Abstract: Title: A method of transient expression of gene of interest in plants using a plant DNA virus based vector. Two DNA constructs comprising the transient gene expression vectors based on the DNA-B of a plant DNA virus, wherein a reporter gene coding sequence flanked by two MCS replaces the BCI ORF in one and the BVI ORF in the other construct.
TITLE:
A method of transient expression of gene of interest in plants using a plant DNA virus based
vector.
FIELD OF INVENTION
The present invention relates to the development of plant DNA virus based vectors capable of
transiently expressing a sequence of interest in plants. The invention also provides a process of
expressing a sequence of interest in plants or plant parts'
BACKGROUND OF THE INVENTION
plants have been in use as protein factories for a number of reasons, including efficient and
sustainabre production of rarge volumes of protein products, row production costs and for safety
and environmental issues (Hood et a1.,2001; Giddings,2001). Another major advantage of using
plants as protein factories is that they possess an endomembrane system and secretory pathway
that are similar to mammalian ce[s (vitale a1ld psdrazzini, 2005). Thus, proteins are generally
efficiently assembled with appropriate post-tanslational modifications' These cost and scale
advantages make the possibility of producing plant-made therapeutic protein agents plants on an
agficultruat scale by "molecular farming" extemely attractive'
Production of transgenic plants, in which transgene is stably integrated into plant nuclear
chromosomal DNA allows stable protein expression and the potential for exffeme scale-up by
sexual propagation. However, use of transgenic plants suffers from relatively poor yield, largely
due to positional effect and post-transcriptional gene silencing (voinnet et al-,2003, chen et al',
2011). Transient gene expression provides a rapid alternative to the material- and timeconsuming
generation of stably transformed plants for production of heterologous gene of
interest. DNA delivered into a plant cell, by means of a transient gene expression system, persists
mostly as episomal DNA molecules that can remain transcriptionally competent for several days
(Komarova et al., 20 1 0).
The synthesis of infectious constructs in vitro, derived from viral genomes, paved the way for
plant virus-based vector technology to be used in expressing recombinant proteins in field-grown
plants (Lico et al., 2008). Several types of RNA viruses have been used to create plant
expression vectors, including Tobacco mosaic virns (TMV), Potato virus X (PVX), Cowpea
mosaic vnas (cpMV) and Alfary mosaic virzs (AIMV) (reviewed in Komarovaet a1.,2010).
The magdCON system, based on TMV, utilizes Agrobacterium inoqilation to deliver DNA
encoding recombinant TMV Cdna into leaves, which upon transcription and tansport of RNA to
the cytoplasm generates replicating viral genomes that produce very high levels of target gene
Mma (Marillonnet et al., 2004, 2005).
The potential for using the DNA-containing geminiviruses as exfia-chromosomal gene
amplification vectors lies in the ability of the single-standed circular DNA genomes of these
viruses to replicate to very high copy number in the nuclei of infected plant cells (Komarova e/
a1.,2010).Owing to these unique features, various geminiviral genomes have been used to create
DNA amplification systems (reviewed in Chen et al',2011)'
Keeping the usability of geminiviruses as extra-chromosomal gene amplification vectors in
mind, we have developed Sri Lankan casscua mosaic vnzs (SLCMV) DNA-based transient gene
expression system. SLCMV contains two genomic components, DNA-A and DNA-B (Saunders
et al., 2OOZ). The present invention provides two binary ptasmid based gene expression
constructs derived from SLCMV DNA-B. DNA-A contains the regUlatory components which
drive replication of both DNA-A and DNA,B. DNA-B contains two oRFs, BCI and BVl. To
derive the expression system, two separate constructs were engineered in which each of the two
Opps was replaced with GFP encoding ORF. Multiple cloning sites (MCS) which allowed easy
cloning of gene of interest in place of GFP were included at the 5'and 3'ends of GFP ORF' The
expression vector has been used to drive production of the GFP reporter protein in Nicotiana
benthamiana leaves.
-3-
OBJECTS OF INVENTION
The main objective of the present invention is to provide two binary plasmid based gene
expression constructs derived from SLCMV DNA-B.
Another objective of this invention is to develop a two component transient gene expression
system based on SLCMV DNA-A and DNA-B.
Another objective of this invention is to provide the sequences of the primers used to construct
the vectorpCAMBIA-B 1 .5-BC I A{CS(SEQ ID NO.s l -4).
Another objective of this invention is to provide the sequences of the primers used to construct
the vectorpCAMBLA-BI.S-BVIA{CS (SEQ ID NO.sl, 5-7).
