Abstract: Disclosed herein is an antifungal drag target comprising a polypeptide sequence of Candida albicans , referred to as Carl, which is involved in regulating the morphogenetic transformation and viralence in response to engulfinent by the immune response cells of its model host is described. The gene is unique in its ability to affect the virulence-associated morphogenesis in vivo but is not required for the morphogenesis in vitro. The putative membrane localization and its effect on cell wall integrity indicates that it is an ideal anti-candid drug target by virtue of its predicted easy accessibility to lead molecules/chemicals and its ability to affect viralence.
The invention relates to an antifungal drug target comprising a polypeptide sequence, a composition for treating Candida infections using the polypeptide sequence, a method of modifying the nucleic acid sequence, the nucleic acid sequence so produced and uses thereof
FIELD OF THE EWENTION
The present invention relates to an anti Candida drug target comprising a polypeptide sequence and a carrier. The said drug target uses a gene expressed in Candida albicans,
BACKGROUND OF THE INVENTION
Candida albicans is opportunistic yeast that lives in the gastrointestinal and genitourinary tract of most humans. In a healthy hmnan body, the population of Candida is kept in check by the immune system and by the normal micro flora of the respective niches in the host microorganisms. When the immune system is compromised, as in AIDS patients and in patient’s xmdergoing immunosuppressive therapy, Candida albicans can cause mimosa as well as systemic infection or "Candida mycosis". If left xmtreated, such systemic infections frequently lead to the death of the patients. Candida albicans is a species of particular interest to medical professionals and scientists because a very large fraction of all cases of Candida mycosis are caused by this species.
Two classes of antifungal drugs are used to fight Candida infections. The fungicidal polyene drugs such as amphotericin B act by disrupting membrane function while the fungistatic azoles, such as fluconazole and ketoconazole, act by inhibiting the ergosterol biosynthetic pathway. Amphotericin B is the most effective antifungal drug, but it is more toxic and is less tolerated by the body than the azoles. As a result, azoles have become the drug treatment of choice for many mucosal fungal infections. At present, the therapy principally available for invasive infections is based on relatively few antifungal antibiotics such as the azole derivatives fluconazole and itraconazole or nystatin, amphotericin B and flu cytosine. Most of these compounds have serious side effects like tissue toxicity (See Roman et al., Curd. Pin. Microbial. 6: 338-343, 2003) A serious need in developing newer antifungal drugs has been felt, especially since rise in
conditions like AIDS and use of immune suppressive drugs in various medical conditions which has led to significant increase in incidence of Candida infections. Newer drugs, to novel targets in the pathogen could also address a serious problem of drug resistant strains of Candida albicans reported all over the world. Major efforts have been recently focused on identifying newer and unique potential drug targets.
The present invention provides a novel anti-Candida drug target for treating Candida albicans infection. Furthermore, the invention also provides an isolated polynucleotide sequence coding for a protein that is linked to the morphological transition between the yeast to hyphal state of Candida albicans in vivo as well as its ability to survive engulfinent by phagocyte macrophages.
SUMMARY OF THE INVENTION
The invention disclosed herein provides an antifungal drug target comprising a polypeptide sequence of SEQ. ID NO: 2 and a carrier.
The invention also provides a composition for treating Candida albicans infections comprising a polypeptide sequence SEQ ID NO: 2 and a carrier.
One another aspect of the invention is to provide a method of modifying a nucleic acid sequence of SEQ ID NO: 1 by deletion comprising the steps of:
a. generating two primers each about 93-94 nucleotides long;
b. amplifying two different nutritional marker genes URA3 and ADE2;
c. transforming the PCR products generated with URA3 and ADE2 markers in the
WT strain C AI8 and
d. isolating the transfonmants
The primers for the method described herein comprise 5' terminal sequence of forward primer corresponding to 70 nucleotides immediately upstream of the ATG of the open reading frame of SEQ ID NO: 1 and remaining corresponds to the puck (forward) primer sequence and the 5' terminal sequence of the dis(R) primer corresponding to 70 nucleotide sequence immediately downstream of the termination cod on TAA of the open
reading frame of SEQ E) NO: 1 and the remaining corresponds to the puck (reverse) primer sequence.
The gene designated as CaSRFl expressed by Candida albicans that is involved in modulating the morphogenetic transformation and virulence upon engulfinent by the imide response cells of the host.
