mycoplasma pulmonis using Trizol method and Roche column-based extraction method, according to manufactures protocol.60 ng/µl -350 ng/µl of the test nucleic acid with purity range of 260/280 of 1.10 to 1.96 is used for conducting experiments.
Example 2. Primer designing and synthesis
For Mycoplasma pulmonis, P1 gene is selected as the identifier gene. Primers for the said gene are designed using Primer Explorer software of Eiken Chemicals (https://primerexplorer.jp/e/). The primers are described below:
Outer Primers:
F3 -Sequence ID 1-
5’ ACCTTCTTTAACTCATCAAAGC 3’
B3 - Sequence ID 2- 5’ CGATGTTTGGTCCTTCAGG 3’

Loop Primers:
FIP-Sequence ID 3- 5’GGCCCTAGAGAAGTAATTTTTCTCTGGGAGTTTATGGATCAAACAAATCCTC 3’
BIP-Sequence ID 4-
5’AGATACAGCTCAATTTGAAGTTCGTGGGTTTCAATTGGGCAAATTCTTCC3’

Table 1: Primer description
Sequence ID Type of Primer
Sequence name Sequence details
1 Outer F3 5’ ACCTTCTTTAACTCATCAAAGC 3’
2 Outer B3 5’ CGATGTTTGGTCCTTCAGG 3’
3 Loop FIP 5’GGCCCTAGAGAAGTAATTTTTCTCTGGGAGTTTATGGATCAAACAAATCCTC 3’
4 Loop BIP 5’AGATACAGCTCAATTTGAAGTTCGTGGGTTTCAATTGGGCAAATTCTTCC3’

Suitably purified primers are obtained from a commercial source (Eurofins). The primers are reconstituted and diluted to the final concentration of 10 pmole. The outer primers and loop primers are mixed in the ratio 1:2 to prepare respective primer mixes.
Example 3. Designing of synthetic gene
A synthetic gene is constructed constituting the specified lengths as mentioned in the primer designing and synthesis in example 2 and cloned in single high copy number plasmid pT-NOT Vector which is then amplified in E.coli Topp10 F` host strain. This plasmid is used as control for detection of Mycoplasma pulmonis. The sequence with sequence ID 5 is provided in the below box.

The amplified and purified plasmid of concentration 35 ng/µl and purity range of 260/280 of 1.9 is used as positive control. Figure 1 show PCR verification of positive control plasmid wherein amplification product of 280 bp corresponding to synthetic gene can be seen.
Example 4. Assay reaction kit preparation
The kit components include Bst Mix, primer mix, molecular biology grade water and positive control DNA. Each reaction uses 15 µL of Bst Mix, 1 µL of primer mix, 5 µL of molecular biology grade water and 4 µL of positive control DNA. Accordingly, appropriate volumes of vials for each component can be customised according to number of reactions for which the kit is to be used. The kit should be stored at 4ºC. Storage at –20ºC may extend shelf life.
The details of kit components, Bst composition and primer mix are provided in table 2, table 3 and table 4.
Table 2: Kit components
Components Volume in µL
Bst Mix 15.0
Respective primer mix 1.0
MBGW 4.0
Plasmid contain gene 5.0
Total Volume 25.0

Table 3: Bst mix composition
Bst enzyme (8 units) 1.0 micro litre
Buffer (10 x) 2.5 micro litre
dNTPS 10mM 1.0 micro litre

Table 4: Primer mix composition
Stock concentration Working concentration
Outer primers 100 picomol 10 picomol
Loop primers 200 picomol 20 picomol

