Abstract: The invention describes a highly improved, reproducible and a consistent method of transformation and regeneration that results in obtaining 12-15% transgenic plants. The present invention relates to a method of selecting genetically transformed Sunflower explants based on their ability to utilize Xylose as a sole carbohydrate source. Further disclosed is the nucleic acid sequence of the Xylose Isomerase gene, vector construction for incorporation of the selection marker gene and the process of Agrobacterium Mediated Transformation of target host plant with the vector comprising the gene encoding the enzyme Xylose isomerase under the functional combination of the heterologous regulatory sequences. Also disclosed is the method of selecting the putative transformants post transformation with the said vector that possess a metabolic advantage of utilizing Xylose as a sole carbon source. Increased efficiency of regeneration, better growth and survival has been observed on subjection to the described method of positive selection. The subject invention alleviates the disadvantages of negative selection methods such as the undesired elimination of the transformed cells and the potential environmental harm caused due to the dispersal of the antibiotic and the herbicide resistant genes.
FIELD OF INVENTION:
Helianthus annum, or sunflower, is a recalcitrant species, which is extremely difficult to transform. We report a highly improved method of transformation, which results in 2-3 fold greater increase in the number of transformants obtained as against the cited prior art. The present invention relates to a method of selecting genetically transformed Sunflower explants based on their ability to utilize Xylose as a sole carbohydrate source. Further disclosed is the nucleic acid sequence of the Xylose Isomerase gene, vector construction for incorporation of the selection marker gene and the process of Agrobacterium Mediated Transformation of target host plant with the vector comprising the gene encoding the enzyme Xylose isomerase under the control of heterologous regulatory sequences. Also disclosed is the method of selecting the putative transformants post transformation with the said vector that possess a metabolic advantage of utilizing Xylose as a sole carbon source. Increased efficiency of regeneration, better growth and survival has been observed on subjection to the described method of positive selection. The subject invention alleviates the disadvantages of negative selection methods such as the use of antibiotic or herbicide resistance genes.
BACKGROUND OF THE INVENTION AND PRIOR ART:
Plant transformation is now a core research tool in plant biology and a practical tool for cultivar improvement; transformation of several plant species via Agrobacterium mediated transformation has become a routine technology. Sunflower is a major crop used worldwide for the production of edible oils; attempts to transform the species are being made for a number of decades - however, the sunflower is a recalcitrant species resistant to the methods of transformation used so far. Attempts to transform the species using Agrobacterium or biolistic methods, using different selectable markers have resulted in very low transformation efficiencies ranging fi-om 0.6-6%.
When a population of plant cells is transformed, selection of the transformed cells is typically done using a selection marker. The major technical challenge in plant transformation is the development of selection markers for screening and selection of successfully transformed cells. This process of selection is extremely important, with the cost of screening for transformants sometimes exceeding the costs of transformation itself. The choice of the selectable marker gene, the selective agent, its concentration and the timing of the application is very important for a strict selection of transformed cells. On the other hand, regeneration should not be impeded. Hence though a strict selection regime is desirable, this should not impede the development potential of the transformants. The choice of conditions that rightly balances the two needs constitutes an art in itself.
Selectable markers identified today can be differentiated into two types that enable transgenic plants or cells to be identified after transformation. They can be divided into positive and negative markers conferring a selective advantage or disadvantage respectively. Negative selectable markers are those, which allow the selection of transformed cells, or tissue explants by their ability to grow in the presence of an antibiotic or herbicide. In addition to selecting of transformants, such markers can be used to follow the inheritance of a foreign gene in segregating population of plants.
These negative selection methods have considerable disadvantages. The most significant of them all is that the non-transformed cells are killed in the presence of the phyto-toxic product and in cases where a coherent tissue is used there is a risk that the transformed cells also die, due to the fact that the death of the non-transformed cells may cut off the supply of nutrients to the transformed cells or because of the damaged or dying non-transformed cells may excrete toxic compounds. Moreover the presence of an antibiotic resistance gene in ingested plants is a matter of concern. In addition, selection of cells or tissues using negative selection requires precise timing of expression of the introduced genes in relation to the selection process. If the transgenic cells are treated with a toxic compound before the detoxifying gene is expressed or before enough of the gene product is produced to ameliorate the action of the toxic compound, both the transgenic and the non-transgenic cells are killed. If selection is delayed, the selection of transgenic cells or tissues may be hindered by, for example, shoot or callus formation from non-transgenic cells or tissues, which forms a barrier to the penetration of the compound used to select the transformed cells.
The above-mentioned disadvantages are overcome to a substantial extent, by the method of positive selection whose operating principle is converse to negative selection. Rather than conferring resistance to a negative or toxic substance, positive selection involves conferring onto the transformed cell a metabolic, or other competitive advantage over non-transformed cells. These identify and select the genetically transformed cells without damaging or killing the non- transformed cells in the population.
Sunflower is an important oil-seed crop, which is reported to be recalcitrant to transformation and regeneration (Schrammeijer et al.. Plant Cell Reports, 1990 9:55-60). Schrammeijer et al., have evaluated some of the potential problems with the regeneration from various explants of Sunflower, the transformants being selected by their ability to grow on negative selection based agents. Kanamycin and hygromycin are the most widely used selection agents for sunflower transformation although these are known to be detrimental to their organogenic potential (Everett et al., 1987; Muller et al., 2001).
Disclosed in this invention is a novel method of selecting transformants belonging to the species Helianthus annuus, specifically exemplifying a positive selection method that involves conferring to the transformed tissue explants an ability to metabolize certain compounds preferably Xylose; transformed explants are selected by simply culturing them on a medium containing the referred selection agent.
