Sign In to Follow Application
View All Documents & Correspondence

A Method For Nucleic Acid Extraction From Cell Free Samples

Abstract: The present invention provides a method for efficient extraction of nucleic acids from cell free sample(s). The method can yield nucleic acids for various applications, for e.g. quantification of host cell nucleic acid contamination.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
21 July 2009
Publication Number
36/2017
Publication Type
INA
Invention Field
MICRO BIOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2019-08-21
Renewal Date

Applicants

Dr. Reddy’s Laboratories Limited
7-1-27  Ameerpet  HYDERABAD

Inventors

1. Dr. Prasad T Krishnamurthy
Flat#G2  Siri Homes Pragathi Enclave  Miyapur  Hyderabad – 500049
2. Saranya Sivakumar
Flat No. 401  Gayatri Sai Nilayam  Opp. Bhaskar Model High School  Nizampet Cross Road  Kukatpally  Hyderabad - 500072

Specification

FIELD OF THE INVENTION
The invention relates to a method for efficient extraction of nucleic acids from cell free samples. More particularly, it describes simultaneous treatment of cell free samples with Sodium dodecyl sulfate (SDS) and Phenol:Chloroform:Isoamyl alcohol prior to the extraction of nucleic acids. The method yields higher efficiency of extraction of nucleic acids than the column based nucleic acid extraction kits used alone.
BACKGROUND OF THE INVENTION
The manufacturing of biopharmaceuticals primarily involves heterologus expression of proteins in prokaryotic or eukaryotic expression host(s) (Baneyx F., Curr. Opin. Biotechnol. 1999; 10(5), 411-421; Swartz J.R., Curr. Opin. Biotechnol. 2001; 12(2), 195-201 and Zang M et.al., Nature Biotech. 1995; 13, 389-392). However, the expressed product contains substantial amounts of host cell contaminants such as host cell DNA (HCD) or host cell proteins (HCP) which are likely to co-purify with the end products, especially if their physicochemical properties are similar to those of the end products. The presence of these contaminants is a potential safety concern; hence their limits have been defined by drug regulatory agencies. Regulatory guidelines of various drug regulatory agencies for cell culture products specify that DNA content in the final cell culture product should be as low as possible. For instance, the Food and Drug Administration (FDA) guidelines require that the final product should contain no more than 100 pg of cellular DNA per dose (FDA, US Department of Health and Human Services, Food and Drug Administration, Centre for Biologics Evaluation and Research, February 28, 1997). Likewise, the World Health Organization (WHO) and the European Union (EU) permits no more than 10 ng residual DNA per dose (The European Agency for the Evaluation of Medicinal products: Evaluation of medicinal products for human use. CPMP/BWP/1143/00, 2001). Further, it is also recommended that methods with sensitivity of at least 10 pg should be used to determine HCD levels (Office of Biologics Research and Review, Food and Drug Administration, Points to consider in the production and testing of new drugs and biologicals produced by recombinant DNA technology (Draft), 1985). It is therefore mandatory for a manufacturer to certify that the contaminants present are within the range provided by regulatory guidelines. Hence, effective and sensitive methods are required for quantification of HCD contaminant(s).

The methods routinely used for quantifying HCD levels include sequence independent and sequence-dependent techniques. Sequence independent techniques include use of single strand DNA binding proteins for quantification of HCD (for e.g. Threshold) and whole genome hybridization such as Dot/Slot blot hybridization, that use labeled genomic DNA for HCD determination (Wolter T. and Richter A., Bioprocess Int 2005; 3, 40-6). Sequence dependent techniques are based upon amplification of target nucleic acid by real-time PCR. In this, a repeat region present in host cell genome (e.g. Alu3 for CHO cells; U.S. patent 5393657) is taken as an amplification target to represent the whole genome and quantified as a measure of host cell DNA. Thus in real time PCR, a target nucleic acid sequence is amplified and the product formed during the reaction is quantified by measuring the fluorescence of dyes or probes used in the reaction. This fluorescence is proportional to quantity of product formed and by taking into account amplification cycles, the exact quantity of nucleic acid initially present in the sample can be calculated (Nissom PM., Biologicals 2007; 35, 211-215; Lovatt A., Rev. Mol. Biotechnol. 2002; 82, 279-300; Valasek M.A and Repa J. J., Adv Physiol Educ 2005; 29, 151-159 and Kubista M et. al., Mol. Aspects. Med. 2006; 27, 95-125).