Example 5. Assay for Mycoplasma pulmonis in vitro
The kit components from the box are removed and placed on ice or at -20°C in mini cooler. The components (except enzymes) are thawed and the contents are spun down (if necessary). A LAMP mix is prepared in separate tubes for positive and negative controls. A standard LAMP reaction is setup using 15 µL of Bst Mix, 1 µL of respective primer mix, 4 µL of molecular biology grade water (MBGW) and 5 µL of extracted DNA/Positive Control/MBGW. This mixture is incubated at 630C for 60 min. After incubation working SYBR dye of concentration 1:10000 is prepared and 1 µL of SYBR dye is added to the reaction tubes. Finally, results are analysed under UV at 254 nm. Schematic representation of standard procedure in LAMP assay is given in Figure 2; (1) samples are collected; (2) DNA is extracted from the collected sample; (3) Amplification of the DNA is done for easy detection, firstly by (3a) preparation of master mix; (3b) addition of DNA samples and then; (3c) LAMP amplification is carried out thus giving required (3d) colour change which can be easily observed; (4) Detection is done visually or by colorimetry.
A LAMP reaction is setup using 15 µL of Bst Mix, 1 µL of primer mix, 4 µL of molecular biology grade water (MBGW) and 5µL of Template. This mixture is incubated at 630C for 60 min. After incubation working SYBR dye is prepared and 1 µL of SYBR dye is added to the reaction tubes finally results are analysed under UV at 254 nm.
A Schematic diagram of LAMP assay is given in Figure 3wherein (a) Template DNA is prepared from the sample; (b) Primer mix, Bst mix and MBGW is taken out from the kit; (c) Reaction mixture is prepared at 4°C placing all the reagents on ice bath; (d) Thermocycler or a dry bath is used to incubate the mixture at 63°C for 60 minutes; (e) Working SYBR solution is prepared by adding TE buffer into SYBR vial and mixed well; (f) Visual observation of colour change in the vial or at 254 nm wherein Fluorescent orange colour represent a negative result and Fluorescent green colour represent a positive result.
Example 6. Interpretation of results of assay
A fluorescent green colour or orange colour appears in the tube as given in Figure 2& 3. Fluorescent green colour indicates positive reaction or presence of Mycoplasma pulmonis and Orange colour indicates negative reaction or absence of Mycoplasma pulmonis.
Example 7. Sensitivity and specificity of LAMP assay using the Kit
The LAMP assay specifically amplified the DNA of Mycoplasma pulmonis. To establish the detection of limit of the LAMP assay, serial dilutions of plasmid that had been quantified by measuring the optical density at 260 nm are tested and compared with the results for a real-time PCR assay done in-house. Assay for dilutions up to 2X101 is done in duplicates and for lower dilutions is performed in triplicates (Figure 4). The results of detection are compared with the results for a real-time PCR assay done in-house.
From the figure 4, the limit of detection is 6.25 copies/ul. Positivity at further dilutions is not 100%, or the colour is faint. However, the detection limit for the LAMP reaction is found to be 20 copies for a 60-minute reaction in ESE Quant LAMP machine as well as in electrophoresis analysis using the kit of present invention.
DNA is isolated from Mycoplasma pulmonis positive animal is used as template for LAMP set up and also PCR using lamp outer primers (Figure 5 and 6).
LAMP positive samples are also positive with two rounds of PCR employing LAMP out primers. PCR Amplified products are gel eluted (Figure 6) and sent for sequencing. The sequence of amplified nucleic acid fragment when aligned using basic Sequence Alignment Search Tool confirms the target gene thus confirming the accuracy of LAMP reaction. The gel eluted PCR product is given in Figure 6.
Example 8. Validation of assay LAMP kit for detection of Mycoplasma pulmonis
LAMP kit for Mycoplasma pulmonis is validated using both clinically positive and clinically negative samples from the field. It is also validated using positive control samples obtained from Central Institute for Experimental Animals, ICLAS Monitoring Centre, Japan. This kit is specific for Mycoplasma pulmonis (Figure 5 & Figure 6).3 batches with different batch sizes obtained from different animals are checked for the consistent performance of the kit (Table 5, Table 6 and Table 7).
Table 5: Batch 1
KIT Myco Batch01 LAMP ELISA
Sample 1 Positive Positive
Sample 2 Negative Negative
Sample 3 Positive Positive
Sample 4 Negative Negative
Sample 5 Negative Negative
Sample 6 Positive Positive
Sample 7 Negative Negative
Sample 8 Positive Positive
Sample 9 Negative Negative
Sample 10 Negative Negative
Sample 11 Positive Positive
Sample 12 Negative Negative

