DESC:TECHNICAL FIELD
The present invention is in relation to detection of pathogen infection in biological samples. More particularly, the present invention is in relation to detection of Sendai virus in rats. The invention discloses primer sequences corresponding to a conserved region of Sendai virus genome, allowing for the detection of Sendai virus in samples obtained from rats. The invention also provides method and a diagnostic kit for the detection, wherein the ribonucleic acid (RNA) extracted from biological sample from the animal is incubated with the kit components, reverse transcriptase mix, Bst polymerase mix, primer mix, and molecular biology grade water, and the presence of the RNA is detected by photometry for turbidity or visually by a simple colour reaction without any equipment.

BACKGROUND
It is well established that many rodent pathogens cause sub-clinical infections and significantly affect research. There are detection kits available to detect the presence of several pathogens, wherein kits are expensive. In order to improve the quality and bring harmonization in the use of animals in research, by educational institutions, pharmaceutical/biotechnology industries, and contract research organizations; animal health monitoring is absolutely necessary and highly relevant. In order to improve quality of the experimental animals used, a rapid and economical method of pathogen detection and related tool (kit) is the need of the hour. As such, sufficient and reliable information about animal health status has become even more important during the last decade with the rapid development and worldwide exchange of new genetically modified rodents, as well as the globalization of contract research. Unhealthy status could lead to irreproducible or repeated experiments, affecting the most important tenet of the use of these animals for research: reducing the numbers used to a minimum. Hence, standardisation of laboratory rodent health monitoring and detection of infection is a pre-requisite forin-vivo studies. To assess the quality of animals used for scientific research, a proper health monitoring scheme is important to define the pathogen status of both individual animal and the population as a whole, detect infection as early as possible, and validate the efficiency of measures for the prevention of agent introduction. Systematic and scheduled laboratory testing is the most effective way to determine the health status of the animal colony and to prevent or detect influences on experiments.
Sendai virus is a single-stranded RNA virus which infects laboratory rodents by causing respiratory diseases especially in rats. It also affects the immune system of the rodents thus making it susceptible to various other pathogenic infection. It affects the growth and development of young rats and reduced reproductive rate of adult rat. It is highly contagious disease and can quickly affect other healthy rats in the colony. Sufficient and reliable information about animal health status has become even more important during the last decade with the rapid development and worldwide exchange of new genetically modified rodents, as well as the globalization of contract research. Unhealthy status could lead to irreproducible or repeated experiments, affecting the most important tenet of the use of these animals for research: reducing the numbers used to a minimum. To assess the quality of animals used for scientific research, a proper health monitoring scheme is important to define the pathogen status of both individual animal and the population as a whole, detect infection as early as possible, and validate the efficiency of measures for the prevention of agent introduction. Systematic and scheduled laboratory testing is the most effective way to determine colony status and to prevent or detect influences on experiments.
There are various studies on Sendai viral infection in rodents.Piedimonteet.al.in “Sendai virus infection potentiates neurogenic inflammation in the rat trachea” J.Appl. Physiol. 1990 68(2); p754-760 discloses a study to determine Sendai virus infection potentiates neurogenic inflammatory responses in the trachea. Parker et.al.in “Natural history of Sendai virus infection in mice” J. Epidemiol.1968 Jul; 88(1); p112-125 describes the sampling from lungs and saliva of the rodents for the detection of Sendai Virus.
Currently, the detection of Sendai virus infection in rats are done by various methods including serological tests, tissue culture and Nucleic acid amplification. Whereas, the commonly followed serological test lack specificity, the stability and quality of the antigen used in serological testing are the challenges faced in serological tests.