Thus, by using oligonucleotides directed to host cell genome repetitive DNA sequences, HCD can be detected by high degree of sensitivity making it a method of choice for quantifying HCD contamination. However, the sensitivity of the method is also governed by the nature of sample requiring HCD estimation.

Though, regulatory guidelines define contaminating HCD levels in only the final formulation, HCD quantification at every stage of recombinant protein production including various purification steps is recommended (Iznaga B.A. et. al., Electronic Journal of Biotechnology 2007, 10(1)). Hence, HCD levels need to be estimated not just in the final product, but also in the in-process samples, viz. the eluates of various product purification steps, collectively termed as cell free samples (see definition). Such samples typically have a high protein content and varying buffer and salt composition and hence cannot be used directly for estimation of nucleic acid by real time PCR due to their inhibitory effects on nucleic acid amplification. Thus, nucleic acid extraction from such samples is mandatory for reliable quantification.

Typically nucleic acid extraction require deproteinizing steps in samples that have high protein content, such as cell free samples. Pre-treatment with a combination of a protease (e.g. proteinase K) and a detergent (e.g. SDS) is one of the most commonly used deproteinizing methods (Goldenberger D. et. al., Genome Res. 1995; 368-370; Maniatis T. et.al. Molecular Cloning: A Laboratory Manual (Third Edition) Cold Spring Harbor laboratory, Vol I, page 2.56-2.58 and 6.4). However, such methods are expensive, time consuming and laborious. Alternatively nucleic acid isolation “kits” are commonly employed for the extraction of nucleic acid. These nucleic acid extraction/isolation kits are silica or ion exchange based columns that bind nucleic acids, which is subsequently eluted using an elution buffer (Little MA. U.S. Patent 5,075,430; Karsten H. et. al. U.S. patent 5,057,426; Vogelstein, B., et. al., Proc. Natl. Acad. Sci. 1979; 76, 615-619). Though these kit based methods generally give a reasonable amount of plasmid or genomic DNA, the methods are inefficient and inconsistent in extracting nucleic acid from cell free samples, especially those that are high in protein content such as biopharmaceuticals, recombinant DNA products or in-process samples
The present invention provides a method that overcomes the inefficiency and inconsistency of nucleic acid extraction by kit based methods. Moreover, the method is quick, inexpensive and consistent for various cell free samples having varying protein(s)/protein concentration and buffer/salt composition.
SUMMARY OF INVENTION
The present invention describes a method for the efficient extraction of nucleic acids from cell free samples that consists of simultaneous pre-treatment of cell free samples with SDS and Phenol:Chloroform:Isoamyl alcohol (25:24:1) prior to use of silica or ion exchange based columns for extraction of nucleic acids.


BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1: Agarose gel images showing recovery of spiked plasmids from various cell free samples (1b, 1c and 1d).
a) In absence of SDS and Phenol:Chloroform:Isoamyl alcohol treatment - Lane 1- spiked plasmid, Lane 2 – 1b, Lane 3 - 1c, Lane 4 - 1d.
b) Treatment with Phenol:Chloroform:Isoamyl alcohol (25:24:1) - Lane 1- spiked plasmid, Lane 2- 1b, Lane 3- 1c and Lane 4 - 1d.
c) Treatment with SDS - Lane 1 – spiked plasmid. Lane 2- 1b, Lane 3- 1c and Lane 4- 1d. Plasmid recovery after treatment with SDS and Phenol:Choloroform:Isoamyl alcohol (25:24:1)- Lane 5- 1b, Lane 6- 1c and Lane 7- 1d.