The method of selection disclosed herein relates to a method of screening and selecting suitable transformed explants for regeneration. A stable, precise, higher transformation and regeneration efficiency has been achieved through our method. The advantages of the technology described are lucid enough to distinguish it from the existing technologies.
US Patent Application 5,767,378 titled- "Mannose or Xylose positive selection" relates to a method of identifying or selecting from a population of eukaryotic cells cultivated on or in a medium containing at least one compound, cells which have a metabolic advantage as a result of being transformed. Wherein the cells are being transformed with a nucleotide sequence or a co-introduced nucleotide sequence which when expressed results in the metabolism of compounds like mannose or xylose.
Haldrup et al. (1998), have established that the xylose isomerase gene from Thermonanaerobacterium thermosulfurogenes allows effective selection of transgenic plants using D-xylose as the selection agent (Plant Molecular Biology (1998), 37(2), 287-296) in potato, tomato and tobacco species. The xylose isomerase gene was transferred to the target plant by Agrobacterium- mediated transformation. Selection studies showed that in potato and tomato, the xylose isomerase selection was more efficient than the kanamycin resistance selection, whereas in the tobacco plants the opposite effect was observed.
A recent review titled "Positive selection marker genes for routine plant transformation" mentions that the selectable marker genes used so far have been either antibiotic resistance genes or herbicide tolerance genes. It also describes the new classes of marker genes that are confer a metabolic advantage of the transgenic cells over the non-transformed cells.
Haldrup et al. (2001) , describe the selection of transformed plants based on the use of Xylose Isomerase as the selection marker (In Vitro Cellular & Developmental Biology: Plant (2001), 37(2), 114-119.
A continuation part of the US Patent Application 5,767,378 fiirther relates to novel glucuronide compounds including cytokinin glucuronide compounds for use in a method of selecting genetically transformed cells from a population of cells comprising introducing a desired nucleotide sequence or the co-introduced nucleotide sequence into the genome of a cell whereby the desired nucleotide sequence induces a positive effect by giving the transformed cells a competitive advantage when the population of cells are supplied with an inactive compoimd thereby allowing the transformed cells to be identified from the population of non-transformed cells.
Hou et al describes the use of selectable marker genes in transgenic plants and its removal. The review focuses on the use of selective marker genes in transgenic plants and its removal with emphasis on positive selection markers in transgenic plants by using isopentenyl transferase gene, xylose isomerase gene, phosphomannose-isomerase gene and beta-glucuronidase gene. Also described are the methods of marker gene removal using cofransformation, site-specific recombination system, transposon-mediated reposition and homologous recombination.
The method of selection disclosed herein is lucid enough to distinguish from the prior art documents cited. Our invention specifically aims at the method of positive selection of transformed plant explants that belong to the plant species Helianthus annuus. Furthermore, the selectable marker gene that encodes for the protein Xylose isomerase has been isolated from the organism Schizochytrium and modified suitably for its expression in the host plant species. It has to be specifically noted that high transformation efficiency in Sunflower plants has been rarely reported. More specifically several problems have been noted with regeneration from various explant types of Simflower (Schrammeijer et al., Plant Cell Reports, 1990 9:55-60)
We report a transformation efficiency and regeneration efficiency of 12-15%"- an efficiency that is 2-3 folds greater than that achieved so far.
OBJECTIVES OF THE INVENTION:
The main objective of the present invention is to obtain a method for selection and regeneration of genetically transformed oil seeds, more specifically Helianthus annuus plant explants.
Another objective of the present invention is to obtain a genetically transformed plant explants harboring the vector comprising the nucleotide sequence, the expression of which confers a metabolic advantage to the transformed explants over the non-transformed cells.
Yet another main objective of the present invention is to obtain a method wherein both the transformed and the untransformed plant explants are selected based on the said competitive metabolic advantage of utilizing the selection agent as a carbohydrate source attributed to the expression of the enzyme by the nucleic acid.
Still another objective of the present invention is to obtain a method wherein the regeneration efficiency is 2-3 fold as against the hygromycin based method of negative selection.
STATEMENT OF THE INVENTION:
Accordingly the present invention relates to a method for selection and regeneration of genetically transformed oil seeds more specifically Helianthus annuus plant explants comprising: a) construction of a recombinant vector incorporating the nucleic acid sequence operably linked to a regulatory sequence encoding the enzyme Xylose Isomerase required for the metabolism of the selection agent xylose, b) Agrobacterium mediated method of transformation of the said vector into the plant explants under conditions optimal for infection, c) a step of selection of the putative transformants on MS mediimi containing the selection agent of step a), and d) a step of regeneration of the selected plant explants; a method wherein the genetically transformed plant explants harboring the vector comprising the nucleotide sequence the expression of which confers a metabolic advantage to the transformed explants over the non-transformed cells; a method, A^^erein both the transformed and the untransformed plant explants are selected based on the said competitive metabolic advantage of the selection agent as a carbohydrate source attributed to the ejqjression of the enzyme by the nucleic acid and a method wherein the regeneration efficiency is 2-3 fold as against the hygromycin based method of negative selection
Sunflower is a major crop used worldwide for the production of edible oils. Attempts to transform the species using Agrobacterium or biolistic methods, using different selectable markers have resulted in very low transformation efficiencies ranging from 0.6-6%. This invention describes a highly improved, reproducible and consistent method of transformation and regeneration that results in obtaining 12-15% transgenic plants.