Polymerase Chain Reaction (PCR) is the first nucleic acid amplification method. With the advancement of research, there have been several amplification methods invented, which include nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR) and Strand Displacement Amplification (SDA) apart from the widely used conventional polymerase chain reaction (PCR) based detection. To develop an economical and efficient amplification method is the need of the hour.
PCR uses heat denaturation of double-stranded DNA to promote the next round of DNA synthesis. It involves multistep processes and it is expensive, hence it is not economical to have PCR based methods on a largescale.
3SR and NASBA eliminate heat denaturation by using a set of transcription and reverse transcription reactions to amplify the target sequence. Similarly, SDA eliminates the heat denaturation step in cycling DNA synthesis by employing a set of restriction enzyme digestions and strand displacement DNA synthesis with modified nucleotides as substrate. These methods can amplify target nucleic acids to a similar magnitude; all with detection limit of less than 10 copies and within an hour, but still have shortcomings. They require either a precision instrument for amplification or an elaborate method for detection of the amplified products due to poor specificity of target sequence selection. Despite the simplicity and the obtainable magnitude of amplification, the requirement for a high precision thermal cycler in PCR prevents this powerful method from being widely used, such as in private clinics as a routine pathogen detection tool.
On the other hand, NASBA and 3SR, which do not use thermal cycling, are compromised in specificity, resulting mainly from the necessity to use a relatively low temperature of 60-65°C for amplification. Patent GB2293238A discloses self-sustained sequence replication (3SR) for synthesising target nucleic acid sequence extracellularly or within cells by replication and/or amplification and thereby extracting the amplified target sequence and carrying out gel electrophoresis followed by Southern or Northern blotting; and detecting the target sequence on the gel or blot. Thus, it requires an additional method due to poor specificity of target sequence selection.
SDA largely overcomes these shortcomings by using four primers and isothermal conditions for amplification, but still has limitation as increased backgrounds due to digestion of irrelevant DNA contained in the sample and the necessity to use expensive modified nucleotides as substrate. Although the use of multiple primers, such as in nested PCR and SDA, has improved amplification specificity for the target sequence, residual co-amplification of irrelevant sequences still causes a general setback in nucleic acid amplification, particularly for pathogen detection. Patent EP0628640 discloses a method for simultaneously amplifying two target nucleic acid sequences by Strand Displacement Amplification (SDA), as it uses multiple primers, hinders its usage in clinical detection.
Cho-Hua Wanet.al.in“Expression of Sendai Virus Nucleocapsid Protein in a Baculovirus Expression System and Application to Diagnostic Assays for Sendai Virus Infection” in J.Clin. Microbiol. Aug. 1995, p. 2007–2011discloses a method for detection wherein the recombinant complementary DNA is synthesized by reverse transcription PCR from Sendai virus RNA with primers from the 5 and 3 termini of the NP-coding region. Ampli?ed DNA is cloned into a baculovirus transfer vector and is co-transfected with wild-type baculovirus into insect cells. Baculovirus recombinants containing the NP gene are identi?ed by PCR. It is a long, tedious and expensive process, it is not applicable for routine analysis and examination of laboratory rodents for Sendai virus infection.
In JP2010254600A, discloses a method wherein Sendai virus-originated polypeptide for an anti-Sendai virus antibody produced by a rat infected by the Sendai virus is a cumbersome method involving many expensive reagents which is not economically feasible.
In CN101928784A, a real-time fluorescent quantitative PCR detection method for Sendai virus comprising, constructing the standard plasmid, designing a specific primer and a fluorescent probe, carrying out real-time fluorescent quantitative PCR amplification, establishing a detection standard curve, extracting the RNA of an infected virus sample, preparing cDNA, verifying the effectiveness and determining the result. It is highly not possible to carry out this method for the detection of infection on a regular basis to keep the check on Sendai virus infection as it not economical and easy.
Effective monitoring is very important as Sendai viral infections in rats can spread quickly thus early detection by clinical observation, appropriate sampling, and sensitive and specific diagnostic testing is the need of the hour.