Another objective of this invention is to provide the sequences of the primers used to modifu the
vector CAMBIA 2300 (SEQ ID NO.s 12 and l3).
Another objective of this invention is to provide the sequences of the primers used to ampliff
GFP coding sequence along with the multiple cloning sites (SEQ ID NO.s 8-9, 10-11).
Another objective of this invention is to provide a method for agroinoculation into N.
benthamianaplants for the purpose of testing GFP expression in the leaves.
Another objective of this invention is to provide a method co-agroinoculation of infectious
DNA-A clone with pcambia-Bl.5_BCIA{CSor Pcambia-B1.5-BVl/ MCS into N. benthamiana
plants.
yet another objective of this invention is to provide a method of assay of the GFP protein
quantification whose expression is being studied using spectrofluorimetry'
-4-
,l
BRIEF DESCRIPTION OF INVENTION
The present invention relates to the development of two binary plasmid based gene expression
constructs derived from SLCMV DNA-B.
The present invention relates to the development of a method of ffansiently expressing gene of
interest, using gene expression constructs derived from SLCMV DNA'B in combination with
DNA-A, in N. benthamiana.
The present invention provides a method for agroinoculation of plants with the transient
expression constructs.
The present invention also provides information about the assay to detect fluorescence of GFP
protein expressed in agroinoculated leaves using hand held UV lamp.
The invention further provides a method for quantification of GFP protein using
spectrofluorimetry and GFP fluorescence standard graph'
FIG l: photographs of agroinfiltarted leaves observed under W illumination using a hand held
B-lggAp lamp UV lamp at 5 dpi. a) Ieaf co-agroinfiltrated with pCAMBIA- BI.5-BCIA/ICS
and pCAMBIA-AI.06, b) leaf co-agroinfilnated with pCAMBIA- Bl's-BVIA{CS
andpCAMBIA-A1.06.
FIG 2: Estimation of GFp protein expressed per gram of infiltrated leaf tissue at three
different time points after inoculation. Quantification of GFP was done by spectrofluorimetry
and the bars represent the average amount of protein obtained from two samples'
-5-
FIG 3: Schematic representation of pCAMBIA- Bl.S_BClA{CS and pCAMBIABI.
5_BVlA{CS.
DETAILED DESCRIPTION OF THE INVENTION:
A preferred embodiment of the present invention relates to the development of two binary
plasmid based tansient gene expression constructs derived from SLCMV DNA-B and their use
for expression of any gene of interest in N. benthamiana.
Another embodiment of the present invention relates to providing the nucleotide sequences of
the primers used to ampliff selected parts of SLCMV DNA-B for the development of
pCAMBIA-BI.5_BCIA{CS (SEQ ID NO. l-4) and pCAMBIA-B1.5-BVIA{CS (SEQ ID NO.
s-8).
Another embodiment of the present invention relates to the process of cloning a gene of interest
in pCAMBIA-B I . 5-BC I A{C S and pCAMBLA-B 1 . s-BV I /lvIC S.
Another embodiment of the present invention relates to the providing the nucleotide sequences
of the primers used to ampliff the GFP encoding ORF (EF090408, region: 3240-3959) from
plasmid DNA (SEQ ID NO.s 8-9 and SEQ ID NO.s l0-11).
Another embodiment of the present invention relates to the transformation of the pCAMBIAB
I .5_BC I A{CS and pCAMBIA-B I .5_BV I A{CS into Agrobacterium cells.
Another embodiment of the present invention relates to the method of agroinoculation of plants,
where the plant can belong to the Family Solanaceae.
Another embodiment of the present invention relates to the providing a method of growing N.
benthamianaplants to study GFP expression.
-6-
yet another embodiment of the present invention relates to the providing a method of assay for
the quantification of GFP protein using spectofluorimetry'
The construction of pCAMBIA-B1.5-BC1A{CS and pCAMBIA-B1.5-BVIA{CS was
confirmed by ptasmid isolation and restriction digestion with several enzymes. Details of this
process are described in Example l. To check the capability of pCAMBIA-BI.5-BC1/]vICS and
pcAMBIA-B1.5_BVla{cs to express GFP in planta, the constructs were agroinoculated into
N. benthamiana plants. As SLCMV DNA-B is incapable of replicating in the absence of DNAA,
the recombinant constructs were co-agroinoculated with the agroinfectious DNA-A
(pCAMBIA-AI.06, Mittal et a1.,200S) construct. The process of agroinoculation is described in
Exarnple 2. Expression of GFp was checked starting from 4 days post inoculation (dpi) till 12
dpi, using W illumination on inoculated leaves from a hand held B-IOOAP UV lamp (UVP,
Upland, CA, USA, Figure l).