This invention relates to a positive selection method that confers transformed explants of species Helianthus annuus an ability to metabolize Xylose. One aspect of the invention pertains to construction of the vector construct comprising a selectable marker gene. A specific aspect pertains to the Agrobacterium mediated method of transforming the constructed vector comprising the selectable marker gene into the host plant explants under conditions suitable for infection. The successfully transformed cells comprising the gene of interest are induced with a positive effect that gives these cells a selective metabolic advantage over the non-transformed cells when cultured together on a suitable medium containing the selective agent. This selective advantage is attributed to the successful expression of the marker gene in the presence of the marker compound.
According to a further aspect the selectable marker compound supplied to the population of the transformed tissues is Xylose that induces the expression of the marker gene in the transformed explants.
Further still, an additional aspect of the subject invention pertains to the polynucleotide molecule that encodes the protein having the biological activity of Xylose Isomerase. Specifically, the aspect pertains to a polynucleotide as represented in SEQ ID 3.
Moreover, the transformation efficiency achieved from the disclosed method is 12- 15% and the regeneration efficiency has been proven to be 2-3 fold greater than antibiotic (hygromycin) based methods of negative selection.
Brief Description of the Drawings:
FIG. 1: Complete Xylose isomerase domain in the 1.5kb sequence of SC-I desaturase. FIG.2: Homology of the motif from SC-1 to the xylose isomerase domail.
FIG. 3: Map of pGEX-XI. The Xylose Isomerase gene was cloned between the BamHI and Xhol sites to study expression in E.coli.
FIG. 4: Induction of Xylose isomerase in E.coli. Amplification of transformed SEA explants with XI primers. Lanes: I: Induced; U: Uninduced; 1,2,3: Different clones carrying the xylose isomerase gene; M: MW marker.
FIG. 5: A. Amplification of the ORF from the xylose Isomerase clone.
B: Restriction of the pC AMBIA-XI with Xho I. Note the release of the hpt gene from the Xho I site. FIG. 6: Replacement of hpt with XI in pC AMBIA-CO-XI.
FIG. 7: Untransformed Sunflower SEA explants A) cultured on sucrose (35gm/l) B) cultured on D- Xylose (30gm/l) C) cultured on medium without any carbon source. The explants were photographed after 3 weeks.
FIG. 8: Budding as observed in transformed SEA explants cultured on A) Hygromycin (25mg/l) and B) Xylose (15g/l)+Sucrose (5gm/l) after 2 weeks of selection
FIG. 9: A) SEA Explants on 1st Selection Media. B) & C) Elongation Media D) Rooting Media E) & F) Plantlets in Hardening stage.
FIG. 10: Amplification of transformed SEA explants with XI primers.
Brief Description of the Sequence Listings:
SEQ ID NO 1: Sequence of full length of Xylose isomerase transcript of SCI
SEQ ID NO 2: Translated Protein sequence of Xylose Isomerase of SCI
SEQ ID NO 3: Sequence of Xylose isomerase after optimization for expression in Plants
SEQ ID NO 4: Sequence of fiill-length codon optimized Xylose isomerase transcript of SCI in frame in pCAMBIA vector.
DETAILED DESCRIPTION OF THE INVENTION:
The present invention relates to a method for selection and regeneration of genetically transformed oil seeds more specifically Helianthus annuus plant explants comprising:
a) Construction of a recombinant vector incorporatinf the nucleic acid sequence operably linked to a regulatory sequence encoding the enzyme Xylose Isomerase required for the metabolism of the selection agent xylose.
b) Agrobacterium mediated method of selection of the transformation of the said vector into the plant explants under conditions optimal for infection.
c) A step of selection of the putative transformants on MS medium containing ±e selection agent of step a)
d) A step of regeneration of the selection plant explants.
In another embodiment of the present invention the species used is that of Helianthud annuus
In yet another embodiment of the present invention the nucleic acid sequence encoding the enzyme Xylose Isomerase is isolated from the organism Schizochytrium represented in SEQ IDl.
In yet another embodiment of the present invention at least one of the nucleotide sequence is modified in that the expression of the thus modified DNA occurs in the host plant explant.
In yet another embodiment of the present invention the nucleic acid sequence has been represented in SeqIDS.
In yet another embodiment of the present invention the corresponding amino acid sequence of the expressed protein is represented in Seq ID 2.
In yet another embodiment of the present invention the regulatory sequence is a promoter sequence.
In yet another embodiment of the present invention the selection agent is Xylose.
The present invention relates to a method for genetically transformed plant explants harboring the vector comprising the nucleotide sequence, the expression of which confers a metabolite advantage to the transformed explants over the non-transformed cells.
The present invention relates to a method wherein the transformed and the untransformed plant explants are selected based on the said competitive metabolic advantage of utilizing the selection agent as a carbohydrates source attributed to the expression of the enzyme by the nucleic acid.
In another embodiment of the present invention the transformation efficiency obtained is greater than or equal to 10%
In another embodiment of the present invention the transformation efficiency obtained is greater than or equal to 15%
The present invention relates to a method wherein the regeneration efficiency is 2-3 fold as against the hygromycin based method of negative selection.
The term "Selectable maker gene" refers to any nucleotide sequence that is preferably co- introduced with the gene of interest, wherein a selective advantage is conferred to a cell transformed with the said selectable marker gene.
