Sign In to Follow Application
View All Documents & Correspondence

A Method Of Increasing Amino Acid Production In Genetically Modified Cyanobacteria

Abstract: “A METHOD OF INCREASING AMINO ACID PRODUCTION IN GENETICALLY MODIFIED CYANOBACTERIA” ABSTRACT The instant disclosure is in the field of photosynthetic microorganisms and value-added products thereof. Particularly, the present disclosure relates to a method of increasing amino acid production in genetically modified/engineered cyanobacteria. Said method employs genetically modified cyanobacteria which is developed by decreasing/avoiding the expression of genes related to cyanophycin synthesis and degradation. The genetically modified cyanobacteria is advantageous in achieving high yields/synthesis of amino acids when compared to wild-type cyanobacteria comprising genes involved in cyanophycin synthesis and degradation.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
28 February 2020
Publication Number
36/2021
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
bangalore@knspartners.com
Parent Application
Patent Number
Legal Status
Grant Date
2023-04-10
Renewal Date

Applicants

RELIANCE INDUSTRIES LIMITED
3rd Floor, Maker Chamber-IV, 222, Nariman Point, Mumbai – 400 021, Maharashtra, India.

Inventors

1. SUDIP KUMAR SAMANTA
911 Jade Block, My Home Jewel, Madinaguda, Hyderabad- 500049, India.
2. NAJMUDDIN MOHD SAQUIB
Zubaida Nest, Old Azimabad Colony, Bhagirathi, PO- Mahendru, Patna-800004, India.
3. NAVISH KUMAR BATCHU
1-1-48/4/3, Plot no. 22 western part, Mohan Nagar Colony, Kothapet, Hyderabad-500035, India.
4. IPSITA DUTTA
B.C. 21/11/3 Deshbandhunagar Kolkata-700059, India.
5. PURBASHA SARKAR
Labanya Apartment, Flat B203, Road No 9, H. B. Town, Sodepur, Kolkata- 700110, India
6. VENKATESH PRASAD
289 29th Main, 11th cross, I Phase JPNagar, Bangalore-560078, India.
7. SANTANU DASGUPTA
Glen Classic, Apt-2502, Hiranandani Gardens, Powai, Mumbai-400076, India.

Specification

Claims:I/WE CLAIM:

1) A method of increasing production of amino acid in cyanobacteria, said method comprising culturing a genetically modified cyanobacteria in which genes encoding cyanophycin synthetase (CphA) and cyanophycinase (CphB) proteins are knocked out, to achieve increased production of the amino acid.
2) The method according to claim 1, wherein the method increases production of both intracellular amino acid and extracellular amino acid.
3) The method according to claim 1, wherein the amino acid is selected from a group comprising threonine, alanine, L-proline, lysine, glycine, glutamic acid and combinations thereof.
4) The method according to claim 1, wherein the genetically modified cyanobacteria comprising cyanophycin synthetase (cphA) and cyanophycinase (cphB) knock-out is selected from a group comprising Cyanobacterium sp., Anabaena sp., Crocosphaera sp., Geitlerinema sp., Geminocystis sp., Leptolyngbya sp., Microcystis sp., Nostoc sp., Nostocaceae sp., Synechococcus sp., Synechocystis sp., Thermosynechococcus sp. and combinations thereof.
5) The method according to claim 1, wherein the genetically modified cyanobacteria comprising cyanophycin synthetase (cphA) and cyanophycinase (cphB) knock-out is selected from a group comprising Cyanobacterium aponinum (Accession No. CCAP 1455/2), Cyanobacterium aponinum PCC 10605, Cyanobacterium stanieri PCC 7202, Anabaena sp. 4-3, Anabaena sp. PCC 7108, Anabena variabilis ATCC 29413, Crocosphaera watsonii WH 8502, Geitlerinema sp. FC II, Geitlerinema sp. PCC 7407, Geminocystis sp. NIES-3708, Geminocystis sp. NIES-3709, Leptolyngbya sp. PCC 7376, Microcystis aeruginosa NIES-2481, Nostoc ellipsosporum NE1, Nostoc sp. NIES-2111, Nostoc sp. PCC 7524, Synechococcus elongatus, Synechococcus lividus, Synechococcus sp. BDU 130192, Synechococcus sp. NKBG042902, Synechococcus sp. PCC 6312, Synechococcus sp. PCC 7002, Synechocystis sp. PCC 6308, Synechocystis sp. PCC 6803, Thermosynechococcus sp. NK55a, Anabaena cylindrica PCC 7122, Synechocystis sp. PCC 6714, Crocosphaera watsonii WH 0401, Thermosynechococcus elongatus BP-1 and combinations thereof.
6) The method according to claim 1, wherein the gene encoding the cyanophycin synthetase (cphA) has a nucleotide sequence selected from a group comprising SEQ ID No. 1, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32, SEQ ID No. 34, SEQ ID No. 36, SEQ ID No. 38, SEQ ID No. 40, SEQ ID No. 42, SEQ ID No. 44, SEQ ID No. 46, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 52, SEQ ID No. 54, SEQ ID No. 56, SEQ ID No. 58, SEQ ID No. 60, SEQ ID No. 62, SEQ ID No. 64, SEQ ID No. 66, SEQ ID No. 68 and SEQ ID No. 70; or wherein the gene encoding the cyanophycin synthetase (cphA) has a nucleotide sequence which is at least 60%, 70%, 80%, 90% or 95% identical to any of the said SEQ ID No. 1, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32, SEQ ID No. 34, SEQ ID No. 36, SEQ ID No. 38, SEQ ID No. 40, SEQ ID No. 42, SEQ ID No. 44, SEQ ID No. 46, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 52, SEQ ID No. 54, SEQ ID No. 56, SEQ ID No. 58, SEQ ID No. 60, SEQ ID No. 62, SEQ ID No. 64, SEQ ID No. 66, SEQ ID No. 68 or SEQ ID No. 70.
7) The method according to claim 1, wherein the gene encoding the cyanophycinase (cphB) has a nucleotide sequence selected from a group comprising SEQ ID No. 3, SEQ ID No. 72, SEQ ID No. 74, SEQ ID No. 76, SEQ ID No. 78, SEQ ID No. 80, SEQ ID No. 82, SEQ ID No. 84, SEQ ID No. 86, SEQ ID No. 88, SEQ ID No. 90, SEQ ID No. 92, SEQ ID No. 94, SEQ ID No. 96, SEQ ID No. 98, SEQ ID No. 100, SEQ ID No. 102, SEQ ID No. 104, SEQ ID No. 106, SEQ ID No. 108, SEQ ID No. 110, SEQ ID No. 112, SEQ ID No. 114, SEQ ID No. 116, SEQ ID No. 118, SEQ ID No. 120, SEQ ID No. 122, SEQ ID No. 124 and SEQ ID No. 126; or wherein the gene encoding the cyanophycinase (cphB) has a nucleotide sequence which is at least 60%, 70%, 80%, 90% or 95% identical to any of the said SEQ ID No. 3, SEQ ID No. 72, SEQ ID No. 74, SEQ ID No. 76, SEQ ID No. 78, SEQ ID No. 80, SEQ ID No. 82, SEQ ID No. 84, SEQ ID No. 86, SEQ ID No. 88, SEQ ID No. 90, SEQ ID No. 92, SEQ ID No. 94, SEQ ID No. 96, SEQ ID No. 98, SEQ ID No. 100, SEQ ID No. 102, SEQ ID No. 104, SEQ ID No. 106, SEQ ID No. 108, SEQ ID No. 110, SEQ ID No. 112, SEQ ID No. 114, SEQ ID No. 116, SEQ ID No. 118, SEQ ID No. 120, SEQ ID No. 122, SEQ ID No. 124 or SEQ ID No. 126.
8) The method according to claim 1, wherein the genetically modified cyanobacteria is Cyanobacterium aponinum (Accession No. CCAP 1455/2) comprising knock-out of SEQ ID No. 1 and SEQ ID No. 3.
9) The method according to claim 1, wherein the knockout of the cphA and cphB genes inactivate cyanophycin synthesis pathway in the genetically modified cyanobacteria, thereby preventing or reducing the formation of cyanophycin.
10) The method according to claim 1, wherein the genetically modified cyanobacteria achieves increased amino acid production relative to corresponding wild-type cyanobacteria.
11) The method according to claim 1, wherein the method comprises culturing the genetically modified cyanobacteria at a temperature ranging from about 16°C to 52°C and for a time-period ranging from about 12 hours to 28 days.
12) The method according to claim 1, wherein culturing of the genetically modified cyanobacteria is carried out at a relative humidity of about 20% to 75%.
13) The method according to claim 1, wherein culturing of the genetically modified cyanobacteria is carried out by employing a CO2 air mixture of about 0% to 5% (v/v) CO2 in air.
14) The method according to claim 1, wherein culturing of the genetically modified cyanobacterium is carried out at a pH of about 6 to 10.
15) The method according to claim 1, wherein culturing of the genetically modified cyanobacterium is carried out at a light intensity of about 50 µmol/m2/s to 2000 µmol/m2/s.
16) The method according to claim 1, wherein the genetically modified cyanobacterium is cultured under batch mode, fed-batch mode, semi-turbidostatic mode, or any combinations thereof.
17) A genetically modified Cyanobacterium aponinum having Accession No. CCAP 1455/2 and comprising knock-out of SEQ ID No. 1 and SEQ ID No. 3.
, Description:TECHNICAL FIELD
[001]. The instant disclosure relates to the field of photosynthetic microorganisms and value-added products thereof. Particularly, the present disclosure relates to a method of increasing amino acid production in genetically modified/engineered cyanobacteria.