The isolated polypeptide of CaSRFl gene comprising an amino acid sequence of SEQ ID NO: 2, modified by the process described above, is used in making the antifungal drug target. The invention may also include naturally occurring allelic variant of the sequence given by SEQ ID NO: 2. Furthermore, the polypeptide variant includes any amino acid specified in SEQ ID NO: 2 that may be changed to provide a conservative substitution.
Another aspect of the invention is to provide a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 1 encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 2. The invention also includes the nucleotide sequence of the naturally occurring allelic nucleic acid variant of SEQ ID NO: 1. In addition, any single nucleotide polymorphism of SEQ ID NO: 1 is encompassed by the instant invention. The invention also provides a vector comprising the nucleic acid sequence of SEQ ID NO: 1 and a transformed host cell comprising the said vector,
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 illustrates the nucleotide sequence of the open reading frame designated as SEQ
IDN0:1.
Figure 2 illustrates the deduced amino acid sequence of the open reading frame of SEQ
IDNO:l
Figure 3 illustrates the expression analysis of CaSRFl in yeast versus hyphal favoring
conditions.
Figure 4a illustrates the deletion strategy used to generate a homozygous deletion mutant
PSC2, Figure 4b illustrates primer sequences used for amplification of the nutritional
markers for disruption of the CaSRFl alleles Figure 4c effect of the deletion in vitro on
membrane stability.
Figure 5 illustrates the effect of macrophage engulfinent on Casrfll Casrfl deletion
mutant.
Figure 6 illustrates the survival curve for mice infected with 10 cells of homozygous
deletion mutant PSC2, cphlefgl/cphlefgl, Sc5314 or heterozygous mutant strain PSCL
DETAILED DESCRIPTION OF THE INVENTION
The present invention describes a novel polynucleotide of 591 nucleotides length that encodes a protein that is specifically expressed in the yeast form of Candida albicans in effect plays some role in sensing of altered environmental conditions by the pathogen. The sequence of the polynucleotide given in Figure 1 and designated as SEQ ID NO: 1 is a part of the gene referred to as CaSRFl/ IPF9211.5/CA3142/orf6.5311/orfl9.3713 (http://www.candidagenome.org). Since it was identified as a genetic suppressor of temperature sensitivity of mutant of 5. cerevisiae gene RPB4, the gene of the present invention is termed as CaSRFl (Candida Suppressor of Rpb Four) pending approval fiow the Candida Genome Database (CGD) curators.
The polynucleotide of the instant invention is capable of encoding a novel polypeptide, which is 196 amino acids in length. The sequence of the polypeptide is given in Figure 2 and designated as SEQ ID NO: 2. The BLAST analysis (WU-blasting, V2.0MP-WashU, 13-Dec-2004) revealed no homologous protein that has significant similarity to the novel protein described herein (SEQ ID NO: 2). The analysis of the sequence using a tool SMART (2) revealed the presence of four trans-membrane domain segments. These segments are hypothesized to be involved in association with cellular membranes.
The expression anal3^is revealed that the expression of this novel protein represented as SEQ ID NO: 2 is dramatically reduced in cells xmdergoing hyphal morphogenetic madder a variety of conditions such as growth at 37^C in YPD containing 10% fetal bovine serum or Lee's medium or Spider medium (see Annexure I), RPMI containing 10% fetal bovine serum etc (Example 1).
Since Candida albicans is a diploid organism with no known stable haploid state, genetic manipulation necessitates eliminating both the copies of the gene in question. Deletion of
this sequence from the genome of Candida albicans eliminates the protein being made in the cell and affects the integrity of the cell walls making the cells sensitive to cell wall disturbing agents such as 0,01 % SDS and calcofluor 10 g /ml present in laboratory culture media (See Examples 2 and 3).