Typical green fluorescence associated with GFP expression could be observed under W
illumination starting from 4 dpi in the infiltrated area of inoculated leaf. Fluorescence persisted
till 12 dpi, although the intensity decreased after 8 dpi. Protein quantification revealed highest
accumulation of GFp (350 pg and 140 pg per gram of fresh weight of leaf tissue, for pGAMBIABl.
5 BVIA{CS and pGAMBIA-BI.5 BCIA{CS respectively) at 8 days post-inoculation
(Figtue 2).
EXAMPLES
The examples given are merelY
invention, and the Practice of
described.
illustrative of the uses, processes and products claimed in this
the invention itself is not restricted to or by the examples
Example I : constnrction of pcAMBlA-B I . s-BC I A{CS and pCAMBIA-B I . 5-BV I A{CS'
-7-
To develop pCAMBIA-B1.5_BCIA{CS, DNA of the cloned partial dimer of DNA-B
OBSK+B1.5mer; Mittal et a1.,2008) of SLCMV (accession no. AJ579308) was used as a
template to ampliff two regions of the partial dimer using the primers mentioned as SEQ ID
NO.s l-4 (Table l). The first primer pair (SEQ ID NO.s I and 2) was used to amplify a region of
the partial dimer which is composed of the parts of DNA-B (AJ579308) between nucleotide
position lgg3-2738 and 1-143. Similarly, the primer pair (SEQ ID NO.s 3 and 4) was used to
ampliff a region of the partial dimer which is composed of the parts of DNA-B (AJ579308)
between nucleotide position l'1132 and 1994'2738.
The primers were designed to include Spel,Sall and BamHl restriction site at the 5' ends of the
BCI(t)R and BCI(2)F respectively. The primers BCI(3)F and BCI(4)R included PsrI and Clsl
Sacl at the 5' ends respectively. The Phusion (Thermo-scientific) polymerase amplified
fragments were cloned into T/A vector (InsTA cloning Kit, Thermo-scientific). The fragment
BCI(I)-BC1(2) was digested out with Spel and BamHl digestion and ligated into the vector
JsGFp_BSK at a position upstream of GFP ORF, giving rise to an intermediate vector
JsGFp_BSK+BCI(1+2). Subsequently, the fragment BCI(3)-BCI(4) was digested out with PsrI
and Claldigestion and ligated into the vector JsGFP-BSK downstream of GFP ORF, giving rise
to the vector JsGFP BSK+BI.5 BCI/GFP.
Similarly, to develop pCAMBIA-81.5_BV1/\{CS, DNA of the cloned partial dimer of DNA-B
OBSK+BI.5 mer) of SLCMV was used as a template to ampliff two regions of the partial dimer
using the primers mentioned as SEQ ID NO.s 1,5-7 (Table 1). The first primer pair (SEQ ID
NO.s I and 5) was used to amplifr a region of the partial dimer which is composed of the parts
of DNA-B (AJ579308) between nucleotide position 1108-2738 and l-143. Similarly, the primer
pair (SEQ ID NO.s 6 and 7) was used to amplify a region of the partial dimer which is composed
of the parts of DNA-B betrveen nucleotide position l-339 afi 1424-2738-
-8-
The Phusion polymerase amplified fragments were cloned into T/A. The primers BVI(2)F and
BVI(3)R included Psd and Xbal at the 5' ends respectively. The fragment BV1(3)-BVI(4)
amplified with primers (Seq ID NO.s 6 and 7) was digested out with SacI and Xbal digestion and
ligated into the vector JsGFP_BSK at a position upstream of GFP ORF, giving rise to an
intermediate vector JsGFP BSK+BVI(2+4). Subsequently, the fragment BCl(l)-BVl(2),
amplified with primers (Seq ID NO.s I and 5) was digested out with PsrI and SalI digestion and
tigated into the vector JsGFP_BSK downstream of GFP ORF, giving rise to the vector
JsGFP_BSK+BI.5 BVI/GFP.