BACKGROUND
[002]. In cyanobacteria, oxygenic photosynthesis and the CO2 fixation are known to be closely related to nitrogen assimilation process [Flores E, et al. 2005. Photosynth Res. 83:117–133]. The assimilation of nitrate to ammonium is a primary step for the nitrogen cycle in the biosphere and the entire process of conversion of nitrate to nitrite and finally to ammonium is an energy dependent mechanism. Nitrate reductase and nitrite reductase are two sequential enzymes required to accomplish the complete conversion of nitrate to ammonium via nitrite [Ohashi Y, et al. 2011. J Exp Bot. 62: 1411–1424]. The ammonium is incorporated into carbon skeletons via glutamine synthetase/glutamate synthase (GS/GOGAT) cycle.
[003]. Nitrogen assimilation and its regulation has been extensively studied among living organisms for nitrogen control [Leigh JA, Dodsworth JA. 2007. Annu Rev Microbiol 61: 349–377]. In many cyanobacteria, the assimilated nitrogen is accumulated in the form of cell inclusion body known as cyanophycin granules. Cyanophycin is a non-ribosomally synthesized polypeptide that consists of a poly-a-aspartic acid peptidic backbone with arginine linked via isopeptide bonds to the ß-carboxyl group of each aspartic acid in the backbone (multi-L-arginyl-poly[L-aspartic acid] [Simon RD. 1971. Proc. Natl. Acad. Sci. U. S. A. 68: 265–267]. Cyanophycin is synthesized by cyanophycin synthetase (CphA) and degraded by cyanophycinase (CphB) [Ziegler K, et al. 1998. Eur. J. Biochem. 254: 154–159; Richter R, et al. 1999. Eur. J. Biochem. 263: 163–169]. Cyanophycin is a nitrogen storage polymer given its relatively high N (nitrogen) to C (carbon) ratio. The size of cyanophycin granule generally varies between 25 to 100 kDa and soluble in mild acids [Simon RD, and Weathers P. 1976. Biochim. Biophys. Acta 420: 165–176].
[004]. Since cyanobacteria accumulates significant amount of cyanophycin as storage, there is a need to channelize this storage and enable the cells to synthesize industrially important products, for instance amino acids. The present disclosure tries to achieve the same by developing methods to induce/enhance the formation of value added-products such as amino acids in cyanobacteria.

SUMMARY
[005]. The present disclosure relates to a method of increasing production of amino acid in cyanobacteria.

[006]. In an embodiment of the present disclosure, the method comprises culturing genetically modified cyanobacteria in which genes encoding cyanophycin synthetase (cphA) and cyanophycinase (cphB) proteins are knocked out, to achieve increased production of the amino acid.
[007]. In another embodiment of the present disclosure, the method produces amino acid selected from a group comprising threonine, alanine, L-proline, lysine, glycine, glutamic acid and combinations thereof.
[008]. In yet another embodiment of the present disclosure, the genetically modified cyanobacteria comprising cyanophycin synthetase (cphA) and cyanophycinase (cphB) knock-out is selected from a group comprising Cyanobacterium sp., Anabaena sp., Crocosphaera sp., Geitlerinema sp., Geminocystis sp., Leptolyngbya sp., Microcystis sp., Nostoc sp., Nostocaceae sp., Synechococcus sp., Synechocystis sp., Thermosynechococcus sp. and combinations thereof.
[009]. In a preferred embodiment of the present disclosure, the genetically modified cyanobacterium is Cyanobacterium aponinum (Accession No. CCAP 1455/2).
[0010]. In another embodiment of the present disclosure, the genetically modified cyanobacteria achieves increased amino acid production relative to the corresponding wild-type cyanobacteria.

BRIEF DESCRIPTION OF THE ACCOMPANYING FIGURES
[0011]. In order that the disclosure may be readily understood and put into practical effect, reference will now be made to exemplary embodiments as illustrated with reference to the accompanying figures. The figures together with detailed description below, are incorporated in and form part of the specification, and serve to further illustrate the embodiments and explain various principles and advantages, where:
[0012]. Figure 1 depicts the structure of cyanophycin granule polypeptide (CGP).
[0013]. Figure 2 depicts the metabolic pathway leading to the formation of cyanophycin storage molecules and selected amino acids.
[0014]. Figure 3 depicts the design of the knock-out vector plasmid pKO-cphA-cphB for deletion of cphA and cphB genes in cyanobacteria.
[0015]. Figure 4 depicts agarose gel images as a confirmation of the pKO-cphA-cphB construct. A) shows the result of a PCR with primers SS95F (SEQ ID No. 6) and SS102R (SEQ ID No. 9) using pKO-cphA-cphB as template, with a band of the expected size 3.2 kb, and B) shows the result of a restriction digestion experiment with the same plasmid with undigested plasmid (lane U), ScaI digestion (lane S, 6.2 kb), and XbaI digestion (lane D, 4.1 kb and 2.1 kb).
[0016]. Figure 5 depicts agarose gel image confirming the complete segregation of recombinant Cyanobacterium aponinum strain (Accession No. CCAP 1455/2). The figure shows the result of a PCR using SS95 F (SEQ ID No. 6) and SS102 R (SEQ ID No. 9) with plasmid pKO-cphA-cphB, cphA-cphB knock-out Cyanobacterium aponinum strain (Accession No. CCAP 1455/2) and the corresponding wild-type (WT) Cyanobacterium aponinum strain.
[0017]. Figure 6 depicts a graph illustrating the comparison of growth kinetics of wild-type (WT) Cyanobacterium aponinum strain and recombinant Cyanobacterium aponinum strain (Accession No. CCAP 1455/2) grown in multi-cultivator (PSI-multi-cultivator MC 1000). Each value of growth data point is mean ± SD of at least 3 biological replicates.
[0018]. Figure 7 depicts a graph illustrating the TEM analysis of the wild-type (WT) Cyanobacterium aponinum strain and recombinant Cyanobacterium aponinum strain (Accession No. CCAP 1455/2). Titan G2 TEM (Thermo Fisher Scientific) was employed for capturing the image. EDX (energy dispersive X-ray spectroscopy) detector (Bruker) was used for nitrogen mapping.
[0019]. Figure 8 depicts: A) a graph illustrating the comparative accumulation of cyanophycin in the wild-type (WT) Cyanobacterium aponinum strain and recombinant Cyanobacterium aponinum strain (Accession No. CCAP 1455/2). Data is represented as the mean ± SD of at least 3 biological replicates. B) A graph illustrating the total arginine and aspartic acid content in biomass as well as in free-form in the wild-type and corresponding recombinant Cyanobacterium aponinum strains. Data is represented as mean ± SD of at least 3 biological replicates.
[0020]. Figure 9 depicts a graph illustrating the estimation of L-proline, glycine and alanine in biomass in the wild-type (WT) Cyanobacterium aponinum strain and recombinant Cyanobacterium aponinum strain (Accession No. CCAP 1455/2). Data is normalized with biomass weight. Data is represented as mean ± SD of at least 3 biological replicates.
[0021]. Figure 10 depicts a graph illustrating the availability of intracellular free threonine, alanine, L-proline and lysine in the wild-type (WT) Cyanobacterium aponinum strain and recombinant Cyanobacterium aponinum strain (Accession No. CCAP 1455/2). Data is represented as mean ± SD of at least 3 biological replicates.
[0022]. Figure 11 depicts a graph illustrating the availability of extracellular glutamic acid and alanine in the wild-type (WT) Cyanobacterium aponinum strain and recombinant Cyanobacterium aponinum strain (Accession No. CCAP 1455/2). Data is represented as mean ± SD of at least 3 biological replicates.
[0023]. Figure 12 depicts the phylogeny of cyanophycin synthetase (cphA), constructed using neighbor-joining method with bootstrap replicates of 500.
[0024]. Figure 13 depicts the phylogeny of cyanophycinase (cphB), constructed using neighbor-joining method with bootstrap replicates of 500.