SUMMARY OF INVENTION
The invention provides a primer set for detection and identification of Sendai Virus, primer set comprising of a) SEQUENCE ID:1, SEQUENCE ID:2 or a sequence complementary thereof corresponding to one pair of forward (F3) and reverse (B3) outer primers and; b) SEQUENCE ID:3, SEQUENCE ID:4 or a sequence complementary thereof corresponding to one pair of forward (FIP) and reverse (BIP) loop primers. The invention also provides a synthetic gene sequence comprising SEQUENCE ID 5 or a sequence complementary thereof as a positive control. The invention also provides method of for detection and identification of Sendai Virus, the method comprising the steps of:
a) obtaining a test biological sample;
b) extracting test RNA from the sample;
c) reverse transcribing the obtained test RNA into test DNA using reverse transcriptase;
d) amplifying the test DNA and synthetic gene of sequence ID 5 as a positive control to atleast one amplicon using at least one LAMP primer set chosen from sequence IDs 1 to 4 for amplification of nucleic acid; and
e) comparing outcome of amplification of test DNA with the positive control to detect atleast one amplicon of nucleic acid, thereby detecting presence of Sendai Virus nucleic acid in the test biological sample.
The invention also provides a composition comprising primer of present invention for detecting and identifying Sendai virus. The invention also provides kit for detecting and identifying Sendai virus in a biological sample, comprising primer set of sequence ID 1, sequence ID 2, sequence ID 3 and sequence ID 4; Bst polymerase mix; reverse transcriptase mix; molecular biology grade water, a positive control of sequence ID 5 and an instruction manual.
BRIEF DESCRIPTION OF FIGURES
The features of the present invention can be understood in detail with the aid of appended figures. It is to be noted however, that the appended figures illustrate only typical embodiments of this invention and are therefore not to be considered limiting of its scope for the invention.
Figure 1: Schematic representation of standard procedure in LAMP assay; (1) Sample (2) RNA extracted (3) Amplification (3a) Preparation of master mix (3b) Addition of RNA samples (3c) LAMP amplification (3d) Colour Change observed (4) Detection.
Figure 2: Schematic diagram of LAMP assay; (a) RNA from the sample, (b) primer mix, RT mix, Bstpolymerase mix and MBGW (c) Ice box (d) Incubation inThermocycler (e) Working SYBR solution by adding TE buffer (f) Fluorescent orange colour (Negative) and Fluorescent green colour (positive).
Figure 3: Visual detectVisual detection of LAMP assay for various dilutions utilizing SYBR dye to estimate limit and accuracy of detection using the Kit ion of LAMP assay for various dilutions utilizing SYBR dye to estimate limit and accuracy of detection using the Kit.
Figure 4 shows visual detection of Sendai virus using a) Positive control and b)clinically negative samples from the field.
Figure 5: shows gel pictures of PCR products (200bp) employing LAMP outer primers for clinically positive and clinically negative samples, wherein lane 1 is negative control, lane 2 is Sample 1, lane 3 is Sample 2 and lane 4 is Ladder.