The term "selective agent" is the compound or nutrient in inactive or precursor form which in the absence of, for example, expression of the selectable marker gene exists in a form substantially biologically inactive with respect to the cells in question, but which when the selectable marker is expressed or transcribed is hydrolyzed or otherwise activated or metabolized so as to provide the genetically transformed cells containing the gene of interest with a selective advantage and thereby allowing the cells to be selected.
The term "selective advantage" as used herein includes the terms selective, metabolic and physiological adv^tage and means the transformed cells are able to grow more quickly than the disadvantaged (non-transformed) cells, or are advantageously able to utilize substrates (such as nutrient precursors, etc.) which disadvantaged cells are not able to utilize.
The invention is further elaborated with the help of the following examples. How ever these examples should not be constructed to limit the scope of the invention.
EXAMPLE: 1
Cloning of Xylose Isomerase from a Thraustochytrid strain SC-I.
Total RNA was isolated from three-day-old cultures of the Schizochytrium SC-I, a Thraustochytrid isolated from the backwaters of Goa. cDNA was synthesized from the mRNA using superscript Rnase (GibcoBRL). The cDNA was cloned into the Notl-Sall site of pSPORTl vector and transformed into E.coli DHIOB.
The primary cDNA library consists of 2 x 106 clones, while the amplified library has a titer of 2 x 1010 clones/ml. EST clones were randomly picked and inserts amplified with SP6 and T7 primers. The 5' ends of the 2000 cDNA clones were randomly selected and sequenced with T7 primers. 5' end sequencing of clones from the cDNA library of SC-I led to the identification of cDNA clone of 1.5kb which encodes a ftill-length Xylose Isomerase (xylA) cDNA of 151 Ibp with a 5' UTR of 158bp and a 3' UTR of 30bp. It has an ORF of 1481bp.
The sequence of the CDS is given in the SEQ ID 1. It is the sequence of the frill length Xylose Isomerase transcript of SC-I. The sequence translates into a protein of 440 amino acids. The amino acid sequence of the translated protein is represented in SEQ ID 2. The sequence shows 74% homology to the Xylose isomerase of Arabidopsis thaliana. It contains the complete Xylose isomerase domain and has been designated as the xylose isomerase of SC-I. Presence of the complete Xylose isomerase domain in the 1.5kb sequence of SC-I desaturase has been represented in the FIG. NO 1 "
FIG. N0.2 represents the homology of the motif from SC-I to Xylose Isomerase domain. EXAMPLE: 2
Codon optimization of the Xylose isomerase
The xylose isomerase (xylA) sequence of SC-I uses codons that are comparatively rarely used in plants; SC-I predominantly utilizes CGC to code for Arginine where only 9% of the plant codons for Arg are CGC. Hence, the CGC codons were replaced with more frequently used codons for arginine. The clone was subjected to two rounds of multi-site directed mutagenesis for substituting 9 nucleotides prior to introduction irito plants. The optimized sequence is represented in SEQ ID 3.
EXAMPLE: 3
Cloning of Xylose Isomerase into pGEX Expression vector
To confirm that the codon optimised gene does transcribe and translate, the codon optimized SC-I XylA gene from pSPORTl, was amplified with the forward primer (5'GCGCGGATCCATGGGTGAATTCTTTCS') containing an Bamffl site and the Reverse primer (5'GAAACTCGAGCTTGTCGATTAAGAAATGTATTGGTTS') containing an Xhol site. The amplified PCR product (1323) was digested with BamHI and Xhol. pGEX-4T-3 is an expression vector used to express the proteins as fiision proteins with the 26-kDa glutathione S- transferase (GST under control of the tac promoter. pGEX-4T-3 was digested with BamHI and Xhol and the PCR product(restricted with BamHI and Xhol) cloned directionally between the two sites - the resultant clone was called pGEX-XI. Map of pGEX-XI has been represented in the FIG.NO. 3
Expression of the Xylose isomerase fusion protein in E.coli
The pGEX-XI carrying the Xylose Isomerase gene was transformed into E coii BL21. The transformed cells were selected on LB media containing 100p.g/nil of Ampicillin. Colonies were picked up at random and were grown overnight in LB containing lOOug/ml of ampicillin. 1% of these overnight cultures were used as starter cultures for inoculating 5ml of LB broth containing lOOug/ml of ampicillin. Cultures were incubated till O.D. 600 reached approximately 0.6-0.7. 2 ml each of these cultures was induced with ImM IPTG for 3 hrs. Simultaneously, 2ml of the culture was pelleted down as control without induction. The cell pellets were resuspended in 100^1 sample buffer and 50ul loaded onto a 10% SDS-PAGE gel. The induction is shown in the FIG. NO 4
A protein of 76KDa, the expected size of the GST-Xylose isomerase fusion protein, was observed in the induced cells of clones 1 and 2 while being absent from the uninduced cells. Thus the codon optimized xylose isomerase is in the right reading frame and is capable of being transcribed and translated.
Proof of function of Xylose Isomerase gene in E. coli
The E.coli strain AB477 (proA2, his-4, aroCl, thi-1, lacYl, galK2, xyl-5, mtl-1, lambda" supE44) is Xylose Isomerase (XylA) deficient (Haldrup et at., 1998 & 2001). The complementation of the Xylose Isomerase gene in the mutant will enable this strain to utilize and grow and thereby proving its function. E.coli strain AB477 was obtained from the E.coli Genetic Stock Center, USA. Xylose isomerase gene in pGEX-4T-3 was transformed into competent cells of E.coli strain AB477 which was plated onto MacConkey agar plates containing l%(w/v) D-Xylose with ampicillin (100p,g/ml). Transformants harboring the XylA gene were able to ferment D-Xylose and appear red on MacConkey agar plates containing xylose.