DESCRIPTION
[0025]. To achieve the needs as stated in the background, the present disclosure provides a method for increased production of amino acids in cyanobacteria.
[0026]. More particularly, the present disclosure provides a method for increased production of amino acids in genetically modified cyanobacteria.
[0027]. In an embodiment, the method of the present disclosure employs a genetically modified cyanobacteria wherein genes responsible for cyanophycin synthesis/elongation and cyanophycin degradation have been knocked out or deleted.
[0028]. In an exemplary embodiment, the present disclosure provides a method of increased production of amino acids in a genetically modified cyanobacteria comprising cyanophycin synthetase (cphA) and cyanophycinase (cphB) genes knocked out or deleted.
[0029]. As used herein, the terms ‘knockout’ or ‘knock out’ or ‘knocked out’ refer to the genetic technique in which a gene(s) is deleted or made inoperative.
[0030]. The present invention particularly relates to a method of increasing production of amino acid in cyanobacteria, said method comprising culturing a genetically modified or recombinant cyanobacteria wherein genes encoding cyanophycin synthetase (cphA) and cyanophycinase (cphB) are knocked out.
[0031]. In an embodiment of the present disclosure, the present method achieves increased production of both intracellular amino acids and extracellular amino acids.
[0032]. In an embodiment of the present disclosure, the present method achieves increased production of amino acid selected from a group comprising threonine, alanine, L-proline, lysine, glycine, glutamic acid and combinations thereof.
[0033]. In an embodiment of the present method, the amino acid is threonine.
[0034]. In another embodiment of the present method, the amino acid is alanine.
[0035]. In yet another embodiment of the present method, the amino acid is L-proline.
[0036]. In still another embodiment of the present method, the amino acid is lysine.
[0037]. In still embodiment of the present method, the amino acid is glycine.
[0038]. In still another embodiment of the present method, the amino acid is glutamic acid.
[0039]. In an embodiment of the present method, the genetically modified cyanobacteria comprising knock-out of cyanophycin synthetase (cphA) and cyanophycinase (cphB) genes is selected from a group comprising Cyanobacterium sp., Anabaena sp., Crocosphaera sp., Geitlerinema sp., Geminocystis sp., Leptolyngbya sp., Microcystis sp., Nostoc sp., Nostocaceae sp., Synechococcus sp., Synechocystis sp., Thermosynechococcus sp. and combinations thereof.
[0040]. In yet another embodiment of the present method, the genetically modified cyanobacteria comprising knock-out of cyanophycin synthetase (cphA) and cyanophycinase (cphB) genes is selected from a group comprising Cyanobacterium aponinum (Accession No. CCAP 1455/2), Cyanobacterium aponinum PCC 10605, Cyanobacterium stanieri PCC 7202, Anabaena sp. 4-3, Anabaena sp. PCC 7108, Anabena variabilis ATCC 29413, Crocosphaera watsonii WH 8502, Geitlerinema sp. FC II, Geitlerinema sp. PCC 7407, Geminocystis sp. NIES-3708, Geminocystis sp. NIES-3709, Leptolyngbya sp. PCC 7376, Microcystis aeruginosa NIES-2481, Nostoc ellipsosporum NE1, Nostoc sp. NIES-2111, Nostoc sp. PCC 7524, Synechococcus elongatus, Synechococcus lividus, Synechococcus sp. BDU 130192, Synechococcus sp. NKBG042902, Synechococcus sp. PCC 6312, Synechococcus sp. PCC 7002, Synechocystis sp. PCC 6308, Synechocystis sp. PCC 6803, Thermosynechococcus sp. NK55a, Cyanobacterium aponinum PCC 10605, Synechococcus elongatus PCC 6301, PCC 7942, Synechococcus sp. PCC 7002, Cyanobacterium stanieri PCC 7202, Anabaena cylindrica PCC 7122, Synechocystis sp. PCC 6714, Crocosphaera watsonii WH 0401, Thermosynechococcus elongatus BP-1 and combinations thereof.
[0041]. In another embodiment of the present method, the genetically modified recombinant cyanobacteria achieves enhanced amino acid production relative to corresponding wild-type/parent cyanobacteria.
[0042]. In yet another embodiment of the present method, culturing the genetically modified recombinant cyanobacteria is carried out at a temperature from about 16?C to 52?C.
[0043]. In still another embodiment of the present method, culturing the genetically modified recombinant cyanobacteria is carried out for a time-period ranging from about 12 hours to 28 days.
[0044]. In still another embodiment of the present method, culturing the genetically modified recombinant cyanobacteria is carried out at a relative humidity of about 20% to 75%.
[0045]. In still another embodiment of the present method, culturing the genetically modified recombinant cyanobacteria is carried out by employing a CO2/air mixture of about 0% to 5% (v/v) CO2 in air.
[0046]. In still another embodiment of the present method, culturing the genetically modified recombinant cyanobacteria is carried out pH of about 6 to 10.
[0047]. In still another embodiment of the present method, culturing the genetically modified cyanobacteria is carried out at a light intensity of about 50 µmol/m2/s to 2000 µmol/m2/s.
[0048]. In still another embodiment of the present method, said method comprises culturing the genetically modified recombinant cyanobacteria described herein under batch mode, fed-batch mode, semi-turbidostatic mode, or any combinations thereof.
[0049]. In an exemplary embodiment, the present method comprises culturing the genetically modified recombinant cyanobacteria described herein under batch mode of cultivation.
[0050]. In another exemplary embodiment, the present method comprises culturing the genetically modified recombinant cyanobacteria described herein under semi-turbidostatic mode of cultivation.
[0051]. In yet another exemplary embodiment, the present method comprises culturing the genetically modified recombinant cyanobacteria described herein under fed-batch mode of cultivation.
[0052]. In an embodiment, the present method of culturing the genetically modified recombinant cyanobacterium for increased amino acid production employs BG-11 culture medium.
[0053]. In an exemplary embodiment, the BG-11 culture medium comprises 17.65 mM NaNO3, 0.18 mM K2HPO4, 0.3 mM MgSO4, 0.25 mM CaCl2, 0.03 mM citric acid, 0.03 mM ferric ammonium citrate, 0.003 mM EDTA, 0.19 mM Na2CO3, 2.86 mg/L H3BO3, 1.81 mg/L MnCl2, 0.222 mg/L ZnSO4, 0.390 mg/L Na2MoO4, 0.079 mg/L CuSO4, and 0.049 mg/L Co(NO3)2 at pH 7.4.
[0054]. In another embodiment of the present method, said BG-11 medium is supplemented with sodium bicarbonate. In specific embodiments, the concentrations of bicarbonate ranges from about 5 mM to 20 mM.
[0055]. In yet another embodiment of the present method, the achieved increase in amino acid yield in biomass by employing the genetically modified recombinant cyanobacteria described herein is about 5 mole % to 500 mole % relative to the yield achieved by the corresponding wild-type/parent cyanobacteria.
[0056]. In an embodiment, mole percentage (mole %) is defined as the percentage of the total moles of a particular component. In another embodiment, to calculate mole percent, the percentage abundance of the component (amino acid in the present case) is first calculated as per 100 g of total abundance. To achieve this, the individual amino acid percentage abundance is multiplied by 100, then divided by the total percentage abundance (sum of all the individual amino acid percentage abundance). Thereafter, this value is converted to the number of moles by dividing by the respective molecular weight of the amino acid. Finally, the number of moles is converted to mole percent by dividing the number of moles of individual amino acids with the total number of moles. Multiplication of 100 to the resultant value would represent the mole percentage.
[0057]. In another embodiment of the present disclosure, the enhancement in the yield of free form amino acids by employing the genetically modified cyanobacterium described herein is about 5 mole % to 500 mole % relative to the yield achieved by the corresponding wild-type/parent cyanobacteria.
[0058]. In an exemplary embodiment of the present disclosure, cyanophycin synthetase (CphA) nucleotide and amino acid sequences from various cyanobacterial species is tabulated in Table 1.

Table 1: Cyanophcyin synthetase (CphA) nucleotide and protein sequences of various cyanobacterial species
Seq ID No. Accession ID Organism
1 - Cyanobacterium aponinum wild-type (WT)
2 - Cyanobacterium aponinum wild-type (WT)
10 Cyan10605_2875 Cyanobacterium aponinum PCC10605
11 AFZ54941.1 Cyanobacterium aponinum PCC10605
12 SYNPCC7002_RS11920 Synechococcus sp. PCC 7002
13 WP_012308001.1 Synechococcus sp. PCC 7002
14 MYO_RS06805 Synechocystis sp. PCC 6803
15 WP_010872519.1 Synechocystis sp. PCC 6803
16 Cyast_1640 Cyanobacterium stanieri PCC 7202
17 AFZ47601.1 Cyanobacterium stanieri PCC 7202
18 AJ288949.1 Synechococcus elongatus
19 CAC07987.1 Synechococcus elongatus
20 A3775_RS16235 Anabaena Sp. 4-3
21 WP_066425864.1 Anabaena Sp. 4-3
22 ANA7108_RS0110275 Anabaena Sp. PCC 7108
23 WP_026104098.1 Anabaena Sp. PCC 7108
24 AJ005201.1 Anabaena variabilis ATCC 29413
25 CAA06440.1 Anabaena variabilis ATCC 29413
26 CWATWH8502_RS00990 Crocosphaera watsonii WH 8502
27 WP_021829122.1 Crocosphaera watsonii WH 8502
28 CKA32_002190 Geitlerinema sp. FC II
29 PPT07000.1 Geitlerinema sp. FC II
30 GEI7407_0857 Geitlerinema sp. PCC7407
31 AFY65355.1 Geitlerinema sp. PCC7407
32 GM3708_1708 Geminocystis sp. NIES-3708
33 WP_066345513.1 Geminocystis sp. NIES-3708
34 GM3709_248 Geminocystis sp. NIES-3709
35 WP_066115487.1 Geminocystis sp. NIES-3709
36 Lepto7376_2228 Leptolyngbya sp. PCC 7376
37 WP_015134280.1 Leptolyngbya sp. PCC 7376
38 amyaer_0558 Microcystis aeruginosa NIES-2481
39 WP_046660864.1 Microcystis aeruginosa NIES-2481
40 EF660551.1 Nostoc ellipsosporum NE1
41 ABV22544.1 Nostoc ellipsosporum NE1
42 CA737_RS25720 Nostoc sp. NIES-2111
43 WP_096682252.1 Nostoc sp. NIES-2111
44 NOS7524_RS23595 Nostoc sp. PCC 7524
45 WP_015140990.1 Nostoc sp. PCC 7524
46 BRW62_RS03600 Synechococcus lividus
47 WP_099798311.1 Synechococcus lividus
48 CQS05_RS04460 Synechococcus sp. BDU 130192
49 WP_099238420.1 Synechococcus sp. BDU 130192
50 BG2_RS07535 Synechococcus sp. NKBG042902
51 WP_030006893.1 Synechococcus sp. NKBG042902
52 AF220099.2 Synechocystis PCC6308
53 P56947.2 Synechocystis PCC6308
54 NK55_RS07630 Thermosynechococcus sp. NK55a
55 WP_024125181.1 Thermosynechococcus sp. NK55a
56 AVA_RS01280 Anabaena variabilis ATCC 29413
57 WP_011317145.1 Anabaena variabilis ATCC 29413
58 AVA_RS01680 Anabaena variabilis ATCC 29413
59 WP_011317220.1 Anabaena variabilis ATCC 29413
60 CA737_RS07810 Nostoc sp. NIES-2111
61 WP_067771316.1 Nostoc sp. NIES-2111
62 ANACY_RS13135 Anabaena cylindrica PCC 7122
63 WP_015214723.1 Anabaena cylindrica PCC 7122
64 SYN6312_RS06220 Synechococcus sp. PCC 6312
65 WP_015124012.1 Synechococcus sp. PCC 6312
66 D082_RS13700 Synechocystis sp. PCC 6714
67 WP_028947105.1 Synechocystis sp. PCC 6714
68 CWATWH0401_RS10045 Crocosphaera watsonii WH 0401
69 WP_048315319.1 Crocosphaera watsonii WH 0401
70 tlr2170 Thermosynechococcus elongatus BP-1
71 NP_682960.1 Thermosynechococcus elongatus BP-1

[0059]. In another exemplary embodiment of the present disclosure, cyanophycinase (CphB) nucleotide and amino acid sequences from various cyanobacterial species is tabulated in Table 2.