SEQUENCE LISTING
Nucleic acid sequences listed herein or in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases. Where, only one strand of each nucleic acid sequence is shown, the complementary strand is understood as included by any reference to the displayed strand.
Sequence ID: 1-4 are nucleic acid sequences of exemplary rat Sendai virusdetection primers.
Sequence ID: 5 is nucleic acid sequences of exemplary synthetic gene corresponding to conserved region of rat Sendai virus.
DETAILED DESCRIPTION OF INVENTION
Unless otherwise noted, technical terms are used according to conventional usage.Definitions of common terms in molecular biology may be found in Lewin's Genes X, ed. Krebs et al., Jones and Bartlett Publishers, 2009 (ISBN 0763766321); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341); and George P. Rédei, Encyclopedic Dictionary of Genetics, Genomics, Proteomics and Informatics, 3rd Edition, Springer, 2008 (ISBN: 1402067534).
The following explanations of terms and methods are provided to better describe the present disclosure and to guide those of ordinary skill in the art to practice the present disclosure. The singular forms "a," "an," and "the" refer to one or more than one, unless the context clearly dictates otherwise. For example, the term "comprising a nucleic acid molecule" includes single or plural nucleic acid molecules and is considered equivalent to the phrase "comprising at least one nucleic acid molecule." As used herein, "comprises" means "includes." Thus, "comprising A or B," means "including A, B, or A and B," without excluding additional elements.
Although methods and materials similar or equivalent to those described herein can be used to practice or test the disclosed technology, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting. The embodiments herein and the various features of the proposed system are explained more fully with reference to the non-limiting embodiments that are illustrated in the accompanying drawings and detailed in the following description. The illustrations used herein are intended to merely facilitate an understanding of ways in which the embodiments herein may be prescribed and further to enable those skilled in the art to practice the embodiment herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein.
The present invention is in relation to a primer set for detection and identification of Sendai Virus, primer set comprising of a) SEQUENCE ID:1, SEQUENCE ID:2 or a sequence complementary thereof corresponding to one pair of forward (F3) and reverse (B3) outer primers and; b) SEQUENCE ID:3, SEQUENCE ID:4 or a sequence complementary thereof corresponding to one pair of forward (FIP) and reverse (BIP) loop primers.
The present invention is also in relation to a synthetic gene sequence comprising Sequence ID 5 or a sequence complementary thereof as a positive control.
The present invention provides a method of for detection and identification of Sendai Virus, the method comprising the steps of:
a) obtaining a test biological sample;
b) extracting test RNA from the sample;
c) reverse transcribing the obtained test RNA into test DNA using reverse transcriptase;
d) amplifying the test DNA and synthetic gene of sequence ID 5 as a positive control to atleast one amplicon using at least one LAMP primer set chosen from sequence IDs 1 to 4 for amplification of nucleic acid; and
e) comparing outcome of amplification of test DNA with the positive control to detect atleast one amplicon of nucleic acid, thereby detecting presence of Sendai Virus nucleic acid in the test biological sample.
In an embodiment of present invention, the test biological sample comprises one or more of whole blood, plasma, serum, lymph, urine, saliva, tears, nasopharyngeal secretions and tissue extracts from lymph nodes, spleen, and lung.
In another embodiment of present invention, the ratio of outer to loop primers is 1:2.
In still another embodiment of present invention reverse transcription is carried out by incubating at 42°Cfor 30 minutes.
In still another embodiment of present invention, the amplification is carried out by incubation at temperature range of 60°C to 63 °C for 50 minutes to 60 minutes.
In yet another embodiment of present invention, amplification is done by Loop-mediated Isothermal Amplification method.
In yet another embodiment of present invention, presence of atleast one amplicon is detected by measuring color change or turbidity.
In yet another embodiment of present invention, said amplification of at least one amplicon is indicated by change in fluorescence emission wavelength of, by change in turbidity or appearance of a ladder-like electrophoresis pattern during process of agarose gel electrophoresis.
The present invention provides a RT-LAMP assay for detection and identification of Sendai Virus, the assay comprising: a) at least one nucleic acid primer set comprising sequence ID1, sequence ID2, sequence ID3, sequence ID4 or a sequence complementary thereof capable of detecting Sendai Virus in a LAMP based molecular test and; b) a positive control comprising SEQUENCE ID 5 or a sequence complementary thereof.
The present invention also provides composition comprising primer set for detecting and identifying Sendai virus.
The present invention is in relation to a kit for detecting and identifying Sendai virus in a biological sample, comprising primer set of sequence ID 1, sequence ID 2, sequence ID 3 and sequence ID 4;Bst polymerase mix; reverse transcriptase mix; molecular biology grade water, positive control of sequence ID 5 and an instruction manual.
The present invention provides a method of detection of Sendai Virus in rats by Loop Mediated Isothermal Amplification (LAMP). Loop mediated isothermal amplification (LAMP) is a nucleic acid amplification technique which uses a single temperature incubation and thereby abstaining the need for expensive thermal cyclers. It may be combined with a reverse transcription step to allow the detection of RNA.