Table 6: Batch 2
KIT Myco Batch02 LAMP ELISA
Sample 1 Positive Positive
Sample 2 Negative Negative
Sample 3 Positive Positive
Sample 4 Negative Negative
Sample 5 Negative Negative
Sample 6 Positive Positive
Sample 7 Negative Negative
Sample 8 Positive Positive
Sample 9 Positive Positive
Sample 10 Negative Negative
Sample 11 Positive Positive
Sample 12 Negative Negative
Table 7: Batch 3
KIT Myco Batch03 LAMP ELISA
Sample 1 Positive Positive
Sample 2 Negative Negative
Sample 3 Positive Positive
Sample 4 Negative Negative
Sample 5 Negative Negative
Sample 6 Positive Positive
Sample 7 Negative Negative
Sample 8 Positive Positive
Sample 9 Negative Negative
Sample 10 Negative Negative
Sample 11 Positive Positive
Sample 12 Positive Positive
The results suggest that the assays performed using the primers and the kit of present invention are in line with the expansive ELISA method.
A single tube technique for the amplification of DNA, single temperature incubation and specific primers for the amplification of Mycoplasma pulmonis in the present invention makes the whole process highly efficient and economical. The present invention can be useful in in-vivo studies and standardisation of laboratory rodent health monitoring and detection of infection with high precision and cost-effectively.
,CLAIMS:WE CLAIM:
1. A primer set to detect Mycoplasma pulmonis infection in mice, comprising primers from a) outer primer set comprising sequence ID 1, sequence ID 2 or a sequence complementary thereof and b) loop primer set comprising sequence ID 3, sequence ID 4 and a sequence complementary thereof.
2. A synthetic gene sequence comprising Sequence ID 5, a sequence complementary to Sequence ID 5, a plasmid containing sequence comprising Sequence ID 5 or a sequence complementary thereof as positive control.
3. A method of detecting Mycoplasma pulmonis infection in mice in vitro, said method comprising steps of:
i) providing sample taken from a subject requiring Mycoplasma pulmonis detection;
ii) isolating nucleic acid from the sample;
iii) providing any one primer set selected from primers comprising a) outer primer set comprising sequence ID 1, sequence ID 2 and a sequence complementary thereof and b) loop primer set comprising sequence ID 3,sequence ID 4 or a sequence complementary thereof and a DNA polymerase to a) the nucleic acid sample and b) positive control;
iv) performing amplification reaction for a) the sample and the primer set; and b) positive control and the primer set; and
v) comparing the results of the amplification reactions to identify presence of amplicon to determine the sample infected with Mycoplasma pulmonis.
4. The method as claimed in claim 3,wherein the samples are one or more of whole blood, plasma, serum, lymph, urine, saliva, tears, ornasopharyngeal secretions.
5. The method as claimed in claim 3 wherein the ratio of outer to loop primers is 1:2.
6. The method as claimed in claim 3,wherein amplification is performed by incubation at temperature range of 60°C to 63 °C for 50 minutes to 60 minutes.
7. The method as claimed in claim 3, wherein comparison of results of the LAMP reaction is performed by measuring one or more of color change or turbidity.
8. The method as claimed in claim 3, wherein the DNA polymerase is Bst Polymerase.
9. The method as claimed in claim 3,wherein the identification of presence of amplicon is by observing change in fluorescent emission wavelength of the reaction mixture, by change in turbidity of the reaction mixture or appearance of a ladder-like electrophoresis pattern during the process of agarose gel electrophoresis.
10. A composition for detecting Mycoplasma pulmonis, comprising the primer set according to claim 1.
11. A kit for detecting Mycoplasma pulmonis, comprising the primer set according to claim 1, Bst Mix, molecular biology grade water, positive control is according to claim 2 and instruction manual.