In order to clone the MCS, two primer pairs (Seq ID NO.s 8-9 and 10-11) were designed to
amplifu the GFP ORF as shown in SEQ ID NO. 14, from JsGFP-BSK plasmid. The restiction
enzyme sites BamHI arrd Xbalat the 5' end of primer BC1MCSF and XbaI, Mlul andPsfl sites at
the 5, end of primer BCIMCSR have been added. The primer BV1MCSF has been designed to
include sites XbaI and Mlul at 5' end and primer BVIMCSR contains Mlul, Avrll, SpeI and Pstl
sites at 5'end. The fragment amplified with the primer pair BCIMCSF-BCIMCSR was ligated
into T/A vector, digested with BamHl-Pstl and subsequently cloned into
JsGFP_BSK+B1.5_BC1/GFP to obtain JsGFP_BSK+B1.5_BCIA{CS. Similarly the fragment
amplified with the primer pair BCIMCSF-BCIMCSR was ligated into T/A vector, digested with
BamHl-Pstl and subsequently cloned into JsGFP BSK+B1.5-BVI/GFP to obtain
JsGFP_BSK+B I .5-BV 1 /MCS.
The BI.5_BCIA{CS and BI.5_BVIA,ICS fragments were subcloned into the binary vector
pCAMBIA 2300 modified to abolish the PsrI site in its MCS. The modification was done using
the Quick Change Lightning Site Directed Mutagenesis kit (Agilent Technologies) and the
primers listed as SEQ ID NO.s 12 and 13, designed using Quick Change primer design tool
(http://www.eenomics.aeilent.com /primer Design Programjsp), to obtain modified pCAMBIA
-9-
2300. ThE JSGFP_BSK+B1.5_BCIA{CS ANd JSGFP_BSK+B1.5_BCIIIVICS VECTOTS WETE
digested with SacI and SalI to obtain the 81.S-BC1/IvICS and B1.5 BVIA{CS fragments which
were cloned into modified pcambia 2300 to obtain Pcambia-B1.5-BCIA{CS and Pcambia-
81.5_BVla{cs.
Example 2: Agroinoculation of plants.
For agroinoculation, pcambia-Bl.5_BCl/IvICS and Pcambia-B1.5 BVIA{CS were transformed
into Agrobacterium tumefaciens strain GV310l by freeze-thaw method (Holsters et a1.,1978).
Approximately lpg of plasmid DNA for each construct was added to competent cells of
Agrobacterium and plunged in liquid nitrogen for two minutes. The tubes were then incubated at
3Z"C waterbath for 5 minutes, followed by on ice for l0 minutes. One ml LB broth was added to
each tube and was incubated at28"C overnight and shaken constantly at200 rpm. Out of the I
ml, 200p1 was spread on LB plate supplemented with appropriate antibiotics. The hansformed
colonies obtained were screened by restriction digestion.
A primary culture was initiated from a single transformed Agrobacterium colony in LB medium
supplemented with appropriate antibiotics and grown at28C in a shaker ovemight. A secondary
culture was grown to an ODooo of 1.0-1.4 using similar growing conditions, the cells were
harvested and resuspended in 10Mm 2-[N-morpholino] ethane sulfonic acid (MES), l0Mm
MgCl2,200Mm acetosyringone to an ODooo of l. A l:l mixture of resuspension cultures of
pcambia-Al.06 \,vith Pcambia-B1.5-BCIA,ICS and Pcambia-Al.06 with Pcambia-
BI.5_BVIA{CS was prepared. A fivefold serial dilution of each mixed culture was prepared to
obtain inoculum density of OD6ss=0.5 and 0.1 respectively. Six weeksold N. benthamiana plants
were used for agroinoculation. Each mixed inoculum was infiltrated into leaf lamina of young
but fully developed leaves on the adaxial surface using a needle less syringe.
-10-
Example 3: Detection of reporter gene expression in inoculated plants
A hand held B-100AP W lamp (JVP, Upland, CA) was used to monitor GFP fluorescence in
the agroinfiltrated leaves in dark. Photographs were taken with a digital Nikon P3 camera using a
Wrattenl5 yellow filter (Kodak) in dark.
Example 4: Reporter protein quantification
One gram sample of N. benthamiana leaves infiltrated with Agrobacterium were ground in 3 ml
of protein extraction buffer (50mM Tris pH 8.0, l50mM NaCl, 0.1% Triton-X, 0.1% pME).The
extact was clarified by centrifuging at 13,000 rpm for 15 min and supernatant was collected for
further analysis. For quantification of GFP, Samples were diluted 1000 fold in extaction buffer
and dilutions were subjected to spectrofluorimetry with a BioRad Versa Fluor fluorometer using
excitation and emission wavelengths of 490 nm and 520 nm, respectively. Amount of protein
present per gram of teaf tissue was estimated using the standard curve prepared from 0-120 ng
dilutions of pure TACGFPI (Clonetech) protein.