One of the major responses of the C. albicans to a variety of environmental conditions is its morphological transition. The transition from the yeast form to the hyphal or pseudohyphal form is tightly associated with the virulence of the organism. The ability of the Candida albicans to form hyphal projections after being engulfed by the phagocytic cells of the immune system contributes greatly to overcoming the cell mediated immunity ensuring its survival in the host and ability to cause infections (Rooney and Klein, 2002, Cell Microbiol 4: 127-137, Gow et al., 2002, Curr. Pin. Microbiol. 5: 366-371)
Candida albicans is capable of differentiating in a reversible fashion between a bud and a hyphal growth form, which is influenced by environmental conditions. For example, pH and temperature influence the transition between bud and hypha while temperature, UV, white blood cell metabolites and so on affect the morphological transition shown by this organism. The morphological changes made by C. albicans in response to environmental cues indicate that the organism uses a sensory mechanism to register and assess environmental alterations. It was observed that the mutant strain lacked the ability to form hyphae piercing the macrophage cells (see Example 4) indicating the role of homozygous deletion mutant PSC2 of the present invention, especially in the macrophages. The inability of the mutant Candida cells to destroy the macrophage cells is seen as an indication of reduced virulence of the mutant cells thus suggestive of the role of this novel protein in macrophages. Furthermore, the protein of the instant invention (SEQ ID NO: 2) appears to be essential for virulence in disseminated candidacies as seen in mouse model system described in Example 5.
The present invention is described further below by reference to the following illustrative examples.
EXAMPLE 1
Expression analysis and Transcriptional profile ofCaSRFl:
Composition of the media used for culturing the Candida albicans cells is presented in Admixture L To test whether transcription of CaSRFl was regulated during hyphal morph genesis, Northern blots of total RNA of the SC5314 strain incubated in YPD medium favoring the yeast condition and RNAs from cultures showing various extents of hyphae induced by addition of serum (10%v/v) were probed with the DNA fragment spanning the entire open reading frame spanning sequence. The CaSRFl transcript was detectable at high level in cultures showing a high fraction of cells in the yeast form. As the cells were shifted to the hyphae inducing condition in presence of serum the levels of transcript of this gene were reduced drastically and rapidly being completely shut off by 2 hrs. This was true for many other hyphae inducing growth conditions (Figure 3). The converse was foxmd to be true in that the cell cultures induced to be mainly (>90% population) in hyphal state when transferred to conditions favoring yeast form the transcript of this gene reappeared although at much slower kinetics as conversion to yeast form takes much longer and only by about 12 hom^ can one see the culture mainly containing yeast form cells. Both these analyses were carried out using RT PCR technique with open reading frame specific primers.
EXAMPLE 2
Deletion of CaSRFl in C albicans Strain CAI8:
The strategy used for deletion of both the alleles of the CaSRFl gene is shown in Figure 4a. In order to generate a CaSRFl deletion cassette, two primers each about 93-94 nucleotides long (Figure 4b) were generated. The 5' terminal sequence of forward primer corresponds to 70 nucleotides immediately upstream of the ATG of the open reading frame and the remaining corresponds to the puff primer sequence. The 5' terminal sequence of the dis(R) primer corresponds to 70 nucleotides immediately downstream of the termination cod on TAA of the open reading frame and the remaining corresponds to the pUCr primer sequence. This allowed the amplification of two different nutritional
marker genes UR43 and ADE2 respectively cloned previously in the vector pPS5 using PCR amplification method (Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Greene Publishing and Wiley-Interscience, New York, 1995). The PCR products generated respectively with URA3 and ADE2 markers flanked by the homologous sequence to the xmtranslated regions of the CaSRFl gene are -1.4 and -2.5 kb respectively.
These were transfonned in the WT strain CAI8 C albicans CAI8 {ade2::hisG/ade2::hisG ura3::imm434/ura3::imm434) (Fungi and Irwin, 1993, Genetics 143:712-728) by the transformation method employing lithium acetate whereby yeast cells are briefly incubated in buffered lithium acetate and transforming DNA is introduced with carrier DNA. Addition of polyethylene glycol (PEG) and a heat shock trigger DNA uptake (Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Greene Publishing and Wiley-Interscience, New York, 1995). The insertion of the above PCR product in the correct locus in the transformants obtained was confirmed by PCR employing the nutritional marker specific internal primers and a primer upstream of the CaSRFl gene. The homozygous deletion was confirmed by northern analysis, which showed complete absence of the gene specific transcript as expected.