One aspect of the invention is nucleotide primers designed and synthesised specifically to amplify conserved gene region of length 200bp for detection and quantification of said virususingLoop Mediated Isothermal Amplification (LAMP) assay. Highly specific primers for the amplification of conserved gene region are used for identification/detection. All primers are designed according to the LAMP primer designing principals and the primer design software Primer explorer V4/primer explorer V5of Eiken Chemicals (https://primerexplorer.jp/e/).
The conserved gene region used in the present invention is HN gene region of length 200 bp. HN gene is used as target region for detection because it is essential for attachment of the the virus to sialic acid-containing cell receptors thereby for initiating infection, and certain stretches of its sequence are conserved to serve this functionality. Since, the complete genome sequence of Sendai virus is not available; based on bioinformatics analysis of the available sequence on public databases, HN gene is selected.
The Loop Mediated Isothermal Amplification is nucleic acid amplification technique wherein the control for the detection of Sendai virus is prepared by cloning synthetic gene into a plasmid. Another aspect of the invention is a synthetic gene sequence corresponding to conserved 200bp region of HN gene to be used as a positive control.
For the synthesis of primers, nucleic acid synthesizer selected from different manufactures may be used and different type of products may be commissioned by related genetic companies. The synthetic gene is amplified using the primers and post confirmation by sequencing and BLAST, are cloned into a suitable high copy number plasmid that can be amplified in a corresponding suitable host cell.
Another aspect of the invention is optimized method of for detection and identification of Sendai virus using Loop Mediated Isothermal Amplification (LAMP) assay. The method of detection comprises steps of:a) obtaining a test biological sample; b) extracting test RNA from the sample; c) reverse transcribing the obtained test RNA into test DNA using reverse transcriptase; d) amplifying the test DNA obtained from the biological sample and the synthetic gene of sequence ID 5 as a positive control using at least one LAMP primer set chosen from sequence IDs 1 to 4 to; and e) comparing the outcome of amplification of test DNA with the positive control to detect the nucleic acid amplification products, thereby detecting presence of Sendai Virus nucleic acid in the test biological sample.
The RNA extracted from the biological sample using available conventional methods is used as test sample. The biological sample comprise but is not limited to one or more of whole blood, plasma, serum, lymph, urine, saliva, tears, nasopharyngeal secretions and tissue extracts from lymph nodes, spleen, and lung. The RNA extraction is carried out manually using methodscomprisingphenol/chloroform extraction, a solid phase method silica spin column absorption, and isopycnic gradient centrifugation or using commercially available RNA extraction kits, including Roche column extraction kit.
In yet another embodiment of present invention, detection of at least one amplicon is indicated by increase in turbidity of reaction mixture.
In yet another embodiment of present invention amplification of at least one amplicon is indicated by change in fluorescent emission wavelength of the reaction mixture, by change in turbidity of the said reaction mixture or appearance of a ladder-like electrophoresis pattern during the process of agarose gel electrophoresis.
The DNA polymerase that may be used in a reaction is a polymerasederived from a thermophilic microorganism, in particular, a polymerase lacking a5'-> 3' exonuclease function. Non-limiting examples of the DNA polymerase include the Bacillus stearothermophilus (Bst) DNA polymerase, the Thermus, thermophilus (Tth) DNA polymerase, the Thermus aquaticus (Taq)DNA polymerase, the Thermococcus litoralis DNA polymerase, the Pyrococcusfuriosus (Pfu) DNA polymerase, and the Bacillus caldotenax DNA polymerase.
Non-limiting examples of reverse transcriptases that may be used in a reaction include the moloney murine leukemia virus (MMLV) reverse transcriptase and the avian myeloblastosis virus (AMV) reverse transcriptase.
Yet another aspect of the invention is a detection kit for detecting and identifying Sendai virus in a biological sample. A rapid pathogen detection kit using LAMP technique is developed for the detection of Sendai virus in rats. The kit components are RT mix, Bst mix,primer mix, positive control and molecular biology grade water). The sample from the animal is incubated with the kit components. Detection of amplification product is done either by photometry for turbidity which is produced by increased quantity of Magnesium pyrophosphate in the reaction mixture/solution or visually by a simple colour reaction using SYBR green dye without any equipment. The LAMP kit has the potential to be used as a simple screening assay in the laboratory animal facility or at the point of care by clinicians. Highly specific primers for the amplification of Sendai virus gene specifically HN gene of length 200bp is used in the kit.
EXPERIMENTAL
Example 1. Isolation of RNA
RNA is extracted from rat tissue using trizol method and Roche column-based extraction method, according to manufacturer’s protocol. 60 ng/µl -350 ng/µl of the test nucleic acid with purity range of 260/280 of 1.10 to 1.96 is used for conducting experiments.
Example 2. Primer designing and synthesis
For Sendai Virus detection, HN gene of length 200bpis used as the identifier gene. Primers for the said gene are designed using Primer Explorer software of Eiken Chemicals (https://primerexplorer.jp/e/).
Outer Primers
F3
Sequence ID 1: 5’ACATAACCTCCTAGAATGCA3’
B3
Sequence ID 2: 5’GCTTGTTATCCCAATGGAC3’