AB477 host cells, cells transformed with pGEX4T-3 and those transformed with pGEX-XI were plated onto MacConkey' s media containing ampicillin (100p,g/ml) as well as media containing Xylose (1% w/v) and ampicillin (lOOjxg/ml) respectively. Red colonies were obtained with pGEX- XI in media containing xylose, while host cells and AB477 carrying pGEX4-T3 did not grow in the media. Thus, the codon optimised xylose isomerase gene isolated from SC-I is translated and fimctional.
EXAMPLE: 4
Cloning of Xylose Isomerase into pCAMBIA
The pCAMBIA-1301 is derived from the pPZP vectors. The vector contains the hygromycin phospho-transferase (hpt) under the CaMV35S promoter and terminated by the CaMV35S polyA signal. The gene provides resistance to hygromycin so that transformed cells are selected for in hygromycin containing medium.
The ORF of the codon optimized Xylose Isomerase (XylA) gene in pSPORT was amplified with Forward primer (5* CTCTCTCGAGCAACCATGGGTGAATTCTTTCC 3') & the reverse primer (5'GAAACTCGAGCTTGTCGATTAAGAAATGTATTGGTT 3') containing the Xhol sites each. The amplified fragment was restricted with Xhol. pCAMBIA 1301 was simultaneously restricted with Xhol to release the hpt gene and the vector purified from agarose gel was ligated to the amplified fragment. Amplification of the ORF from the Xylose isomerase clone and the restriction of the pC AMBIA-XI with Xhol is represented in the FIG.N0.5
The ligation mix was transformed into DHIOB. Transformed colonies were picked up and the plasmid isolated from these colonies amplified with XI primers and sequenced with the same. Thus constructs carrying the XI gene in the right orientation and right frame were identified. The sequence of the gene, cloned in the right frame, is given in the SEQ ID.4
The FIG N0.6 represents the sequence of full-length codon optimized Xylose Isomerase transcript of SC-I in frame in pCAMBIA vector and the replacement of hpt with XI in pC AMB lA-CO-XI. The hpt gene coding for hygromycin phospho transferase cloned between Xho-I sites of vector pCAMBIA 1301 has been replaced by codon optimized Xylose isomerase in place of hygromycin has been named pCAMBIA-XI.
EXAMPLE: 5
Transformation of sunflower using xylose isomerase as positive selection marker
It is known that when genetic material is to be introduced into a population of cells by transformation, only a certain number of the cells are successfully transformed. Identification and selection of the transformed cells has fraditionally been accomplished using negative selection, whereby transformed cells are capable of survival on media containing an agent which they are able to degrade, while non-transformed cells are killed on the media. Hygromycin is the most commonly used antibiotic while the hygromycin phospho transferase gene (hpt) in the construct used for transformation provides resistance to the transformed cells grown in media containing the antibiotic.
These negative selection methods have certain disadvantages. While the non-transformed cells may die because of the presence of antibiotics in the growth medium, they release toxins into the medium, which are inhibitory and toxic to the transformed cells as well. Moreover, the presence of an antibiotic resistance gene in ingested plants and microorganisms is a matter of concern for environmental groups and governmental authorities. In addition, selection of cells or tissues using negative selection requires precise timing of expression of the introduced genes in relation to the selection process. If the transgenic cells are treated with a toxic compound before the detoxifying gene is expressed, or before enough gene products are produced to ameliorate the action of the toxic compound, both the transgenic and the non-transgenic cells are killed. If selection is delayed!, the selection of transgenic cells or tissues may be hindered by, for example, shoot or callus formation from non-transgenic cells or tissues, which forms a barrier to the penetration of the compound used to select the transformed cells.
The above disadvantages are overcome to a substantial extent, by the method of positive selection, which makes it possible to selectively grow transformed cells without damaging or killing the non- transformed cells in the population and without introduction of antibiotic or herbicide resistance genes.
Many plant species do not have the innate ability to metabolise xylose and hence fail to tiirive on media where xylose is the sole carbon source. Transformation of such species with constructs carrying xylose isomerase, as selection marker, would impart the transformed cells the ability to utilize xylose as the carbon source.
Transformation and selection in sunflower: Plant Material:
For our study, we have used Helianthus annuus CMS234B - a maintainer line for 234A, an inbred line widely used as a female parent for production hybrid sunflower in India. It is a parental line of KBSHl Hybrid, a national check, short duration variety (90-100 days) with oil content of 42% used as the maintainer line for all hybrid production.
Seeds of Helianthus annuus CMS 234B were dehusked and sterilised in 70% alcohol for 2 minutes and with 0.1% Mercuric Chloride for 4 minutes. The sterilized seeds were vigorously washed 4-5 times with sterile water, followed by imbibition in water for 2 hours at 25° C in BOD. Three different explants viz., shoot apical meristem. Split embryonic axis and cotyledons were tested for their regeneration efficiency. Among these, the split embryonic axis (SEA) explants was foimd to have maximum potential for regeneration.
Isolation of Split embryonic axis explant
After sterilization of the seed, the papery translucent seed coat and the thin transparent endosperm layer within was carefully peeled away. The first cut was made through the cotyledons parallel to the line where the two cotyledons are attached to dissect the shoot meristem. The primordial leaves from the tip of the shoot apical meristem were carefully cut away, if present. The tissue containing the root meristem was removed and the last cut was made directly through the center of the shoot apical meristem. Explants were collected on moistened filter paper.