Table 2: Cyanophcyinase (CphB) nucleotide and protein sequences of various cyanobacterial species
Seq ID No. Accession ID Organism
3 - Cyanobacterium aponinum wild-type (WT)
4 - Cyanobacterium aponinum wild-type (WT)
72 Cyan10605_2874 Cyanobacterium aponinum PCC10605
73 WP_015220662.1 Cyanobacterium aponinum PCC10605
74 SYNPCC7002_RS11925 Synechococcus sp. PCC 7002
75 WP_012308002.1 Synechococcus sp. PCC 7002
76 SGL_RS08655 Synechocystis sp. PCC 6803
77 WP_010872518.1 Synechocystis sp. PCC 6803
78 Cyast_1641 Cyanobacterium stanieri PCC 7202
79 AFZ47602.1 Cyanobacterium stanieri PCC 7202
80 AJ288949.1 Synechococcus elongatus
81 CAC07986.1 Synechococcus elongatus
82 1811979.6.peg.3704 Anabaena Sp. 4-3
83 1811979.6.peg.3704 Anabaena Sp. 4-3
84 NZ_KB235896.1 Anabaena Sp. PCC 7108
85 WP_016950702.1 Anabaena Sp. PCC 7108
86 AVA_RS01690 Anabaena variabilis ATCC 29413
87 WP_011317222.1 Anabaena variabilis ATCC 29413
88 NZ_CAQK01000040.1 Crocosphaera watsonii WH 8502
89 WP_007308443.1 Crocosphaera watsonii WH 8502
90 NRIU01002552.1 Geitlerinema sp. FC II
91 PPT05392.1 Geitlerinema sp. FC II
92 GEI7407_RS04395 Geitlerinema sp. PCC7407
93 WP_015170923.1 Geitlerinema sp. PCC7407
94 NZ_AP014815.1 Geminocystis sp. NIES-3708
95 WP_066345515.1 Geminocystis sp. NIES-3708
96 GM3709_RS01190 Geminocystis sp. NIES-3709
97 WP_066115489.1 Geminocystis sp. NIES-3709
98 LEPTO7376_RS11150 Leptolyngbya sp. PCC 7376
99 WP_015134279.1 Leptolyngbya sp. PCC 7376
100 amyaer_RS02730 Microcystis aeruginosa NIES-2481
101 WP_046660862.1 Microcystis aeruginosa NIES-2481
102 CA737_RS25725 Nostoc sp. NIES-2111
103 WP_067763727.1 Nostoc sp. NIES-2111
104 NOS7524_RS01760 Nostoc sp. PCC 7524
105 WP_015136734.1 Nostoc sp. PCC 7524
106 BRW62_RS03595 Synechococcus lividus
107 WP_099798310.1 Synechococcus lividus
108 CQS05_RS04465 Synechococcus sp. BDU 130192
109 WP_012308002.1 Synechococcus sp. BDU 130192
110 BG2_RS07540 Synechococcus sp. NKBG042902
111 WP_012308002.1 Synechococcus sp. NKBG042902
112 SYN6308_RS13960 Synechocystis PCC6308
113 WP_017295072.1 Synechocystis PCC6308
114 NOS7524_RS23600 Nostoc sp. PCC 7524
115 WP_015140991.1 Nostoc sp. PCC 7524
116 amyaer_RS11150 Microcystis aeruginosa NIES-2481
117 WP_046662142.1 Microcystis aeruginosa NIES-2481
118 tlr2169 Thermosynechococcus elongatus BP-1
119 NP_682959.1 Thermosynechococcus elongatus BP-1
120 ANACY_RS13130 Anabaena cylindrica PCC 7122
121 WP_015214722.1 Anabaena cylindrica PCC 7122
122 NC_019680.1 Synechococcus sp. PCC 6312
123 WP_015124011 Synechococcus sp. PCC 6312
124 D082_RS13705 Synechocystis sp. PCC 6714
125 WP_038530995.1 Synechocystis sp. PCC 6714
126 CWATWH0401_RS10050 Crocosphaera watsonii WH 0401
127 WP_007308443.1 Crocosphaera watsonii WH 0401