Figure 2: Percentage spike recovery from cell free samples after spiking cell free samples (1a and 1b) with genomic DNA.
a) In absence of SDS and Phenol:Chloroform:Isoamyl alcohol treatment followed by nucleic acid extraction using Qiagen PCR purification kit.
b) In absence of SDS and Phenol:Chloroform:Isoamyl alcohol treatment followed by nucleic acid extraction using Sigma GenElute plasmid miniprep kit.
c) Treatment with SDS and Phenol:Chloroform:Isoamyl alcohol followed by nucleic acid extraction using Qiagen PCR purification kit.
DETAILED DESCRIPTION OF THE INVENTION
The present invention describes a method for consistent and efficient extraction of nucleic acids by silica or ion-exchange based columns that comprises pre-treatment of nucleic acid containing cell free samples for the removal of proteins.

“Cell free samples” are samples devoid of cells including cell lysates from those of bacterial, fungal, microbial, plant or animal origin, loading, wash and eluate solutions of protein purification procedures, cell culture media, biopharmaceuticals or recombinant DNA products or biological products of commercial or therapeutic importance.
Most regulatory agencies recommend that biopharmaceuticals have minimum possible HCD contamination and regulatory guidelines define the maximal permissible limits of HCD contamination (FDA, US Department of Health and Human Services, Food and Drug Administration, Centre for Biologics Evaluation and Research, February 28, 1997; The European Agency for the Evaluation of Medicinal products: Evaluation of medicinal products for human use CPMP/BWP/1143/00, 2001). This requires precise quantitation of HCD levels in biopharmaceutical products. The HCD levels need to be monitored not just in the finished products/formulations but at every stage of the product development pathway, including cell lysates, cell culture media, including bacterial, fungal, microbial, plant or animal media, loading, wash and eluate solutions of protein purification procedures etc. The emphasis is on quantifying HCD levels at each stage of recombinant protein production, to ensure the efficiency of HCD removal (Iznaga B.A. et. al., Electronic Journal of Biotechnology 2007, 10(1)). Hence, accurate and precise methods are required for quantifying HCD levels in cell free samples. Real time PCR is one such method for quantifying HCD levels (Lovatt A., Rev. Mol. Biotechnol. 2002; 82, 279-300; Nissom PM., Biologicals 2007; 35, 211-215). However, the inhibitory effects of protein, buffer and salts in cell free samples on precise nucleic acid estimation preclude the use Real time PCR for direct HCD quantitation. Hence isolation of contaminating nucleic acid is required. This necessitates the development of efficient methods for isolation of nucleic acid from cell free samples.
A variety of methods have been developed for nucleic acid extractions that are largely based on the nature of the sample. Typically samples containing nucleic acid and proteinaceous material are pre-treated with protease and detergent for the removal of the proteinaceous material. However, this method is time consuming, expensive and laborious. Various nucleic acid isolation kits based upon silica or ion exchange chromatography are used to extract nucleic acid (Vogelstein, B., et al., Proc. Natl. Acad. Sci. 1979; 76, 615-619; Little MA., U.S patent 5,075,430; Karsten H. et.al., U.S. patent 5,057,426). However when used as such, the yields of nucleic acid isolated from cell free samples were low, and the efficiency of extraction poor and inconsistent.