Screening for capability to utilize xylose as carbon source
In order to determine if sunflower is capable of using xylose as the carbon source, explants were cultured on regeneration media containing sucrose and xylose respectively.
100 SEA explants were isolated and cultured on Murashige and Skoog Medium (MS medium) containing 0.5mg/l BAP where the carbon source was a) 3.5% sucrose; b) 3% Xylose; c) no carbon source for 3 weeks. The effect of the carbon source on the explant was observed at the end of 3 weeks.
FIG NO 7 represents Sunflower SEA explants A) cultured on sucrose (35gm/l) B) cultured on D- Xylose (30gm/l) C) cultured on medium without any carbon source. The explants were photographed after 3 weeks.
Explants cultured in media containing xylose brown and die within 2-3 weeks. These explants look similar to explants grown in the absence of any carbon source in the medium. Thus, the sunflower CMS234B SEA explants do not appear to be able to use xylose as a carbon source.
Transformation of Sunflower using pCAMBIA-XI
Transfection with Agrobacterium
The seeds were sterilized and the split embryonic axis isolated as described earlier. Agrobacterium tumefaciens strain GV3101 harboring the binary vector pCAMBIA 1301 (carrying hpt gene) and the strain carrying vector pCAMBIA- XI were used for comparison.
Agrobacterium cells from the glycerol stock were grown overnight in Luria-Bertani (LB) medium containing Rifampicin (10/xg/ml), Gentamycin (lO^g/ml) and Kanamycin (50}xg/mi) and grown exponentially for a period of 4-6 hrs to reach O.D600 = 1.0. The cells were centrifuged at 6000 rpm for 5 min at 4°C and then washed and resuspended in MS liquid to reach an 0.D600 of 1.0. The excised explants were immediately transferred to a vacuum infiltration flask containing 25 ml of the resuspended culture. Vacuum at 200atm pressure for 15 min was applied and quickly released. The culture was then drained off completely and explants collected on a blotting paper. The explants were transferred to MS medium containing 0.5mg/l BAP+ 2gm/l sucrose) for 2days at 26°C imder dark
EXAMPLE: 6
Selection and Regeneration:
Positive Selection and Regeneration
After two days of co-cultivation, the explants were washed thoroughly with Murashige and Skoog (1972) liquid medium containing Cefotaxime 250mg/l. The explants were then transferred to MS medium containing 0.5mg/lBAP, 15gmD-Xylose, 5gm/lSucrose, 250mg/l Cefotaxime, 8gm/l Agar, pH 5.6 and kept under photoperiod of 16hr light and 8hr dark condition for 3 weeks with two rounds of subculturing. After the selection period the shoots were subcultured onto Elongation medium containing 1/2 Strength MS medium. After 2 weeks the elongated shoots were transferred to rooting medium Q/i MS medium containing O.Olmg/1 IBA). The rooted plants were hardened for 2 days in water before transferring to soil and vermiculite mixture.
Negative Selection and regeneration:
After two days of co cultivation the explants were washed thoroughly with MS medium containing 250mg/l Cefotaxime. The explants were transferred to Selection and regeneration mediimi (MS medium containing 0.5mg/lBAP, 15mg/lHygromycin, 250mg/l Cefotaxime, 30gm/lSucrose, 8gm/l Agar, pH 5.6). After the selection period the shoots were subcultured onto Elongation medium for 2 weeks (1/2 Strength MS medium). The elongated shoots were transferred to Rooting medium (1/2
Strength MS mediiim containing O.Olmg/1 IBA) and the rooted plants were subsequently transferred to soil.
Comparing Positive and negative selection:
Explants were transformed with pCAMBIA 1301 (with hpf) and pCAMBIA-XI (Xylose Isomerase replacing hpt) and selected on respective selection media containing different concentrations of hygromycin and xylose respectively. The explants surviving first selection were transferred for a second selection to the same medium for 21 days. Explants were subsequently transferred to their respective elongation media. Healthy shootlets were transferred to their respective rooting media.
The observations made are tabulated below:
A) Transformation of explants with pCAMBIA-1301; Selection on media containing Hygromycin
Cone. (mg/1) No. Of
explants
infected No. of explants surviving I
selection (15 days) No. of explants surviving I
selection (21 days) No. of explants surviving II
selection (15 days) No of PCR
+ve
explants No. of explants Regenerating into shootlets PCR +ve Regenerants
30 100 45 22 12 12 1 1
25 100 50 30 17 15 3 2
20 100 58 42 28 20 5 2
15 100 65 50 43 27 7 3
B) Transformation of explants with pCAMBIA-XI. Selection on media containing Xylose
Cone. No. Of No. of No. of No. of No of No. of PCR+ve
(mg/1) explants explants explants explants PCR explants Regenerants
infected surviving surviving surviving +ve Regenerating
I I II explants into shootlets
selection selection selection
(15 days) (21 days) (15 days)
30 100 50 38 20 18 5 5
25 100 65 55 40 28 7 6
20 100 72 65 57 30 12 7
15 100 80 70 60 28 20 10
Table 1: Transformation of sunflower SEA explants with pCAMBIA-1301 and pCAMBIA- XI
FIG NO. 8 represents Budding as observed in transformed SEA explants cultured on A) Hygromycin (25mg/l) and B) Xylose (15g/l)+Sucrose (5gm/l) after 2 weeks of selection. Hygromycin-appears to have a greater toxic effect on the explants than Xylose. The buds put forth by explants growing on Hygromycin media are seen to be stunted and hydric. They do not grow well and very few survive on elongation media. The regeneration efficiency is very low even at low concentrations of Hygromycin.