[0060]. In yet another embodiment of the present disclosure, the CphA nucleotide sequences (listed in Table 1) and CphB nucleotide sequences (listed in Table 2) are knocked-out to develop respective double knock-out (CphA and CphB knock-out) cyanobacterial strains which can be employed in the method of increasing production of amino acids described herein.
[0061]. In a preferred embodiment of the present disclosure, the genetically modified cyanobacteria is Cyanobacterium aponinum.
[0062]. In an exemplary embodiment of the present disclosure, the genetically modified cyanobacteria is Cyanobacterium aponinum having Accession No. CCAP 1455/2, and comprises knock-out of CphA (SEQ ID No. 1) and CphB (SEQ ID No. 3) genes.
[0063]. In an exemplary embodiment of the present disclosure, the gene encoding cyanophycin synthetase (CphA) has a nucleotide sequence set forth as SEQ ID No. 1.
[0064]. In another embodiment of the present disclosure, cyanophycin synthetase (CphA) has an amino acid sequence set forth as SEQ ID No. 2.
[0065]. In an exemplary embodiment of the present disclosure, the gene encoding cyanophycinase (CphB) has a nucleotide sequence set forth as SEQ ID No. 3.
[0066]. In another embodiment of the present disclosure, the cyanophycinase (CphB) has an amino acid sequence set forth as SEQ ID No. 4.
[0067]. In some embodiments of the present disclosure, the cyanophycin synthetase (cphA) gene has a nucleotide sequence selected from a group comprising SEQ ID No. 1, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32, SEQ ID No. 34, SEQ ID No. 36, SEQ ID No. 38, SEQ ID No. 40, SEQ ID No. 42, SEQ ID No. 44, SEQ ID No. 46, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 52, SEQ ID No. 54, SEQ ID No. 56, SEQ ID No. 58, SEQ ID No. 60, SEQ ID No. 62, SEQ ID No. 64, SEQ ID No. 66, SEQ ID No. 68 and SEQ ID No. 70.
[0068]. In other embodiments of the present disclosure, the cyanophycin synthetase (cphA) gene has a nucleotide sequence which is at least 60%, 70%, 80%, 90% or 95% identical to any of the SEQ ID No. 1, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24, SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30, SEQ ID No. 32, SEQ ID No. 34, SEQ ID No. 36, SEQ ID No. 38, SEQ ID No. 40, SEQ ID No. 42, SEQ ID No. 44, SEQ ID No. 46, SEQ ID No. 48, SEQ ID No. 50, SEQ ID No. 52, SEQ ID No. 54, SEQ ID No. 56, SEQ ID No. 58, SEQ ID No. 60, SEQ ID No. 62, SEQ ID No. 64, SEQ ID No. 66, SEQ ID No. 68, or SEQ ID No. 70.
[0069]. In an embodiment of the present disclosure, the cyanophycin synthetase (cphA) protein has an amino acid sequence selected from a group comprising SEQ ID No. 2, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23, SEQ ID No. 25, SEQ ID No. 27, SEQ ID No. 29, SEQ ID No. 31, SEQ ID No. 33, SEQ ID No. 35, SEQ ID No. 37, SEQ ID No. 39, SEQ ID No. 41, SEQ ID No. 43, SEQ ID No. 45, SEQ ID No. 47, SEQ ID No. 49, SEQ ID No. 51, SEQ ID No. 53, SEQ ID No. 55, SEQ ID No. 57, SEQ ID No. 59, SEQ ID No. 61, SEQ ID No. 63, SEQ ID No. 65, SEQ ID No. 67, SEQ ID No. 69 and SEQ ID No. 71.
[0070]. In another embodiment of the present disclosure, the cyanophycin synthetase (cphA) protein has an amino acid sequence which is at least 60%, 70%, 80%, 90% or 95% identical to any of the SEQ ID No. 2, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23, SEQ ID No. 25, SEQ ID No. 27, SEQ ID No. 29, SEQ ID No. 31, SEQ ID No. 33, SEQ ID No. 35, SEQ ID No. 37, SEQ ID No. 39, SEQ ID No. 41, SEQ ID No. 43, SEQ ID No. 45, SEQ ID No. 47, SEQ ID No. 49, SEQ ID No. 51, SEQ ID No. 53, SEQ ID No. 55, SEQ ID No. 57, SEQ ID No. 59, SEQ ID No. 61, SEQ ID No. 63, SEQ ID No. 65, SEQ ID No. 67, SEQ ID No. 69, or SEQ ID No. 71.
[0071]. In some embodiments of the present disclosure, the cyanophycinase (cphB) gene has a nucleotide sequence selected from a group comprising SEQ ID No. 3, SEQ ID No. 72, SEQ ID No. 74, SEQ ID No. 76, SEQ ID No. 78, SEQ ID No. 80, SEQ ID No. 82, SEQ ID No. 84, SEQ ID No. 86, SEQ ID No. 88, SEQ ID No. 90, SEQ ID No. 92, SEQ ID No. 94, SEQ ID No. 96, SEQ ID No. 98, SEQ ID No. 100, SEQ ID No. 102, SEQ ID No. 104, SEQ ID No. 106, SEQ ID No. 108, SEQ ID No. 110, SEQ ID No. 112, SEQ ID No. 114, SEQ ID No. 116, SEQ ID No. 118, SEQ ID No. 120, SEQ ID No. 122, SEQ ID No. 124 and SEQ ID No. 126.
[0072]. In other embodiments of the present disclosure, the cyanophycinase (cphB) gene has a nucleotide sequence which is at least 60%, 70%, 80%, 90% or 95% identical to any of the SEQ ID No. 3, SEQ ID No. 72, SEQ ID No. 74, SEQ ID No. 76, SEQ ID No. 78, SEQ ID No. 80, SEQ ID No. 82, SEQ ID No. 84, SEQ ID No. 86, SEQ ID No. 88, SEQ ID No. 90, SEQ ID No. 92, SEQ ID No. 94, SEQ ID No. 96, SEQ ID No. 98, SEQ ID No. 100, SEQ ID No. 102, SEQ ID No. 104, SEQ ID No. 106, SEQ ID No. 108, SEQ ID No. 110, SEQ ID No. 112, SEQ ID No. 114, SEQ ID No. 116, SEQ ID No. 118, SEQ ID No. 120, SEQ ID No. 122, SEQ ID No. 124, or SEQ ID No. 126.
[0073]. In some embodiments of the present disclosure, the cyanophycinase (cphB) protein has an amino acid sequence selected from a group comprising SEQ ID No. 4, SEQ ID No. 73, SEQ ID No. 75, SEQ ID No. 77, SEQ ID No. 79, SEQ ID No. 81, SEQ ID No. 83, SEQ ID No. 85, SEQ ID No. 87, SEQ ID No. 89, SEQ ID No. 91, SEQ ID No. 93, SEQ ID No. 95, SEQ ID No. 97, SEQ ID No. 99, SEQ ID No. 101, SEQ ID No. 103, SEQ ID No. 105, SEQ ID No. 107, SEQ ID No. 109, SEQ ID No. 111, SEQ ID No. 113, SEQ ID No. 115, SEQ ID No. 117, SEQ ID No. 119, SEQ ID No. 121, SEQ ID No. 123, SEQ ID No. 125 and SEQ ID No. 127.
[0074]. In other embodiments of the present disclosure, the cyanophycinase (cphB) protein has an amino acid sequence which is at least 60%, 70%, 80%, 90% or 95% identical to any of the SEQ ID No. 4, SEQ ID No. 73, SEQ ID No. 75, SEQ ID No. 77, SEQ ID No. 79, SEQ ID No. 81, SEQ ID No. 83, SEQ ID No. 85, SEQ ID No. 87, SEQ ID No. 89, SEQ ID No. 91, SEQ ID No. 93, SEQ ID No. 95, SEQ ID No. 97, SEQ ID No. 99, SEQ ID No. 101, SEQ ID No. 103, SEQ ID No. 105, SEQ ID No. 107, SEQ ID No. 109, SEQ ID No. 111, SEQ ID No. 113, SEQ ID No. 115, SEQ ID No. 117, SEQ ID No. 119, SEQ ID No. 121, SEQ ID No. 123, SEQ ID No. 125, or SEQ ID No. 127.
[0075]. In an embodiment, a wild-type Cyanobacterium aponinum comprises cphA having a nucleotide sequence set forth as SEQ ID No. 1 and cphB having a nucleotide sequence set forth as SEQ ID No. 3.
[0076]. In an embodiment of the present disclosure, the genetically modified cyanobacteria described herein comprises a vector for the knockout of the cphA and cphB genes encoding cyanophycin synthetase and cyanophycinase, respectively.
[0077]. In another embodiment of the present disclosure, the genetically modified cyanobacteria described herein comprises a vector set forth as SEQ ID No. 5 for the knockout of cphA and cphB genes in Cyanobacterium aponinum.
[0078]. In a preferred embodiment of the present disclosure, the genetically modified Cyanobacterium aponinum (Accession No. CCAP 1455/2) is obtained by employing the vector set forth as SEQ ID No. 5 for the knockout of cphA and cphB genes.
[0079]. In an exemplary embodiment of the present disclosure, the genetically modified Cyanobacterium aponinum (Accession No. CCAP 1455/2) is obtained by employing the vector set forth as SEQ ID No. 5 for the knockout of SEQ ID No. 1 and SEQ ID No. 3.
[0080]. In an embodiment of the present disclosure, the knockout of cphA and cphB genes prevents or reduces cyanophycin synthesis in the genetically modified cyanobacteria described herein.
[0081]. In another embodiment of the present disclosure, the genetically modified recombinant cyanobacteria described herein achieves increased synthesis or accumulation of amino acids, relative to corresponding wild-type cyanobacteria.
[0082]. In an exemplary embodiment of the present disclosure, the genetically modified recombinant cyanobacteria described herein achieves increased synthesis or accumulation of amino acids selected from a group comprising threonine, alanine, L-proline, lysine, glutamic acid, glycine and combinations thereof, relative to corresponding wild-type cyanobacteria.
[0083]. In another exemplary embodiment of the present disclosure, the genetically modified Cyanobacterium aponinum (Accession No. CCAP 1455/2) described herein achieves enhanced synthesis or accumulation of amino acid selected from a group comprising threonine, alanine, L-proline, lysine, glutamic acid, glycine and combinations thereof, relative to corresponding wild-type Cyanobacterium aponinum.
[0084]. The present disclosure further describes a method of obtaining the genetically modified cyanobacteria described herein.
[0085]. In an embodiment of the present disclosure, the method of obtaining the genetically modified cyanobacteria described herein comprises knocking out the genes encoding cyanophycin synthetase (CphA) and cyanophycinase (CphB) in the corresponding wild-type cyanobacteria.
[0086]. In another embodiment of the present disclosure, the method of obtaining the genetically modified cyanobacteria described herein comprises:
a) constructing a vector for the knock-out of the genes encoding cyanophycin synthetase (cphA) and cyanophycinase (cphB); and
b) transforming a wild-type cyanobacteria with said vector, to obtain a genetically modified cyanobacteria.
[0087]. In an exemplary embodiment of the method described above, the genetically modified Cyanobacterium aponinum (Accession No. CCAP 1455/2) is obtained by employing a vector set forth as SEQ ID No. 5.
[0088]. The present disclosure further provides a cphA and cphB knock out vector. In an exemplary embodiment, said knock out vector is set forth as SEQ ID No. 5.
[0089]. In an embodiment of the present disclosure, the cphA and cphB knock out vector comprises elements including but not limiting to the origin of replication for Enterobacteriaceae, in particular E. coli; antibiotic marker with its own promoter and terminator; upstream and downstream homologous sequences of cphA and cphB, respectively from wild-type cyanobacteria.
[0090]. In an exemplary embodiment of the present disclosure, the cphA and cphB knock out vector comprises elements including an upstream (UP) and a downstream (DN) region for homologous recombination in cyanobacteria, spectinomycin/streptomycin selection marker aadA under the control of rpsB promoter, and cpcA terminator. In an embodiment, the UP sequence comprises 992 bp polynucleotide sequence upstream of the cphB gene of the wild-type cyanobacteria, for instance, the wild-type Cyanobacterium aponinum. In another embodiment, the DN sequence comprises 1087 bp polynucleotide sequence downstream of the cphA gene of the wild-type Cyanobacterium aponinum. In an exemplary embodiment, the vector corresponds to SEQ ID No. 5 and comprises said UP sequence of 992 bp upstream of the cphB gene and DN sequence of 1087 bp downstream of the cphA gene.
[0091]. The present disclosure thus aims at inactivating the cyanophycin synthesis pathway in cyanobacteria by knocking out cphA and cphB genes in order to improve the titre of amino acids such as threonine, alanine, L-proline, lysine, glutamic acid and glycine, respectively.