The present invention describes a novel method for extraction of nucleic acid from cell free samples that is also convenient, economical and consistent. Cell free samples are first treated with SDS and Phenol:Chloroform:Isoamyl alcohol (25:24:1), prior to the actual extraction of nucleic acids, such as by silica or ion exchange chromatography based nucleic acid extraction kits. This prior treatment with SDS and Phenol:Chloroform:Isoamyl alcohol greatly improves the yield of nucleic acids, than when extraction is carried out in the absence of such treatment. Without wishing to be bound by theory, the improved extraction is perhaps a result of removal of proteins that may otherwise bind to nucleic acids and affect the availability of nucleic acids for isolation by silica or ion-exchange chromatography based nucleic acid isolation kits. For instance, it has been observed that glycoproteins as immunoglobulins (IgG) can interact with nucleic acid non-specifically (Kung VT., U.S patent 5004806), the strength of this interaction being dependent on the buffer composition of cell free samples. The addition of SDS may disrupt the interaction between protein and nucleic acids. This disruption minimizes the loss of nucleic acids in the subsequent nucleic acid isolation step, perhaps as a result of the precipitation of protein by Phenol:Chloroform:Isoamyl alcohol. Treatment with either SDS or Phenol:Chloroform:Isoamyl alcohol alone do not improve the yield of nucleic acids during the subsequent steps.
The present invention provides a method for the efficient isolation of nucleic acid from cell free samples.
In one embodiment the invention provides a method for the efficient isolation of nucleic acids from cell free samples comprising pre-treatment of cell free samples with anionic detergent and protein denaturant prior to isolation of nucleic acids.
In other embodiment the invention provides a method for the efficient isolation of nucleic acids from cell free samples comprising pre-treatment of cell free samples with wherein the anion detergent is SDS and the protein denaturant is Phenol:Chloroform:Isoamyl alcohol prior to isolation of nucleic acids.
In a preferred embodiment the invention provides a method for the efficient isolation of nucleic acids from cell free samples comprising pre-treatment of cell free samples with SDS and Phenol:Chloroform:Isoamyl alcohol followed by isolation of nucleic acids by silica or ion exchange chromatography based nucleic acid extraction kits.
The pre-treatment of the cell free samples as mentioned in the embodiments may be carried out by adding SDS to a final concentration of 0.5%, or/and equal volume of saturated Phenol:Chloroform:Isoamyl alcohol (25:24:1) solution to cell free samples.
The efficiency of extraction of nucleic acids by this method can be evaluated by measuring “percentage nucleic acid recovery” by “nucleic acid spike recovery assay”. The cell-free samples are spiked with plasmids, and the plasmids are extracted from cell free samples by the method described in the instant invention. The extracted plasmids are electrophoresed on 1% agarose gel pre-stained with ethidium bromide and plasmid bands are quantified using densitometry to give percentage nucleic acid recovery. Cell free samples can also be spiked with sheared genomic DNA from CHO cells prior to pre-treatment, and the DNA extraction be performed as provided in the instant application. The percentage nucleic acid recovery is estimated by quantifying extracted genomic DNA by Real time PCR.
For quantification of extracted genomic DNA by Real time PCR, a standard curve from known quantities of sheared DG44 genomic DNA is first prepared. Sheared genomic DNA starting from 10 ng is serially diluted and 5 µl from each dilution is used for real time PCR. 10 dilutions are used for preparing standard curve. A repeat region specific for CHO genome, such as Alu3, is taken as the amplification target. Forward and reverse primers GAGGTTAAGAGCACCAACTG and ATCTGCACACCAGAAGAGG are used for the amplification of the target sequence. The following cycling conditions are used: Step 1: Initial denaturation: 95°C for 5 min, Step 2: PCR cycles: 95°C for 15 sec, Step 3: 58°C for 60 sec, Step 4: Go to step 2 and repeat 39 times, Step 5: Melt curve: 95°C for 60 sec, Step 6: 58°C for 30 sec, Step 7: 95°C for 30 sec.