EXAMPLES
Fxmctional Characterization of the Casrfl/ Casrfl null Mutant of Strain CAJ8:
To test whether the Casrfl/ Casifl i.e. homozygous deletion mutant PSC2 is affected in its ability to show morphological variation like its parent strain, testing was carried out as to how the WT strain CAI8 and the clinical isolate SC5314 behave in presence of serum and some of the other conditions under which C albicans strains are reported to show hyphal transition associated with virulence. The experiments were carried out at 37** C. In all conditions tested, no significant difference in hyphae formation was observed. Especially the serum induced hyphae formation was seen in the mutant having either no copy of the CaSRFl gene or one copy or two copies as in WT. Similarly the solid media such Lee's medium, YPS medium, YEPD+10% serum as well as media in which pH
induced hyphae formation is tested showed no difference. While since the protein is predicted to have four transmembrane domains, it is likely, that it plays some role in the membrane/ cell wall integrity. Two chemicals, SDS and calcofluor, resistance to which is dependent on the integrity of the cell wall of the yeast cell (Moreno et al. FEMS Microbiol. Lett, 226, 159-167) were employed to test if there was any defect in the cells lacking the CaSRFl protein. It wish observed that the homozygous strain was sensitive to 0.05% SDS and 5^g/ml of Calcofluor,
ADE2 primers referred above are:
Forward primer-CAGATCTCAACACCAATAATTGATGAAAC
Reverse primer-CCTCGAGTAAGAAGGGAAAAGCACCAC
URA3 primers referred above are:
Forward primer (5'-3') -CAAGCTT AATAGGAATTGATTTGGATGG
Reverse primer (5'-3') - TCTAGAAGGACCACCTTTG
EXAMPLE 4
Morphological changes of the homozygous deletion mutant PSC2:
The Candida albicans strains (Wt. homozygous or heterozygous sofa strain) were co-incubated with mouse macrophage cell line (or peritoneal macrophages) grown in RPMH-10% FCS in 6 well plastic trays for upto 6 hrs and at one hour interval the morphology of the Candida cells was recorded using Leila bright field inverted microscope.
The homozygous deletion mutant PSC2 does not have overall defect in forming hyphae, since the cells incubated in media containing serum as well as other hyphae promoting media (listed in Admixtures I) show no difference in the ability of forming hyphae when compared with the clinical isolate SC5314 widely used in laboratory research (Figure 5). On the other hand, the mutant cells were observed to be engulfed by the activated macrophage cells of the imide system but unlike the parent strain were unable to form hyphae piercing the macrophage cells. This inability of the mutant Candida cells to
destroy the macrophage cells was seen as an indication of reduced virulence of the mutant cells in turn the observation was considered suggestive of the role of this protein specifically in macrophage.
EXAMPLE 5
In vivo survival in the presence of homozygous double mutant:
10 cells of the mutant Candida albicans strain per animal were injected in five, 4-week old BALB/c mice via tail vein route. As a control 10 cells of Candida albicans wild type strain SC5314 were injected in five, 4-week old BALB/c mice. The mice in this control group were unable to survive for more than 5 days consistently in three experiments including 5 mice per group in an experiment. The result of a typical experiment is shown in Figure 6 wherein mice were injected with homozygous deletion mutant PSC2, cphlefgl/cphlefgl, Sc5314 or heterozygous PSCL The homozygous deletion mutant PSC2 revealed 100% survival similar to the negative control {cphlefgl/cphlefgl) as against the wild type (Sc5314) and the heterozygous mutant (PSCl),
All publications and patent applications referred to in this specification are indicative of the level of skill of those in the art to which the invention pertains.
Other objects, features and advantages of the present invention will become apparent fiow the foregoing detailed description and examples. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given only by way of illustration.
Annexure I
Media compositions of the media used for culturing the Candida albicans cells.
YPD/YPG Synthetic Complete + Serum
Yeast Extract : Igm Dextrose : 2gm
Peptone : 2gm DM :20ml
Dextrose/Galactose: 2gm FCS rlOml
Water :70ml
Spider medium
Peptone : Igm
YPD-f Serum
Yeast Extract : Igm
Yeast Extract : 1 gm
NaCl : 0.5gm
Peptone : 2g;m
Mannitol : l.Ogm ^Dextrose : 2gm
Water :90ml
Lees Medium
(NH4)2 SO4 :0.5gm
MgS04 :0.2gm
K2HPO4 : 0.25gm
NaCl : O.Sgm
Glucose : 1.25gm
Biotin : 0.001 gm
DM :20ml
Water : 80 ml
We Claim:
1. An antifungal drug target comprising a polypeptide sequence of SEQ ID NO: 2,
which is 196 amino acids in length or a naturally occurring allelic variant thereof,
and a carrier.