Loop Primers
FIP
Sequence ID 3: 5’CCTGTCAATGTCAACTTGTTCAGTTTTAATCATACACTCTAGTAACATACG3’
BIP
Sequence ID 4: 5’CTAACCCCTGAGCTGGTCTTGTTTCTTATCTAGATGCCCTGCA3’

Suitably purified primers areobtained from a commercial source (Eurofins). The primers are reconstituted and diluted to the final concentration of 10 pmole. The outer primers and loop primers( FIP and BIP are loop primers) are mixed in the ratio 1:2 to prepare respective primer mixes.
Table 1: Sequence details
Sequence ID Type of Primer
Sequence name Sequence details
1 Outer F3 5’ACATAACCTCCTAGAATGCA3’
2 Outer B3 5’GCTTGTTATCCCAATGGAC3’
3 Loop FIP 5’CCTGTCAATGTCAACTTGTTCAGTTTTAATCATACACTCTAGTAACATACG3’
4 Loop BIP 5’CTAACCCCTGAGCTGGTCTTGTTTCTTATCTAGATGCCCTGCA3’

Example 3. Design of synthetic gene
A synthetic gene is constructed constituting the specified lengths as mentioned in the primer designing and synthesis in example 2 and cloned in single high copy number plasmid pT-NOT Vector which is then amplified in E.coli Topp10 F` host strain. This plasmid is used as control for detection of Sendai virus.The gel diagram of electrophoresed sample of constructed synthetic gene (HN gene of length 200bp) is given in Figure 1 and the sequence of the region is given below.

The amplified and purified plasmid of concentration 35 ng/µl and purity range of 260/280 of 1.9 is used as positive control.

Example 4. Kit Preparation for detection of Sendai Virusin vitro
The kit components include Bst Mix, RT mix , primer mix, molecular biology grade water and positive control DNA. Each reaction uses 15 µL of Bst Mix, 1 µL of primer mix, 5 µL of molecular biology grade water and 4 µL of positive control DNA. Accordingly, appropriate volumes of vials for each component can be can be customised according to number of reactions for which the kit is to be used. The kit should be stored at 4ºC.Storage at –20ºC may extend shelf life.

Table 2- Bst mix composition
Bst enzyme (8 units) 1.0 micro litre
Buffer (10 x) 2.5 micro litre
dNTPS 10mM 1.0 micro litre

Table 3- RT mix composition
RT enzyme 100 units 0.5 micro litre
RT buffer 2.5 micro litre

Components per reaction are given in the table 4 below:
Table 4: Components per reaction
Components Volume in µL
RT Mix 4.0
Bst Mix 15.0
Respective primer mix 1.0
Plasmid contain gene 5.0
Total Volume 25.0

The primer mix is provided according to the details provided below:
Stock concentration Working concentration
Outer primers 100 pico mol 10 pico mol
Loop primers 200 pico mol 20 pico mol