Thus, the present invention can be used for extraction of nucleic acid from any cell free sample. The invention can be used to improve yield of nucleic acids extracted by any nucleic acid isolation protocol. The invention enables the extraction and quantification of not only host cell DNA, but also viral, bacterial, fungal or microbial contamination of protein and other therapeutic products. The invention can also be used to quantify levels of nucleic acid contamination after protein purification or nucleic acid contamination elimination steps.
Definitions
“Cell free samples” are samples devoid of cells, including cell lysates including those of bacterial, fungal, microbial, plant or animal origin, loading, wash and eluate solutions of protein purification procedures, cell culture media, biopharmaceuticals or recombinant DNA products or biological products of commercial or therapeutic importance.
“Anionic detergent” is defined as a class of detergents having a negatively charged surface-active ion, e.g. Sodium dodecyl sulphate.
EXAMPLES
Example 1
Extraction of host cell contaminating DNA from cell free samples
In 1.5 ml microfuge tubes, 100 µl of cell free samples was taken and 5.5 µl SDS (10%) was added to it. The final volume of samples was adjusted to 110 µl by autoclaved water to get 0.5% as the final SDS concentration. The samples were vortexed for 5 seconds and then 100 µl of Phenol:Chloroform:Isoamyl alcohol (25:24:1) was added. The mixture was vortexed for 30 sec and then centrifuged at 13,200 rpm for 10 min at room temperature. The mixture separates into top aqueous and bottom organic phase, 55 µl of aqueous phase was carefully transferred to a fresh 1.5 ml tube. The aqueous phase was mixed with 5 volumes of buffer PBI (column binding buffer; Qiagen PCR purification kit) and loaded onto Qiagen PCR purification spin columns. The columns were centrifuged at 13,200 rpm for 30 sec and flow through was discarded. The columns were washed with 750 µl buffer PE (wash buffer; Qiagen PCR purification kit) and centrifuged for 30 sec at 13,200 rpm (flow through was discarded). The columns were centrifuged again at 13,200 rpm for 60 sec and any flow through was discarded. The columns were then transferred to fresh 1.5 ml tubes and 50 µl of buffer EB (elution buffer; Qiagen PCR purification kit) was added. The columns were centrifuged at 13,200 rpm for 60 sec and the flow through was collected as the extracted DNA. The extracted DNA was then quantified for HCD levels by Real time PCR.
Example 2
Extraction of nucleic acid from cell free samples without SDS and Phenol:Chloroform treatment.
The nucleic acids were extracted from cell free samples in the absence of SDS and Phenol:Chloroform:Isoamyl alcohol treatment and nucleic acid extraction efficiency was tested by nucleic acid spike recovery assay. 100 µl cell free samples of protein product 1(1b, 1c & 1d; refer Table II for sample details) were spiked with plasmids. The sample volume was adjusted to 110 µl with autoclaved water and the samples were mixed with 5 volumes of PBI buffer. The mixture was loaded onto Qiagen PCR purification spin columns and the columns were centrifuged at 13, 200 r.p.m. for 30 sec. Further steps as described in Example 1 were followed to recover spiked plasmids. The plasmids were electrophoresed on 1% agarose gel pre-stained with ethidium bromide (Figure 1a) and quantified densitometrically to calculate percentage nucleic acid recovery (Table I). There was almost negligible recovery from cell free samples 1b and 1c while from sample 1 d there was 23.6% nucleic acid recovery (Figure 1a, lane 4).
Table I: Comparison of percentage nucleic acid recovery from various cell free samples of protein product 1 after treatment with SDS or Phenol:Chloroform:Isoamyl alcohol or SDS and Phenol:Chloroform:Isoamyl alcohol.
S. No Cell free sample % nucleic acid recovery
(commercial columns) % nucleic acid recovery
(Phenol:Chloroform:Isoamyl alcohol + commercial columns) % nucleic acid recovery (SDS + commercial columns) % nucleic acid recovery
(SDS + Phenol:Chloroform:Isoamyl alcohol + commercial columns)
1 1b 0.11 92 20 89
2 1c 2.11 0.14 41 95
3 1d 23.66 0.04 53 104