[0092]. Cyanophycin is a storage molecule that contains aspartic acid and arginine in equimolar ratio. These amino acids are arranged is a poly-aspartate backbone by linking the ß-Carboxyl group of an aspartic acid to the a-amino group of an arginine moiety (see Figure 1). Amino acids, which are structurally similar to arginine, such as lysine, ornithine, glutamic acid and citruline may also replace the arginine content of cyanophycin.
[0093]. Cyanobacteria has not been designed naturally to produce high titre of amino acids (AAs) in the cells. To develop a green platform for various biotechnology-based innovations, photosynthetic organisms need to be genetically modified to fulfill industrial demands. Among various industrial demands, one such requirement is to achieve improved/high amino acid yields. The present disclosure tries to meet the same by providing method for improving amino acid titer in photosynthetic organisms, particularly cyanobacteria. The reduced amine (NH2-) which is transported inside cyanobacteria has been utilized extensively to form glutamate and glutamine, which are subsequently used to form arginine via ornithine cycle (Figure 2). This arginine along with aspartic acid acts as a precursor for cyanophycin formation (nitrogen storage) by CphA (cyanophycin synthetase) as shown with the dotted arrows in Figure 2. One of the objectives of the present inventors was the elimination of this storage (cyanophycin) which could improve the free availability of reduced amine (NH2-). Further, the idea of the present inventors includes not only to free the reduced amine (NH2-) which can be further utilized to improve the glutamate flux, but also to improve the carbon pool accumulation at the Calvin cycle. These junctures act as connecting links for the formation of various amino acids like glutamic acid, proline, lysine, threonine, glycine and alanine as shown with the black highlighted boxes in Figure 2. Both these objectives are simultaneously achieved in the present disclosure by providing a method for increasing amino acid production which employs genetically modified/recombinant cyanobacteria, wherein said recombinant cyanobacteria is obtained by knocking out cphA (cyanophycin synthetase) and cphB (cyanophycinase, the enzyme responsible for cyanophycin degradation) genes from the wild-type/parent cyanobacteria. In a preferred embodiment, a genetically modified recombinant Cyanobacterium aponinum (Accession No. CCAP 1455/2) was constructed with cphA and cphB genes knocked out.
[0094]. The present disclosure thus provides deletion of cphA and cphB genes from the genome of cyanobacteria to develop double knock-out mutants which are employed for improving amino acid production in cyanobacteria. In an embodiment, the present disclosure provides deletion of cphA and cphB genes from the genome of a wild-type Cyanobacterium aponinum. In order to delete these genes, the upstream and downstream regions of these two genes, which are located next to each other in the genome, were cloned into an E. coli plasmid vector and the construct confirmed (Figures 3 and 4). The wild-type C. aponinum was transformed with this vector, and the transformants were segregated completely (Figure 5). The segregated genetically modified/recombinant strain (cphA and cphB knock out Cyanobacterium aponinum) was submitted to depository and assigned Accession No. CCAP 1455/2.
[0095]. In an embodiment, the present disclosure also confirms the limited role of nitrogen metabolism in cyanobacterial growth. The results herein suggest the non-defective growth profile of the genetically modified Cyanobacterium aponinum with respect to the wild-type Cyanobacterium aponinum (Figure 6). In an exemplary embodiment, this genetically modified/mutant strain was vigorously tested in the photo-bioreactor (PBR) condition along with the wild-type Cyanobacterium aponinum as control. Irrespective of the PBR conditions, mutants grow identical with same growth rate and produce same biomass at the end of the experiment. This non-defective growth of the mutants is an added advantage for industrial application of these cyanobacteria mutants in amino acid production.
[0096]. In an embodiment of the present disclosure, the genetically modified Cyanobacterium aponinum contain highly reduced globule like structures present across the cell when compared to the wild-type Cyanobacterium aponinum. TEM analysis of this globule confirms the presence of nitrogen element with EDX scanning (Figure 7). Biochemical and analytical methods validate the presence of dark globule like structure as cyanophycin in the wild-type Cyanobacterium aponinum. Biochemical estimation further indicates the accumulation of cyanophycin to around 4% in the wild-type cyanobacterium. On the other hand, the mutant shows negligible accumulation of said nitrogen storage structure - cyanophycin (Figure 8A).
[0097]. In another embodiment, the present disclosure further validates the removal of cyanophycin (i.e. inactivation of cyanophycin synthesis) in the presently described genetically modified cyanobacteria wherein biochemical results (spectrophotometer) showed no or negligible cyanophycin in case of the mutant strain. Further, analytical approach was also employed to validate the biochemical estimation of cyanophycin using Ultra-High Performance Liquid Chromatography (UHPLC).
[0098]. Since cyanobacteria accumulate significant amount of cyanophycin as storage, elimination of this storage could improve the free availability of reduced amine (NH2-). In cyanobacteria, this reduced amine (NH2-) is channeled into ornithine cycle to form arginine via glutamate and glutamine. Consequently, the elimination/inactivation of cyanophycin synthesis in the genetically modified cyanobacteria described herein not only results in accumulation of free, reduced amine (NH2-) but also improves the GAP (Glyceraldehyde-3-phosphate) flux at Calvin cycle by minimizing the usage of 2-OG (2-Oxoglutarate) at tricarboxylic acid (TCA) cycle (Figure 2). This effect improves the availability/accumulation of amino acids such as threonine, alanine, L-proline, lysine and glycine in the presently described recombinant/genetically modified cyanobacteria.
[0099]. In an embodiment, quantitative amino acid estimation in the wild-type Cyanobacterium aponinum strain and the corresponding mutant strain was carried out. These results not only gave thorough understanding of the amino acid biosynthesis, but also indicated the reduction of arginine and aspartic acid in the mutants to 83% and 19% respectively compared to the parent wild-type strain (Figure 8B). Said results further indicate that the genetically modified cyanobacteria utilizes/channelizes the nitrogen or reduced amine (NH2-) in the formation of various amino acids rather than cyanophycin formation of said cyanophycin into arginine and aspartic acid.
[00100]. In another embodiment, the present disclosure emphasizes the accumulation of higher levels of amino acids in the genetically modified cyanobacteria. In an exemplary embodiment, the recombinant Cyanobacterium aponinum described herein, accumulates high levels of amino acids such as L-proline, glycine and alanine at around 116 mole %, 11 mole % and 7 mole % respectively in the biomass when compared to the wild-type Cyanobacterium aponinum. In another exemplary embodiment, the recombinant strain shows higher abundance of free form amino acids including threonine and alanine at around 9% and 61% respectively when compared to the wild-type Cyanobacterium aponinum. In yet another exemplary embodiment, L-proline and lysine in its free form were detected only in the mutants and was absent/lacking in the parent Cyanobacterium aponinum (Figures 9 and 10). In yet another embodiment, extracellular glutamic acid was shown to have increased in the recombinant strain compared to the wild-type strain with respect to mole % as high as 480%, while extracellular alanine was detected only in the recombinant strain (Figure 11). Based on the abovementioned results, it can be concluded that the genetically modified cyanobacteria such as the cphA and cphB -knock out Cyanobacterium aponinum described herein demonstrates successful re-distribution of nitrogen and carbon flux into increased titres of amino acids in the cell.
[00101]. ADVANTAGES/BENEFITS:
Based on the above discussed aspects, it is observed that the method of increasing amino acid levels by employing genetically modified cyanobacteria as described in the present disclosure has several advantages/benefits, including, but not limiting to the following:
a) The genetically modified cyanobacterial strains comprising knock out of cphA and cphB genes result in the inactivation of cyanophycin synthesis. Therefore, the availability of reduced amine (NH2-) in the cells is enhanced and is utilized/channeled in the formation of various amino acids.
b) The genetically modified cyanobacteria achieves successful re-distribution of nitrogen and carbon flux resulting in increased titres of specific amino acids in the cell.
c) The method employing the genetically modified cyanobacteria shows enhanced accumulation of amino acids such as threonine, alanine, L-proline, glutamic acid, lysine and glycine. For instance, the recombinant strain described herein demonstrates accumulation of high levels of amino acids such as L-proline, glycine and alanine at around 116 mole %, 11 mole % and 7 mole % respectively in the biomass when compared to the corresponding wild-type cyanobacteria. Said recombinant strain mutants also show higher abundance of free form amino acids including threonine and alanine at around 9% and 61% respectively when compared to the corresponding wild-type cyanobacteria. Further, amino acids L-proline and lysine in their free forms were detected only in the recombinant strain and was absent/lacking in the corresponding wild-type strain. Further, the recombinant strain showed 480% more extracellular glutamic acid compared to the wild-type strain, while extracellular alanine was detected only in the recombinant strain.
d) The genetically modified cyanobacteria described herein are highly useful for industrial production of value-added products such as amino acids. More particularly, the present strains are highly valuable in the production of amino acids including threonine, alanine, L-proline, lysine, glutamic acid and glycine.
[00102]. Additional embodiments and features of the present disclosure will be apparent to one of ordinary skill in art based upon description provided herein. The embodiments herein provide various features and advantageous details thereof in the description. Descriptions of well-known/conventional methods and techniques are omitted so as to not unnecessarily obscure the embodiments herein. Further, the disclosure herein provides for examples illustrating the above described embodiments, and in order to illustrate the embodiments of the present disclosure certain aspects have been employed. The examples used herein for such illustration are intended merely to facilitate an understanding of ways in which the embodiments herein may be practiced and to further enable those of skill in the art to practice the embodiments herein. Accordingly, the following examples should not be construed as limiting the scope of the embodiments herein.