Example 5. Setting up LAMP Reaction
The kit components from the box are removed and placed on ice. The components (except enzymes) are thawed and the contents are spun down (if necessary). A LAMP mix is prepared in separate tubes for positive and negative controls. A standard LAMP reaction is setup using 15 µL of Bst polymerase mix, 1 µL of respective primer mix, 4 µL of RT mix and 5 µL of extracted RNA or positive control or molecular biology grade water (MBGW). This mixture is incubated at 420C for 30 min and 630C for 60 min. After incubation, working SYBR dye of (1: 10,000) concentration is prepared and 1 µL of SYBR dye is added to the reaction tubes. Finally, results are visualized directly or analysed under UV at 254 nm wavelength. Schematic representation of standard procedure in LAMP assay is given in figure 2; wherein (1) samples are collected; (2) RNA is extracted from the collected sample; (3) amplification of the RNA is done for easy detection, firstly by (3a) preparation of master mix; (3b) addition of RNA samples and then; (3c) LAMP amplification is carried out thus giving required (3d) colour change which can be easily observed; (4) Detection is done visually or by colorimetry.
A LAMP reaction for Sendai virus infection detection is setup using 15 µL of Bst polymerase mix, 1 µL of primer mix, 4 µL of RT mix and 5 µL of template.The mixture is incubated at 420C for 30 min and 630C for 60 min on a thermal cycler or calibrated constant temperature dry bath. After incubation, working SYBR dye is prepared and 1 µL of SYBR dye is added to the reaction tubes. Finally, results are visualized directly or analysed under UV at 254 nm.
A schematic diagram of LAMP assay is given in figure 3 wherein (a) Template RNA is prepared from the sample; (b) Primer mix, RT mix, Bst mix and MBGW is taken out from the kit; (c) Reaction mixture is prepared at 4°C placing all the reagents on ice bath; (d) Thermocycler or a dry bath is used to incubate the mixture at 63°C for 60 minutes; (e) Working SYBR solution of concentration 0.75 X is prepared by adding Tris-EDTA buffer into SYBR vial and mixed well; (f) Visual observation of colour change in the vial or at 254 nm wherein fluorescent orange colour represent a negative result and fluorescent green colour represent a positive result.
Example 6. Interpretation of LAMP assay
A fluorescent green colour or orange colour appears in the tube as given in figure 3.Fluorescent green colour indicates positive reaction i.e. presence of Sendai virus in the test sample and orange colour indicates negative reactioni.e. absence of Sendai virus in the test sample. The positive control and test sample is compared against a negative control tube.
Example 7. Sensitivity and specificity of LAMP assay using the Kit
To establish the detection of limit of the LAMP assay, serial dilutions of plasmid that is quantified by measuring the optical density at 260 nm are tested and compared with the results for a real-time PCR assay. Assay is done at 65 °C for 2 min. FAM channel reading is done after every two minutes.
The detection for 60-minute reaction is done using ESE Quant LAMP machine as well as in electrophoresis analysis. The reaction is also observed by the naked eye as SYBR green dye is used (Figure 4).
From the figure, the limit of detection is 6.25 copies/ul. Positivity at further dilutions is not 100%, or the colour is faint. However, the detection limit for the LAMP reaction is found to be 20 copies for a 60-minute reaction in ESE Quant LAMP machine as well as in electrophoresis analysis using the kit of present invention.
From figure 4, the limit of detection is 6.25 copies/ul. Positivity at further dilutions is not 100%, or the colour is faint. The assay using ESE Quant LAMP machine as well as in electrophoresis analysis, the limit of detection is found to be 20 copies.
RNA is isolated from Sendai virus positive animals is used as template for LAMP set up and also cDNA synthesis by outer reverse primer and PCR using two lamp outer primers. LAMP positive samples are also positive with two rounds of PCR employing LAMP outer primers. PCR amplified products are gel eluted and sent for sequencing. The sequence of amplified product is confirmed by Basic Local Alignment Search Tool to be the target gene thus confirming the accuracy of LAMP reaction.
Example 8. Validation of assay LAMP kit for detection of Sendai Virus
A LAMP kit for detection of Sendai virus in rat is prepared and validated using both clinically positive and clinically negative samples from the field. It is also validated using positive control samples obtained from Central Institute for Experimental Animals, ICLAS Monitoring Centre, Japan (Figure 5 and Figure 6). This kit is found to be highly specific for Sendai virus.3 batches with different batch sizes are checked for the consistent performance of the kit (Table 5, Table 6 and Table 7).
Table 5-Batch 1
KIT Sendai Batch 01 LAMP ELISA
Sample 1 (Positive control) Positive Positive
Sample 2 (Clinical) Negative Negative
Sample 3 (Positive control) Positive Positive
Sample 4 (Clinical) Negative Negative
Sample 5 (Clinical) Negative Negative
Sample 6 (Positive control) Positive Positive
Sample 7 (Clinical) Negative Negative
Sample 8 (Positive control) Positive Positive
Sample 9 (Clinical) Negative Negative

Table 6-Batch 2
KIT Sendai Batch 02 LAMP ELISA
Sample 1 (Positive control) Positive Positive
Sample 2 (Clinical) Negative Negative
Sample 3 (Clinical) Negative Negative
Sample 4 (Positive control) Positive Positive
Sample 5 (Clinical) Negative Negative
Sample 6 (Positive control) Positive Positive
Sample 7 (Clinical) Negative Negative
Sample 8 (Positive control) Positive Positive
Sample 9 (Clinical) Negative Negative