Table II. Protein concentration and buffer composition of various cell free samples.
S. No Cell free samples Protein conc. (mg/ml) Buffer composition
1 Protein product1 1a 0.8-1.0 Cell culture media
2 1b 5 80 mM Sodium acetate; neutralised with 1M Tris; pH = 6.2
3 1c 3.5 80 mM Sodium acetate titrated with 35 mM phosphate buffer; pH = 6.2
4 1d 3.9 80 mM Phosphate buffer; pH = 6.2
5 1e 33 51 mM Phosphate buffer; pH = 6.2
6 Protein product 2 2a NE Cell culture media
7 2b NE 73.4 mM Acetate buffer; 200 mM Sodium Chloride; pH = 4.8
8 2c 0.024 73.4 mM Acetate buffer; pH 4.8; Neutralised with 1M Tris; pH = 6 - 7
9 2d 0.135 83.4 mM Acetate buffer; pH 3.3; Neutralised with 1M Tris; pH = 6 - 7
10 2e 0.96 20 mM Phosphate buffer; 140 mM Sodium Chloride; pH = 6.2
11 Protein product 3 3e 15 25 mM Citrate buffer; 0.9% (w/v) Sodium Chloride; pH = 6.2
NE- Not estimated
Example 3
Extraction of nucleic acid after treatment with Phenol:Chloroform: Isoamylalcohol (25:24:1).
The cell free samples were treated with Phenol:Chloroform:Isoamylalcohol (25:24:1) prior to nucleic acid extraction by Qiagen PCR purification spin columns and the nucleic acid extraction efficiency was tested by nucleic acid spike recovery assay. As described in example 2, 100 µl of cell free samples (1b, 1c & 1d) were spiked with plasmids and the final sample volume was adjusted to 110 µl with autoclaved water. The sample was then treated with 100 µl of of Phenol:Chloroform:Isoamylalcohol (25:24:1) by vortexing the mixture for 30 seconds. The mixture was centrifuged at 13,200 r.p.m for 10 min at room temperature to separate aqueous and organic phase. 55 µl of top aqueous phase was transferred to a fresh 1.5 ml centrifuge tube and mixed with 5 volumes of PBI. The mixture was then loaded onto Qiagen PCR purification spin column. The steps as described in example 1 were repeated to recover spiked plasmids from cell free samples. The plasmids were electrophoresed on 1% agarose gel pre-stained with ethidium bromide (Figure 1b) and quantified densitometrically (Table I). The results showed that Phenol:Chloroform:Isoamyl alcohol treatment alone is not sufficient to extract nucleic acid from all cell free samples. Though a good recovery was obtained for sample 1b (Figure 1b, lane 2) there was almost negligible recovery for products 1c and 1d (lanes 3 and 4 - no visible plasmid bands).
Example 4
Extraction of nucleic acid after treatment with SDS
The cell free samples were treated with SDS prior to nucleic acid extraction by Qiagen PCR purification spin columns and the nucleic acid extraction efficiency was tested by nucleic acid spike recovery assay. 100 µl of cell free samples (1b, 1c and 1d) were spiked with plasmids, 5.5 µl of SDS (10%) was added and volume of sample was adjusted to 110 µl. The sample was then mixed with 5 volumes of PBI and processed for nucleic acid extraction as described in example 1. The obtained plasmids were electrophoresed on 1% agarose gel pre-stained with ethidium bromide (Figure 1c, lanes 2-4) and quantified densitometrically (Table I). Though, in comparison to Phenol:Chloroform:Isoamyl alcohol treatment alone, plasmids could be recovered from all cell free samples by SDS treatment, the percentage nucleic acid recovery was still low ranging between 20-53%.
Example 5
Extraction of nucleic acid after treatment with SDS and Phenol:chloroform:Isoamyl alcohol
The cell free samples were treated with SDS and Phenol:Chloroform:Isoamyl alcohol (25:24:1) prior to nucleic acid extraction by Qiagen PCR purification spin columns and the nucleic acid extraction efficiency was tested by nucleic acid spike recovery assay. 100 µl of cell free samples (1b, 1c and 1d) were spiked with plasmids and processed as described in example 1 to recover plasmids. The plasmids were resolved on a 1% agarose gel (Figure 1c, lanes 5-7) pre-stained by ethidium bromide and quantified by densitometry to calculate percentage nucleic acid recovery (Table I). High percentage nucleic acid recovery was obtained with the combination in comparison to SDS or Phenol:Chloroform:Isoamyl alcohol used individually (Table I). The percentage nucleic acid recovery from all the samples was in the range of ~ 90-100% suggesting high extraction efficiency and consistency of the treatment method.
The genomic DNA extraction efficiency from cell free samples following SDS and Phenol:Chloroform:Isoamylalcohol treatment was finally tested. 100 µl of cell free samples (1a and 1b) were spiked with sheared genomic DNA from DG 44 CHO cells. 5.5 µl of SDS (10%) was added and volume of samples was adjusted to 110 µl with autoclaved water. The samples were treated with Phenol:Chloroform:Isoamyl alcohol (25:24:1) and processed as described previously to recover genomic DNA in flow through after addition of EB buffer. Real time PCR was then done to quantify the recovered DNA (Figure 2c). The genomic DNA extraction (percentage nucleic acid recovery) from cell free samples with SDS and Phenol:Chloroform:Isoamyl alcohol treatment (Figure 2c) was remarkably higher, ranging in between ~87-100%. Genomic DNA was also extracted from cell free samples without SDS and Phenol:Chloroform:Isoamyl alcohol treatment prior to nucleic acid extraction by Qiagen and Sigma nucleic acid extraction kits. The percentage nucleic acid recovery in case of extraction by Qiagen PCR purification kit was less than 50% (Figure 2a). In the case of Sigma nucleic acid extraction kit, high percentage nucleic acid recovery was obtained from sample 1a, however, the percentage recovery was again less for sample 1b (Figure 2b). The results clearly demonstrated loss of genomic DNA during nucleic acid extraction using commercial nucleic acid extraction kits alone (i.e. without SDS and Phenol:Chloroform:Isoamyl alcohol treatment), a critical step in HCD quantification.
Experiments were also performed with various cell free samples (1a, 1e, 2a, 2b, 2c, 2d, 2e and 3e) after SDS and Phenol:Chloroform:Isoamyl alcohol treatment and consistently high percentage nucleic acid recovery was obtained. The results of these cell free samples are tabulated in Table III.