EXAMPLES
EXAMPLE 1:
Isolation and identification of the cyanobacterial strain
[00103]. The wild-type Cyanobacterium aponinum employed in present examples was originally isolated/sourced from Gagva, Gujarat, India. In the present disclosure/examples, said strain is referred to the wild-type or parent Cyanobacterium aponinum strain, while the corresponding genetically modified strain is referred to as the recombinant or mutant strain.
[00104]. The recombinant/mutant Cyanobacterium aponinum strain of the present disclosure comprising SEQ ID No. 1 (cphA) and SEQ ID No. 3 (cphB) knock-outs is deposited with the Scottish Association for Marine Science - Culture Collection of Algae and Protozoa (CCAP), United Kingdom under Accession No. CCAP 1455/2.

EXAMPLE 2:
Identification of cyanophycin synthesis and degradation pathways by in-silico analysis
[00105]. Whole genome sequence analysis of the wild-type cyanobacterial strain showed the presence of cphA, located downstream of cphB. Nucleotide/protein sequences of cphA/CphA and cphB/CphB are provided as SEQ ID No. 1 [nucleotide sequence of cyanophycin synthetase (cphA) of wild-type Cyanobacterium aponinum], SEQ ID No. 2 [amino acid sequence of cyanophycin synthetase (CphA) of wild-type Cyanobacterium aponinum], SEQ ID No. 3 [nucleotide sequence of cyanophycinase (cphB) of wild-type Cyanobacterium aponinum] and SEQ ID No. 4 [amino acid sequence of cyanophycinase (CphB) of wild-type Cyanobacterium aponinum], respectively.
[00106]. Cyanophycin synthatase (cphA) and cyanophycinase (cphB) sequence homology analysis using NCBI BLAST also confirms their presence in other cyanobacterial species apart from wild-type Cyanobacterium aponinum. Top sequence homolog hits with at least 60%, 70%, 80%, 90% or 95% identity and expectation value less than or equal to zero belong to the group consisting of Anabaena sp., Crocosphaera sp., Cyanobacterium sp., Geitlerinema sp., Geminocystis sp., Leptolyngbya sp., Microcystis sp., Nostoc sp., Nostocaceae sp., Synechococcus sp., Synechocystis sp., and Thermosynechococcus sp.. Figure 12 depicts the phylogeny of cyanophycin synthatase (CphA), constructed using neighbour joining method with bootstrap replicates of 500. Figure 13 depicts the phylogeny of cyanophycinase (CphB), constructed using neighbour joining method with bootstrap replicates of 500.

EXAMPLE 3:
Construction of the gene knock-out cassette and vector for the development of the recombinant cyanobacterial strain
[00107]. Gene knock outs can be accomplished by variety of techniques such as homologous recombination and site-specific nuclease based techniques [zinc-finger nucleases, Transcription activator-like effector nucleases (TALENs), or Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9].
[00108]. In the present example, to delete cphA and cphB from the C. aponinum genome, a homologous recombination based strategy was employed. Chromosomal DNA was isolated from wild-type C. aponinum by using Gene Elute Plant genomic DNA Miniprep kit (Sigma, G2N10) following the manufacturer protocol. Using the genomic DNA of wild-type C. aponinum as the template, the upstream 992 bp sequence of cphB, and downstream 1087 bp region of cphA were amplified using primers SS95F (SEQ ID No. 6) and SS98R (SEQ ID No. 7), and SS99F (SEQ ID No. 8) and SS102R (SEQ ID No. 9), respectively. Phusion® High-Fidelity DNA Polymerase (NEB, M0530S) was used for PCR. Sequences of all primers are listed in Table 3. A spectinomycin and streptomycin resistance cassette from Klebsiella pneumonia (Genebank ID AXV47344.1) was codon optimized for C. aponinum and synthesized along with the promoter PrpsB and the terminator TcpcA. The amplified upstream and downstream regions, and the synthesized fragment were fused together using an overlap extension PCR protocol. The final PCR product was cloned into the pJET1.2/blunt cloning vector using a CloneJET PCR cloning kit (Thermo Scientific, K1231) according to the manufacturer’s protocol, resulting in plasmid pKO-cphA-cphB. An illustration of the plasmid construct is shown in Figure 3. NEB® 5-alpha competent E. coli cells (C2987I) were transformed with this plasmid, again following the manufacturer’s protocol. Colonies of E. coli transformants were picked and grown in liquid LB medium overnight. Plasmids were isolated next morning from these cultures using the Plasmid Miniprep Kit (QIAGEN, 27104). Correct plasmids were confirmed by: a) PCR with primers SS95F (SEQ ID NO: 6) and SS102R (SEQ ID NO: 9), which amplified a 3.2 kb fragment, and b) restriction digestion with ScaI, producing a single fragment of 6.2 kb, and with XbaI, producing 2 fragments of 4.1 kb and 2.1 kb. Agarose gel images of the PCR product and the restriction digestion products are shown in Figure 4.

Table 3. Primers used to construct the plasmid pKO-cphA-cphB and their sequences
SEQ ID No. Primer Amplicon Sequence
6 SS95F cphB upstream ATTCATTAATGCAGGAAATTCGAGCTGGACGAGTATAATGAGGGTAATCCAA
7 SS98R cphB upstream GCTTTTCCAGGTCTTGTCGAAGTACGACCTTATCTTCTGCACCTCCTATAAC
8 SS99F cphA downstream GGGAAAATTGGCGAGGTGATCTGTCGAATTAGGAATTGAGAAAGGGCAAAAGG
9 SS102R cphA downstream GCTTGTCTGTAAGCGGATGCCAAGACCCAAAACCTCTGATAACCAAATTC

EXAMPLE 4:
Construction of genetically modified/recombinant cyanobacterial strain
[00109]. The wild-type strain Cyanobacterium aponinum was transformed with the pKO-cphA-cphB plasmid prepared in Example 3 following the steps described below.
1) The recombinant nucleic acids in the plasmid pKO-cphA-cphB were protected against endogenous restriction endonucleases of the cyanobacterial host cell by treating with methyltransferases such as M.SssI and M.CviPI. The methylation treatment was conducted at a temperature of about 37?C for about 5 minutes to 4 hours, preferably from 1 hour to 4 hours. Further, about 0.2 to 2 µg of plasmid DNA was methylated for each methylation using M.SssI.
2) In another example, the cyanobacterial culture was grown in BG-11 medium with 1% to 4% salt up to OD750 0.5 to 8, preferably up to OD750 0.5 to 2. The cyanobacterial culture was grown in about 1% to 5% CO2, preferably between 2% to 5% CO2. Further, the temperature of the cyanobacterial culture was between 30°C and 42°C, with about 300-1000 µE of constant light.
3) In yet another example, the cyanobacterial culture was grown overnight in BG-11 medium with about 1% to 4% salt at about 5% CO2. The culture conditions were then changed to room temperature with ambient light and CO2, and the culture was incubated in this condition for about 4 hours. In this example, a culture volume equivalent to 5 OD*ml was precipitated by centrifugation, and resuspended in about 0.1 ml to 1 ml of fresh BG-11 medium with about 1% to 4% salt. Further, about 0.2 µg to 2 µg of methylated plasmid DNA was added to about 200 µl of resuspended cyanobacterial culture, and incubated at a temperature between 25°C and 42°C and about 1% to 5% CO2 for about 1 hour to 12 hours. Alternatively, the resuspended cyanobacterial culture was mixed with methylated plasmid DNA and incubated overnight. After incubation, the cyanobacterial culture was platted on antibiotic-plates. The transformants were selected on antibiotic plates, which were incubated at a temperature between 25°C and 42°C and about 0% CO2 for about 5 to 7 days.
[00110]. In the present example, the transformants were selected on an antibiotic plate, and sub-cultured a couple of times for complete segregation, which was confirmed by PCR using primers SS95F (SEQ ID No. 6) and SS102R (SEQ ID No. 9). The PCR amplified a 5.7 kb fragment for the wild-type, and a 3.2 kb fragment for transformants (see Figure 5).

EXAMPLE 5:
Comparative growth kinetics of the wild-type and recombinant strains
[00111]. The growth kinetics of the recombinant Cyanobacterium aponinum strain was studied using a multi-cultivator (PSI-multi-cultivator MC 1000). BG-11 medium was used for maintaining the culture with salt supplements. The multi-cultivator was maintained at sinusoidal mode, with about 12 hours with maximum light of about 1100 µE/m2/s. Day-time temperature was maintained at about 35°C, while night-time temperature was decreased to about 25°C. Constant bubbling of 2% CO2 was maintained. The OD750 of the initial inoculum was ~0.06. The wild-type and recombinant strains were grown for about nine days with daily monitored OD750. The growth kinetics of the wild-type and the recombinant strains are shown in Figure 6. The wild-type strain as well as the recombinant strain reached OD750 11 in 9 days. This strongly suggested that the knock-out recombinant strain did not possess any significant growth defect. Additionally, no change in their chlorophyll content was seen either. This leads to the understanding of a complex equilibrium of carbon and nitrogen metabolism that exists in cyanobacteria. In the event of no nitrogen storage/accumulation, cyanobacteria prefer to increase the fixation of carbon via photosynthesis for its growth.

EXAMPLE 6:
Transmission electron microscopic (TEM) analysis of the wild-type and recombinant strains
[00112]. Cells were grown in multi-cultivator with previously defined growth conditions. Both the wild-type and recombinant Cyanobacterium aponinum strains were harvested at stationary phase to capture the accumulation of cyanophycin by STEM (Scanning Transmission Electron Microscopy) - EDX (Energy Dispersive X-ray Spectroscopy) analysis. STEM-bright field (BF) imaging (Figure 7) of wild-type strain suggested the accumulation of some dark /grey bodies while the recombinant strain did not show such bodies in the cytoplasm. Furthermore, the accumulation of these dark/grey bodies was tested for the presence of nitrogen using a high-angle annular dark field (HAADF)-EDX (energy dispersive X-ray spectroscopy) detector. Results from the HAADF-EDX indicated the accumulation of high nitrogen containing mass cyanophycin in the wild-type strain at stationary phase, while the recombinant strain did not show any nitrogen cluster.