Better budding efficiencies are observed in explants selected on Xylose. More of the explants put forth normal shoot buds; these buds survive second selection better. 2-3 healthy shoots per explants are observed on positive selection as compared to 1.-2 clustered and stimted shoots on Hygromycin medium. Plantlets grown on D-Xylose medium contained 90% green tissue when compared to plantlets grown on Hygromycin. The explants also show better survival and growth on elongation media. The buds are healthy and develop into shootlets in elongation media.
We observe 2-3 fold greater numbers of regenerating plantlets using XI as against the hpt for selection. Further improvement in the efficiency of regeneration is obtained when 5g of sucrose and 15g xylose was used in the selection medium following transfection. The following is the protocol standardized for the transformation and regeneration of sunflower using positive selection:
■ Seeds of Helianthus armuus CMS 234B are dehusked and sterilised in 70% alcohol for 2 minutes followed by treatment with 0.1% Mercuric Chloride for 4 minutes.
■ The sterilized seeds are vigorously washed 4-5 times with sterile water, followed by imbibition in water for 2 hours at 25o C in BOD.
■ The cotyledons, radiciila and leaf primordial are carefully removed to expose the shoot apical meristem (SEA).
■ The SEA explants are infected with Agrobacterial culture GV3101 carrying AGT-D15-XI (OD600 =1.0)
■ Vacuum infiltrated at 200 mbar for 15 min
■ Cocultivation is done for two days on MS media containinglOOmg/1 myoinositol, 0.5 mg/1 BAP, 2g/l Sucrose, 8g/l Agar pH 5.6 for 2days.
■ The explants are washed for 15 min in MS media containing 35g/lSucrose, lOOmg/lmyoinositol, 250mg/lCefotaxime pH5.6 and blot dried.
■ Subcultured onto MS media containing lOOmg/1 myoinositol, 15g/l xylose, 2gm/l Sucrose, 0.5 mg/1 BAP, 250mg/l Cefotaxime, 8g/l Agar, pH5.6 for 3 weeks
■ Subcultured onto 1/2 MS media containing 50mg/lmyoinositol, 15g/l Sucrose, 250mg/l Cefotaxime, 8g/l Agar, pH5.6 for 1 week
■ Subcultured onto 1/2MS media containing 50mg/lmyoinositol, O.Olmg/1 IBA, 250mg/l Cefotaxime, 8g/l Agar pH 5.6
■ The plantlets are finally transferred onto pots containing Red soil (10%) and vermiculite (90%) mixture.
FIG NO. 9 represents A) SEA Explants on 1st Selection Media. B) & C) Elongation Media D) Rooting Media E) & F) Plantlets in Hardening stage.
Starting with 100 explants, 2-3 transgenic plants carrying the hpt gene are obtained on transformation with pCAMBIA-1301. However, starting with the same number of explants, 12-15 transgenic plants carrying the XI gene are obtained on transformation with pCAMBIA XI, The plantlets obtained through Hygromycin selection are very few, moreover these plantlets are very weak and do not grow into a complete plants.
EXAMPLE: 7
Molecular Analysis
Plantlets obtained after transformation were screened for the selectable marker gene by amplification with XI primers.
Xylose Isomerase- Forword Primer 5' CTCTCTCGAGCAACCATGGGTGAATTCTTTCC
Xylose Isomerase- Reverce Primer 5' GAAACTCGAGCTTGTCGATTAAGAAATGTATTGGTT-3'
Table 2. Primers used for amplification of xylose isomerase genes.
Genomic DNA isolated from transformed plantlets were amplified with the above primers. The
amplification conditions used were as follows:
DNA lOOng dNTP 200^M
Primer 0.25 jiM
MgC12HiM
lOX Buffer 2.5^1 (Bangalore Genei) Taq Polymerase lU Total Volume 25 \il
The cycling conditions used are as follows:
Amplifying Conditions Followed.
940C -3 min
940C -1 min
550C -1 min 4ocycies
720C-1.3mm
720C-I0min
FIG NO. 10 represents the Amplification of transformed SEA explants with XI primers. lOOng of genomic DNA of the selected plantlets, carrying pCAMBIA1301-XI were ampUfied with XI primers Lane 1-10: DNA samples from different explants;'+' Agrobacterium DNA; M: 1 kb ladder
Note: Amplification in 9 explants with XI primers suggesting that these samples have XI integrated in their genome.
Ca. 90% of the selected explants show integration of the XI gene into their genome as seen by amplification of the XI gene in the transformed explants.
Thus, we report a stable transformation efficiency of 12-15 % using xylose Isomerase for selection compared to the transformation efficiency of 0.2-6.2% reported with other selection markers around the world so far.
r
Thus, we prove that the use of xylose isomerase of SCI for positive selection is an efficient method for transformation of sunflower explants. This selection system is more efficient and results in larger number of transgenic plants than traditional Kanamycin and Hygromycin based systems. It also solves the problem of raising transgenics from a recalcitrant crop like sunflower to produce transgenic sunflower successfully. Finally, it also fulfills tiie demand of alternative selective markers and avoids the use of antibiotic resistance genes in the development of genetically modified plants.
Claims:
1) A method for selection and regeneration of genetically transformed oil seeds more specifically Helianthus annuus plant explants comprising:
a) Construction of a recombinant vector incorporating the nucleic acid sequence operably linked to a regulatory sequence encoding the enzyme Xylose Isomerase required for the metabolism of the selection agent xylose.
b) Agrobacterium mediated method of transformation of the said vector into the plant explants under conditions optimal for infection.
c) A step of selection of the putative transformants on MS medium containing the selection agent of step a)
d) A step of regeneration of the selected plant explants.