Table III: Percentage nucleic acid recovery from different cell free samples using SDS and Phenol:Chloroform:Isoamyl alcohol method.

S. No Cell free sample % nucleic acid recovery
1 Protein product 1 1a 105
2 1e 87
3 Protein product 2 2a 95
4 2b 80
5 2c 75
6 2d 76
7 2e 87
8 Protein product 3 3e 82

Documents

Orders

Section Controller Decision Date

Application Documents

# Name Date
1 1720-CHE-2009-FORM 13 [21-05-2020(online)].pdf 2020-05-21
1 Form5_As Filed_21-07-2009.pdf 2009-07-21
2 1720-CHE-2009-RELEVANT DOCUMENTS [21-05-2020(online)].pdf 2020-05-21
2 Form3_As Filed_21-07-2009.pdf 2009-07-21
3 Form2 Titlepage_Complete_21-07-2009.pdf 2009-07-21
3 1720-CHE-2009-RELEVANT DOCUMENTS [29-04-2020(online)].pdf 2020-04-29
4 Form1_As Filed_21-07-2009.pdf 2009-07-21
4 1720-CHE-2009-IntimationOfGrant21-08-2019.pdf 2019-08-21
5 Drawing_As Filed_21-07-2009.pdf 2009-07-21
5 1720-CHE-2009-PatentCertificate21-08-2019.pdf 2019-08-21
6 Description Complete_As Filed_21-07-2009.pdf 2009-07-21
6 Abstract_Granted 318574_21-08-2019.pdf 2019-08-21
7 Correspondence_Complete Specification_21-07-2009.pdf 2009-07-21
7 Claims_Granted 318574_21-08-2019.pdf 2019-08-21
8 Description_Granted 318574_21-08-2019.pdf 2019-08-21
8 Claims_As Filed_21-07-2009.pdf 2009-07-21
9 Abstract_As Filed_21-07-2009.pdf 2009-07-21
9 Drawings_Granted 318574_21-08-2019.pdf 2019-08-21
10 1720 -che-2009 form-5 21-07-2009.pdf 2009-07-21
10 Marked Up Claims_Granted 318574_21-08-2019.pdf 2019-08-21
11 1720-CHE-2009-Proof of Right (MANDATORY) [09-08-2019(online)].pdf 2019-08-09
12 1720-CHE-2009-Written submissions and relevant documents (MANDATORY) [01-04-2019(online)].pdf 2019-04-01
13 1720-CHE-2009-HearingNoticeLetter.pdf 2019-02-27
14 1720-CHE-2009 FORM-18 08-07-2013.pdf 2013-07-08
14 1720-CHE-2009-ABSTRACT [29-06-2018(online)].pdf 2018-06-29
15 1720-CHE-2009 CORRESPONDENCE OTHERS 08-07-2013.pdf 2013-07-08
15 1720-CHE-2009-CLAIMS [29-06-2018(online)].pdf 2018-06-29
16 1720-CHE-2009-CORRESPONDENCE [29-06-2018(online)].pdf 2018-06-29
16 1720-CHE-2009-FER.pdf 2018-01-03
17 1720-CHE-2009-FER_SER_REPLY [29-06-2018(online)].pdf 2018-06-29
17 1720-CHE-2009-OTHERS [29-06-2018(online)].pdf 2018-06-29
18 1720-CHE-2009-OTHERS [29-06-2018(online)].pdf 2018-06-29