EXAMPLE 7:
Identification and quantitation of cyanophycin in wild-type and recombinant strains
[00113]. Isolation of cyanophycin from Cyanobacterium aponinum strains was done. Briefly, 100% acetone was added to the dried biomass (100 mg) to dissolve the lipid layers of the cell membrane. The mixture was washed twice with about 50 mM Tris-Hcl (pH 7.5) to remove soluble proteins from the cell lysate, and finally resuspended in about 0.1 N HCl for cyanophycin extraction. The extracted cyanophycin was precipitated using about 0.1 M Tris-HCl at about pH 12.
[00114]. Cyanophycin from 100 mg of biomass was subjected to biochemical analysis [Messineo L 1966. Arch Biochem Biophy 117, 534-540]. Briefly, cyanophycin was treated with about 1 ml of reagent A (300 mg KI in 100 ml distilled water) and about 3 ml of reagent B (100 ml 5M KOH, 2 gm of potassium sodium tartarate, 100 mg of 2,4-dichloro-1-naphthol, 180 ml of absolute alcohol and 9.33 ml NaOCl). Reagent C (20 ml of commercial NaOCl diluted in 100 ml with water) was added to the mixture that formed a red complex with arginine, which can be detected at 520 nm. As expected, the biochemical estimation results validated the successful removal of cyanophycin from Cyanobacterium aponinum strains. In particular, cyanophycin accumulation was not found in the recombinant strain, while the wild-type strain showed around 4% of cyanophycin accumulation (Figure 8A).
[00115]. The accumulation of arginine and aspartic acid (constituents of cyanophycin) was also evaluated with chromatography. Cell biomass was hydrolyzed with about 6N HCl overnight at about 90?C. On subsequent derivatization, arginine and aspartic acid were detected using an UPLC (Waters Acquity UPLC H-Class-Xevo TQD system, MA, USA). The chromatographic analysis showed decrease in mole % of arginine by 83%, and aspartic acid mole % reduced to about 19% in recombinant strain compared to the wild-type strain (Figure 8B).

EXAMPLE 8:
Quantification of amino acids L-Proline, Glycine and Alanine in the biomass of wild-type and recombinant strains
[00116]. The concentrations of amino acids were estimated in the biomass of the wild-type and the recombinant strains. This study was conducted at the stationary phase of OD750. Cells were harvested and spin down at 9000x g for about 10 minutes. Pellet was washed twice with PBS buffer, and finally dried in hot air oven at about 60°C. Subsequently, dried biomass was subjected to acid hydrolysis using 6N HCl overnight at about 90°C. Finally, the hydrolyzed biomass was derivatised using the Waters kit (AccQ Tag derivatisation kit, P/N WAT052880). Chromatographic analysis of the amino acids suggested a significant accumulation of L-proline pool size i.e. about 116% (mole %) in the recombinant strain compared to the wild-type, while glycine and alanine was shown to have increased mole % of about 11% and 7% respectively in the recombinant strain (Figure 9).

EXAMPLE 9:
Quantification of intracellular availability of free amino acids Alanine, L-Proline, Lysine and Threonine content in wild-type and recombinant strains
[00117]. Cellular availability of intracellular free amino acids was measured. Briefly, cells were quenched at log phase (OD750) using methanol:water (80:20). Free amino acids were extracted using the liquid-liquid extraction technique employing methanol: chloroform: water (1:2:2). Isolated free amino acids were dried using a lyophilizer. Lyophilized amino acids were subsequently derivatised using the water kit. Amino acids were identified using UPLC (Waters Acquity UPLC H-Class-Xevo TQD system, MA, USA). Amino acid quantitation was done using the amino acid mix from Sigma (Sigma Aldrich, AAS18). The availabilities of threonine, alanine were confirmed and were found to be increased to about 40% and 61% respectively in the recombinant strain compared to the wild-type strain. Further, L-proline and lysine were only detected in the recombinant strain and were lacking/absent in wild-type strain (Figure 10).

EXAMPLE 10:
Quantification of secreted Glutamate and Alanine content in wild-type and recombinant strains
[00118]. Secreted amino acids were estimated from the culture medium. Culture medium were separated from the cyanobacterial cells by centrifugation at 6000 rpm for about 5 minutes at about 4°C. Supernatants were collected and lyophilized. Lyophilized amino acids in both cases were subsequently derivatised using the water kit. Amino acids were identified using UPLC (Waters Acquity UPLC H-Class-Xevo TQD system, MA, USA). Amino acid quantitation was done using the amino acid mix from Sigma (Sigma Aldrich, AAS18). The availability of secreted glutamic acid was found to be increased by 480% in the recombinant Cyanobacterium aponinum strain compared to the corresponding wild-type strain (Figure 11). Further, some amount of Alanine was secreted by the recombinant strain but not the wild-type strain.
[00119]. The above examples/results thus successfully show enhanced availability/accumulation of amino acids, preferably Threonine, Alanine, L-Proline, Glutamic acid, Lysine and Glycine in the cphA and cphB knock-out cyanobacteria.
[00120]. Similar to the above examples/results, cphA and cphB knock-out strains of cyanobacterial species such as Cyanobacterium sp., Anabaena sp., Crocosphaera sp., Geitlerinema sp., Geminocystis sp., Leptolyngbya sp., Microcystis sp., Nostoc sp., Nostocaceae sp., Synechococcus sp., Synechocystis sp., and Thermosynechococcus sp. can be developed for achieving enhanced synthesis/accumulation of amino acids. In-silico analysis was performed to confirm the presence of cphA and cphB genes in said cyanobacterial species. Accordingly, the specific cphA and cphB genes of various cyanobacterial species are provided in the Table 1 and Table 2, respectively. By developing suitable knock-out vectors based on the upstream and downstream homology regions of cphA and cphB genes in the wild-type strains (similar to the vector described in the present examples), recombinant cyanobacteria strains comprising cphA and cphB gene knock-outs can be developed, and said recombinant cyanobacteria strains can be cultured to achieved increased amino acid production, preferably the amino acids Threonine, Alanine, L-Proline, Glutamic acid, Lysine and Glycine.
[00121]. Additional embodiments and features of the present disclosure will be apparent to one of ordinary skill in art based on the description provided herein. The embodiments herein provide various features and advantageous details thereof in the description. Descriptions of well-known/conventional methods and techniques are omitted so as to not unnecessarily obscure the embodiments herein.
[00122]. The foregoing description of the specific embodiments fully reveals the general nature of the embodiments herein that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments in this disclosure have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments herein can be practiced with modification within the spirit and scope of the embodiments as described herein.
[00123]. Throughout this specification, the word/phrase “comprise”, or variations such as “comprises” or “comprising” or “including but not limiting to” wherever used, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
[00124]. With respect to the use of substantially any plural and/or singular terms herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for sake of clarity.
[00125]. Any discussion of documents, acts, materials, devices, articles and the like that has been included in this specification is solely for the purpose of providing a context for the disclosure. It is not to be taken as an admission that any or all of these matters form a part of the prior art base or were common general knowledge in the field relevant to the disclosure as it existed anywhere before the priority date of this application.
[00126]. While considerable emphasis has been placed herein on the particular features of this disclosure, it will be appreciated that various modifications can be made, and that many changes can be made in the preferred embodiments without departing from the principles of the disclosure. These and other modifications in the nature of the disclosure or the preferred embodiments will be apparent to those skilled in the art from the disclosure herein, whereby it is to be distinctly understood that the foregoing descriptive matter is to be interpreted merely as illustrative of the disclosure and not as a limitation.

Documents

Application Documents

# Name Date
1 202041008659-STATEMENT OF UNDERTAKING (FORM 3) [28-02-2020(online)].pdf 2020-02-28
2 202041008659-SEQUENCE LISTING(PDF) [28-02-2020(online)].pdf 2020-02-28
3 202041008659-SEQUENCE LISTING [28-02-2020(online)].txt 2020-02-28
4 202041008659-REQUEST FOR EXAMINATION (FORM-18) [28-02-2020(online)].pdf 2020-02-28
5 202041008659-POWER OF AUTHORITY [28-02-2020(online)].pdf 2020-02-28
6 202041008659-FORM 18 [28-02-2020(online)].pdf 2020-02-28
7 202041008659-FORM 1 [28-02-2020(online)].pdf 2020-02-28
8 202041008659-DRAWINGS [28-02-2020(online)].pdf 2020-02-28
9 202041008659-DECLARATION OF INVENTORSHIP (FORM 5) [28-02-2020(online)].pdf 2020-02-28
10 202041008659-COMPLETE SPECIFICATION [28-02-2020(online)].pdf 2020-02-28
11 202041008659-Proof of Right [27-08-2020(online)].pdf 2020-08-27
12 202041008659-FER.pdf 2022-07-14
13 202041008659-OTHERS [11-01-2023(online)].pdf 2023-01-11
14 202041008659-FER_SER_REPLY [11-01-2023(online)].pdf 2023-01-11
15 202041008659-COMPLETE SPECIFICATION [11-01-2023(online)].pdf 2023-01-11
16 202041008659-CLAIMS [11-01-2023(online)].pdf 2023-01-11
17 202041008659-US(14)-HearingNotice-(HearingDate-23-03-2023).pdf 2023-02-23
18 202041008659-FORM-26 [20-03-2023(online)].pdf 2023-03-20
19 202041008659-Correspondence to notify the Controller [20-03-2023(online)].pdf 2023-03-20
20 202041008659-Written submissions and relevant documents [06-04-2023(online)].pdf 2023-04-06
21 202041008659-PatentCertificate10-04-2023.pdf 2023-04-10
22 202041008659-IntimationOfGrant10-04-2023.pdf 2023-04-10

Search Strategy

1 SearchHistory(92)E_13-07-2022.pdf
2 Doc1E_13-07-2022.pdf

ERegister / Renewals

3rd: 04 Jul 2023

From 28/02/2022 - To 28/02/2023

4th: 04 Jul 2023

From 28/02/2023 - To 28/02/2024

5th: 30 Jan 2024

From 28/02/2024 - To 28/02/2025

6th: 31 Jan 2025

From 28/02/2025 - To 28/02/2026