ADVANTAGES OF THIS INVENTION
Expression of protein can be detected within 4-5 days of agtoinoculation of pCAMBIABl.
5_BC[/IvICS and pCAMBIA-B1.5_BVIA{CS containing the gene of interest. The
protein accumulation reaches the manimum level around 8 days after inoculation.
A multi-cloning site has been introduced into each of the constructs for replacing GFP
encoding ORF with any gene whose expression is desired.
In this method, each of the constructs, pCAMBIA-B1.5-BC1A{CS and pCAMBIABI.
5_BVIA{CS containing gene of interest can be co-inoculated with the DNA-A based
construct separately or as a mixfure of all three conshrcts. In the latter case, the
pCAMBIA-81.5_BCI/\{CS and pCAMBIA-BI.5 BVIA{CS constructs may contain the
same or different genes of interest.
l.
2.
3.
-l lTable
I Sequence listing
SEQ Sequence (5'+ 3')
D
Name
SEQ
IDI
BC1(r)R ACTAGTGTCGACAAGCTTC
SEQ GGATCCTGGCCCCGCAG
rD2
BCI(2)F
SEQ
ID3
BCl(3)R TATATCG
SEQ
ID4
BCI(4)F }CAGGGGAAATG
SEQ
ID5
BV1(2)F fu{TA\rqrq'/MT
SEQ
ID6
BV1(3)R TCTAGACCTGCCACCACCATGT
SEQ ETCCATAAGCTCGGATCCTATTAGAC
tD7
BVl(4)F
SEQ CCATCCTCTAGAATGGTGAGCAAGGGCG
ID8
BCIMCSF
SEQ
ID9
BCIMCSR CTGCAGACGCGTTCTAGATTAC'I-T U I AUAUU T UU I UU
SEQ TCTECAECCCGTATGGTGAGCAAGGGCG
ID IO
BV1MCSF
SEQ
ID II
BVlMCSR CTGCAGCCTAGGACTAGTACGCGTI-IAC'I-I U T AUA(JU T UU T
CCATG
SEQ
ID 12
modpCAMB[AF TCCTCTAGAGTCGACGCATGCAAGCTTGGC
SEQ
ID 13
modpCAMBlAR TCTAGAGGA
-12-
sEQ rD NO. 14
atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagct ggac
g g cg acglaaa c g g c ca c a a g t t ca g c g t g t c cg g cg ag g g c g ag g g cg a t g c c a c c t a c
ggcaagctgaccctgaagttcatctgcaccaccggcaagct gcccgtgccctggcccacc
ctcgtgaccaccttcacctacggcgtgcagtgcttcagccgctaccccgaccacatgaag
cagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatctt c
ttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctg
gtgaaccgcatcgagctgaagggcatcgaCttcaaggaggacggcaacatcctggggcac
aagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaac
ggcatcaaggtgaacttcaagatccgccacaacatCgaggacggcagcgtgcagctcgcc
gaccactaccagcagaacacccccatcggcgacqgccccgtgctgctgcccgacaaccac
tacctgagcacccagtccgccctgagCaaagaccccaacgagaagcgcgatcacatggtc
ctgctggagttcgtgaccgccgccgggatcactcacggcatggacgagctgtacaagtaa
-13-
WE CLAIM:
l. Two DNA constructs comprising the transient gene expression vectors based on the
DNA-B of a plant DNA virus, wherein a reporter gene coding sequence flanked by two
MCS replaces the BCI ORF in one and the BVl ORF in the other construct.
The DNA constnrcts as claimed in claim 1 wherein the gene of interest can be any gene
whose expression is desired.
3. The DNA constructs as claimed in claim 2 wherein the gene of interest is a reporter gene.
4. The DNA constructs as claimed in claim 1 wherein the viral genome is derived from a
Geminivirus.
5. The DNA constructs as claimed in claim 4 wherein the viral genome is from DNA-B of
Sri Lanlcan Cassava Mosaic virus.
6. The DNA constructs as claimed in claim 4 wherein the viral genome comprises a
nucleotide sequence of Gen Bank accession number AJ579308, except for l133-1993
comprising the BCI ORF in one and 342-1124 comprising the BVI ORF in the other
construct.