2) A method according to claim 1, wherein the species used is that of Helianthus annuus
3) A method according to claim 1, wherein the nucleic acid sequence encoding the enzyme Xylose Isomerase is isolated from the organism Schizochytrium represented in SEQ IDl.
4) The nucleic acid sequence according to claim 3, wherein at least one of the nucleotide sequence is modified in that the expression of the thus modified DNA occurs in the host plant explaht.
5) The nucleic acid sequence according to claim 4, wherein the sequence has been represented in the
Seq ID 3.
6) The corresponding amino acid sequence of the expressed protein according to claim 3 is represented
in Seq ID 2.
7) The nucleic acid according to claim 2, wherein the regulatory sequence is a promoter sequence.
8) A method according to any of the preceding claims, wherein the selection agent is Xylose.
9) A method according to claim 1, wherein the genetically transformed plant explants harboring the vector comprising the nucleotide sequence of claim 5, the expression of which confers a metabolic advantage to the transformed explants over the non- transformed cells.
10) A method according to claim 1, wherein both the transformed and the untransformed plant explants are selected based on the said competitive metabolic advantage of utilizing the selection agent as a carbohydrate source attributed to the expression of the enzyme by the nucleic acid of claim 5.
11) A method according to claim 1, wherein the transformation efficiency obtained is greiater than or equal to 10%.
12) A method according to claim 1, wherein the transformation efficiency obtained is greater than equal to 15%.
13) A method according to any preceding claims, wherein the regeneration efficiency is 2-3 fold as against the hygromycin based method of negative selection represented in the Table- 1 of the description.
14) A method for selection and regeneration of genetically transformed oil seess more specifically Helianthus annuus plant explants, a method wherein the genetically transformed plant explants harboring the vector comprising the nucleotide sequence, a method wherein both the transformed and the untransformed plant explants are selected based on the said competitive metabolic advantage of utilizing the selection agent and a method according to any preceding claims, wherein the regeneration efficiency is 2-3 fold as against the hygromycin based method of negative selection as substantially herein described with reference to examples and figures.
| # | Name | Date |
|---|---|---|
| 1 | 3956-CHENP-2008 FORM-13 29-07-2008.pdf | 2008-07-29 |
| 1 | 3956-CHENP-2008_EXAMREPORT.pdf | 2016-07-02 |
| 2 | 3956-CHENP-2008 EXAMINATION REPORT REPLY RECEIVED 11-04-2011.pdf | 2011-04-11 |
| 2 | 3956-CHENP-2008 CORRESPONDENCE OTHERS.pdf | 2012-06-26 |
| 3 | 3956-CHENP-2008 CORRESPONDENCE PO.pdf | 2012-06-26 |
| 3 | 3956-CHENP-2008 POWER OF ATTORNEY 11-04-2011.pdf | 2011-04-11 |
| 4 | 3956-CHENP-2008 FORM-1.pdf | 2012-06-26 |
| 4 | 3956-chenp-2008 form-13 11-04-2011.pdf | 2011-04-11 |
| 5 | 3956-CHENP-2008 FORM-13.pdf | 2012-06-26 |
| 5 | 3956-CHENP-2008 FORM-5 11-04-2011.pdf | 2011-04-11 |
| 6 | 3956-CHENP-2008 FORM-18.pdf | 2012-06-26 |
| 6 | 3956-CHENP-2008 FORM-3 11-04-2011.pdf | 2011-04-11 |
| 7 | 3956-CHENP-2008 PCT.pdf | 2012-06-26 |
| 7 | 3956-CHENP-2008 AMENDED PAGES OF SPECIFICATION 11-04-2011.pdf | 2011-04-11 |
| 8 | 3956-CHENP-2008 AMENDED CLAIMS 11-04-2011.pdf | 2011-04-11 |
| 9 | 3956-CHENP-2008 PCT.pdf | 2012-06-26 |
| 9 | 3956-CHENP-2008 AMENDED PAGES OF SPECIFICATION 11-04-2011.pdf | 2011-04-11 |
| 10 | 3956-CHENP-2008 FORM-3 11-04-2011.pdf | 2011-04-11 |
| 10 | 3956-CHENP-2008 FORM-18.pdf | 2012-06-26 |
| 11 | 3956-CHENP-2008 FORM-13.pdf | 2012-06-26 |
| 11 | 3956-CHENP-2008 FORM-5 11-04-2011.pdf | 2011-04-11 |
| 12 | 3956-CHENP-2008 FORM-1.pdf | 2012-06-26 |
| 12 | 3956-chenp-2008 form-13 11-04-2011.pdf | 2011-04-11 |
| 13 | 3956-CHENP-2008 CORRESPONDENCE PO.pdf | 2012-06-26 |
| 13 | 3956-CHENP-2008 POWER OF ATTORNEY 11-04-2011.pdf | 2011-04-11 |
| 14 | 3956-CHENP-2008 EXAMINATION REPORT REPLY RECEIVED 11-04-2011.pdf | 2011-04-11 |
| 14 | 3956-CHENP-2008 CORRESPONDENCE OTHERS.pdf | 2012-06-26 |
| 15 | 3956-CHENP-2008_EXAMREPORT.pdf | 2016-07-02 |
| 15 | 3956-CHENP-2008 FORM-13 29-07-2008.pdf | 2008-07-29 |