18 1720-CHE-2009-FER_SER_REPLY [29-06-2018(online)].pdf 2018-06-29
19 1720-CHE-2009-FER.pdf 2018-01-03
19 1720-CHE-2009-CORRESPONDENCE [29-06-2018(online)].pdf 2018-06-29
20 1720-CHE-2009 CORRESPONDENCE OTHERS 08-07-2013.pdf 2013-07-08
20 1720-CHE-2009-CLAIMS [29-06-2018(online)].pdf 2018-06-29
21 1720-CHE-2009 FORM-18 08-07-2013.pdf 2013-07-08
21 1720-CHE-2009-ABSTRACT [29-06-2018(online)].pdf 2018-06-29
22 1720-CHE-2009-HearingNoticeLetter.pdf 2019-02-27
23 1720-CHE-2009-Written submissions and relevant documents (MANDATORY) [01-04-2019(online)].pdf 2019-04-01
24 1720-CHE-2009-Proof of Right (MANDATORY) [09-08-2019(online)].pdf 2019-08-09
25 1720 -che-2009 form-5 21-07-2009.pdf 2009-07-21
25 Marked Up Claims_Granted 318574_21-08-2019.pdf 2019-08-21
26 Drawings_Granted 318574_21-08-2019.pdf 2019-08-21
26 Abstract_As Filed_21-07-2009.pdf 2009-07-21
27 Claims_As Filed_21-07-2009.pdf 2009-07-21
27 Description_Granted 318574_21-08-2019.pdf 2019-08-21
28 Correspondence_Complete Specification_21-07-2009.pdf 2009-07-21
28 Claims_Granted 318574_21-08-2019.pdf 2019-08-21
29 Description Complete_As Filed_21-07-2009.pdf 2009-07-21
29 Abstract_Granted 318574_21-08-2019.pdf 2019-08-21
30 Drawing_As Filed_21-07-2009.pdf 2009-07-21
30 1720-CHE-2009-PatentCertificate21-08-2019.pdf 2019-08-21
31 Form1_As Filed_21-07-2009.pdf 2009-07-21
31 1720-CHE-2009-IntimationOfGrant21-08-2019.pdf 2019-08-21
32 Form2 Titlepage_Complete_21-07-2009.pdf 2009-07-21
32 1720-CHE-2009-RELEVANT DOCUMENTS [29-04-2020(online)].pdf 2020-04-29
33 1720-CHE-2009-RELEVANT DOCUMENTS [21-05-2020(online)].pdf 2020-05-21
33 Form3_As Filed_21-07-2009.pdf 2009-07-21
34 1720-CHE-2009-FORM 13 [21-05-2020(online)].pdf 2020-05-21
34 Form5_As Filed_21-07-2009.pdf 2009-07-21

Search Strategy

1 1720CHE2009patseersearch_02-01-2018.pdf

ERegister / Renewals

3rd: 22 Aug 2019

From 21/07/2011 - To 21/07/2012

4th: 22 Aug 2019

From 21/07/2012 - To 21/07/2013

5th: 22 Aug 2019

From 21/07/2013 - To 21/07/2014

6th: 22 Aug 2019

From 21/07/2014 - To 21/07/2015

7th: 22 Aug 2019

From 21/07/2015 - To 21/07/2016

8th: 22 Aug 2019

From 21/07/2016 - To 21/07/2017

9th: 22 Aug 2019

From 21/07/2017 - To 21/07/2018

10th: 22 Aug 2019

From 21/07/2018 - To 21/07/2019

11th: 22 Aug 2019

From 21/07/2019 - To 21/07/2020