Table 7-Batch 3
KIT Sendai Batch 03 LAMP ELISA
Sample 1 (Clinical) Negative Negative
Sample 2 (Positive control) Positive Positive
Sample 3 (Clinical) Negative Negative
Sample 4 (Positive control) Positive Positive
Sample 5 (Clinical) Negative Negative
Sample 6 (Clinical) Negative Negative
Sample 7 (Positive control) Positive Positive
Sample 8 (Clinical) Negative Negative
Sample 9 (Positive control) Positive Positive
The results suggest that the assays performed using the primers and the kit of present invention are in line with the expensive ELISA method.
The single tube assay carried out in the present invention is simpler and faster than multistep processes and also eliminates false positives which may arise due to contamination from previous reactions. The rapid detection kit for the detection of Sendai virus of the present invention is economical and highly specific, which will be very helpful in systematic and scheduled laboratory testing is the most effective way to determine colony status and to prevent or detect influences on experiments.
,CLAIMS:WE CLAIM:
1. A primer set for detection and identification of Sendai Virus, primer set comprising of a) SEQUENCE ID:1, SEQUENCE ID:2 or a sequence complementary thereof corresponding to one pair of forward (F3) and reverse (B3) outer primers and; b) SEQUENCE ID:3, SEQUENCE ID:4 or a sequence complementary thereof corresponding to one pair of forward (FIP) and reverse (BIP) loop primers.
2. A synthetic gene sequence comprising SEQUENCE ID 5 or a sequence complementary thereof as a positive control.
3. A method of for detection and identification of Sendai Virus, the method comprising the steps of:
a) obtaining a test biological sample;
b) extracting test RNA from the sample;
c) reverse transcribing the obtained test RNA into test DNA using reverse transcriptase;
d) amplifying the test DNA and synthetic gene of sequence ID 5 as a positive control to atleast one amplicon using at least one LAMP primer set chosen from sequence IDs 1 to 4 for amplification of nucleic acid; and
e) comparing outcome of amplification of test DNA with the positive control to detect atleast one amplicon of nucleic acid, thereby detecting presence of Sendai Virus nucleic acid in the test biological sample.
4. The method as claimed in claim 3, wherein the test biological sample comprises one or more of whole blood, plasma, serum, lymph, urine, saliva, tears, nasopharyngeal secretions and tissue extracts from lymph nodes, spleen, and lung.
5. The method as claimed in claim 3, wherein the ratio of outer to loop primers is 1:2.
6. The method as claimed in claim 3wherein reverse transcription is carried out by incubating at 42°Cfor 30 minutes.
7. The method as claimed in claim 3, wherein the amplification is carried out by incubation at temperature range of 60°C to 63 °C for 50 minutes to 60 minutes.
8. The method as claimed in claim 3, wherein amplification is done by Loop-mediated Isothermal Amplification method.
9. The method as claimed in claim 3, wherein presence of atleast one amplicon is detected by measuring color change or turbidity.
10. The method as claimed in claim 3, wherein said amplification of at least one amplicon is indicated by change in fluorescence emission wavelength of, by change in turbidity or appearance of a ladder-like electrophoresis pattern during process of agarose gel electrophoresis.
11. A RT-LAMP assay for detection and identification of Sendai Virus, the assay comprising: a) at least one nucleic acid primer set comprising sequence ID1, sequence ID2, sequence ID3, sequence ID4 or a sequence complementary thereof capable of detecting Sendai Virus in a LAMP based molecular test and; b) a positive control comprising SEQUENCE ID 5 or a sequence complementary thereof.
12. A composition comprising primer set according to claim 1 for detecting and identifying Sendai virus.
13. A kit for detecting and identifying Sendai virus in a biological sample, comprising primer set of sequence ID 1, sequence ID 2, sequence ID 3 and sequence ID 4;Bst polymerase mix; reverse transcriptase mix; molecular biology grade water, positive control of sequence ID 5 and an instruction manual.