7. The DNA constructs as claimed in claim 4, wherein said geminivirus genome is repeated
at least 1.5 times.
8. The DNA constructs as claimed in claim I containing the primer pairs selected from a
group consisting of SEQ ID No. l, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID
No. 5, SEQ ID No. 6, SEQ ID No. 7,SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ
ID No. l l and SEQ ID No. 13.
2.
-14-
g. The DNA construct as claimed in claim I containing a DNA fragment amplified using
primer pairs selected from the group consisting of SEQ ID No. 1, SEQ ID No. 2, SEQ ID
No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ
ID No. 9, SEQ ID No. 10, SEQ ID No. I I and SEQ ID No. 13.
10. The DNA construct as claimed in claim I where the plant is selected from a group
consisting of Family Solanaceae
ll.The DNA construct as claimed in claim 1 where the plant is selected from a group
consisting of N. benthamiana.
12. A method of transient gene expression using constructs based on a plant DNA virus for
use in expressing any gene of interest in plant.
13. The method as claimed in claim 12, wherein each of the DNA constructs of claim I is co
inoculated with infectious clone based on DNA-A of the same DNA virus for use in
expressing any gene of interest in plant.
14. The method as claimed in claim 13 wherein the step of introducing the DNA into plants
is agroinoculation.
15. The method as claimed in claim 13 wherein the step of introducing the transient
expression constructs is selected from the group consisting of particle bombardment,
Agrobacterium-mediated transformation, Agrodrench, abrasion of plant surfaces and
plasmid inoculation.
Dated this 9th day of September2013
| Section | Controller | Decision Date |
|---|---|---|
| # | Name | Date |
|---|---|---|
| 1 | 2660-DEL-2013-US(14)-HearingNotice-(HearingDate-10-03-2021).pdf | 2021-10-17 |
| 1 | F5.pdf | 2013-09-17 |
| 2 | F3.pdf | 2013-09-17 |
| 2 | 2660-DEL-2013-Correspondence to notify the Controller [09-03-2021(online)].pdf | 2021-03-09 |
| 3 | F2.pdf | 2013-09-17 |
| 3 | 2660-DEL-2013-CLAIMS [18-08-2020(online)].pdf | 2020-08-18 |
| 4 | 2660-DEL-2013-DRAWING [18-08-2020(online)].pdf | 2020-08-18 |
| 4 | DW.pdf | 2013-09-17 |
| 5 | Form 18 [26-07-2016(online)].pdf | 2016-07-26 |
| 5 | 2660-DEL-2013-FER_SER_REPLY [18-08-2020(online)].pdf | 2020-08-18 |
| 6 | 2660-DEL-2013-OTHERS [18-08-2020(online)].pdf | 2020-08-18 |
| 6 | 2660-DEL-2013-FER.pdf | 2019-11-13 |
| 7 | 2660-DEL-2013-FORM 4(ii) [07-05-2020(online)].pdf | 2020-05-07 |
| 8 | 2660-DEL-2013-OTHERS [18-08-2020(online)].pdf | 2020-08-18 |
| 8 | 2660-DEL-2013-FER.pdf | 2019-11-13 |
| 9 | Form 18 [26-07-2016(online)].pdf | 2016-07-26 |
| 9 | 2660-DEL-2013-FER_SER_REPLY [18-08-2020(online)].pdf | 2020-08-18 |
| 10 | 2660-DEL-2013-DRAWING [18-08-2020(online)].pdf | 2020-08-18 |
| 10 | DW.pdf | 2013-09-17 |
| 11 | 2660-DEL-2013-CLAIMS [18-08-2020(online)].pdf | 2020-08-18 |
| 11 | F2.pdf | 2013-09-17 |
| 12 | F3.pdf | 2013-09-17 |
| 12 | 2660-DEL-2013-Correspondence to notify the Controller [09-03-2021(online)].pdf | 2021-03-09 |
| 13 | F5.pdf | 2013-09-17 |
| 13 | 2660-DEL-2013-US(14)-HearingNotice-(HearingDate-10-03-2021).pdf | 2021-10-17 |
| 1 | NCBIBlast_NucleotideSequence_04-11-2019.pdf |
| 1 | tposearch_04-11-2019.pdf |
| 2 | NCBIBlast_NucleotideSequence_04-11-2019AE_04-02-2021.pdf |
| 3 | NCBIBlast_NucleotideSequence_04-11-2019.pdf |
| 3 | tposearch_04-11-2019.pdf |