2. A composition for treating Candida infections comprising a polypeptide sequence which is 196 amino acids in length or a naturally occurring allelic variant thereof, SEQ ID NO: 2 and a carrier.
3. A method of modifying a nucleic acid sequence of SEQ ID NO: 1 by deletion to obtain isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 2 which is 196 amino acids in length or a naturally occurring allelic variant thereof, said method comprising the steps of:
a. Generating two primers each about 93-94 nucleotides long, said primers
comprising 5' terminal sequence of forward primer corresponding to 70
nucleotides immediately upstream of the ATG of the open reading frame of SEQ
ID NO: 1 and remaining corresponds to the puff primer sequence and the 5'
terminal sequence of the dis(R) primer corresponding to 70 nucleotide sequence
immediately downstream of the termination codon TAA of the open reading
frame of SEQ ID NO: 1 and the remaining corresponds to the pure primer
sequence;
b. amplifying two different nutritional marker genes URA3 and ADE2;
c. transforming the PCR products generated with URA3 and ADE2 markers
in the WT strain CA18 and
d. isolating the transfonmants.
4. An isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 2
which is 196 amino acids in length or a naturally occurring allelic variant thereof,
obtained by the method of claim 3.
5. The polypeptide of claim 4, wherein the variant is the translation of a single
nucleotide polymorphism.
6. The polypeptide of claim 5 that is a variant of SEQ ID NO: 2, wherein any amino
acid specified in the chosen sequence is changed to provide a conservative
substitution.
7. An isolated nucleic acid molecule comprising a nucleic acid sequence of SEQ ID
NO: 1 encoding a polypeptide comprising an amino acid sequence of SEQ ID
NO: 2.
8. The nucleic acid molecule of claim 7, wherein the nucleic acid molecule
comprises the nucleotide sequence of a naturally occurring allelic nucleic acid
variant.
9. The nucleic acid molecule of claim 8, wherein the nucleic acid molecule
comprises a single nucleotide polymorphism of SEQ ID NO: 1.
10. The nucleic acid molecule of claim 9, wherein the said nucleic acid molecule
comprises a nucleotide sequence of SEQ ID NO: 1.
11. The nucleic acid molecule of claim 7, wherein the said nucleic acid molecule
hybridizes under stringent conditions to the nucleotide sequence given by SEQ ID
NO: 1 or its complement.
12. A vector comprising a nucleic acid sequence of SEQ ID NO: 1 encoding polypeptide comprising an amino acid sequence of SEQ ID NO: 2.
13. A transformed host cell comprising the vector of claim 12.
| # | Name | Date |
|---|---|---|
| 1 | 562-CHENP-2008 FORM-13 11-06-2009.pdf | 2009-06-11 |
| 1 | 562-CHENP-2008_EXAMREPORT.pdf | 2016-07-02 |
| 2 | 562-chenp-2008-form 5.pdf | 2011-09-03 |
| 2 | 562-CHENP-2008 CORRESPONDENCE OTHERS 08-08-2012.pdf | 2012-08-08 |
| 3 | 562-chenp-2008-form 3.pdf | 2011-09-03 |
| 3 | 562-CHENP-2008 FORM-1 08-08-2012.pdf | 2012-08-08 |
| 4 | 562-CHENP-2008 FORM-13 08-08-2012.pdf | 2012-08-08 |
| 4 | 562-chenp-2008-form 26.pdf | 2011-09-03 |
| 5 | 562-chenp-2008-form 1.pdf | 2011-09-03 |
| 5 | 562-chenp-2008-abstract.pdf | 2011-09-03 |
| 6 | 562-chenp-2008-drawings.pdf | 2011-09-03 |
| 6 | 562-chenp-2008-claims.pdf | 2011-09-03 |
| 7 | 562-chenp-2008-description(complete).pdf | 2011-09-03 |
| 7 | 562-chenp-2008-correspondnece-others.pdf | 2011-09-03 |
| 8 | 562-chenp-2008-description(complete).pdf | 2011-09-03 |
| 8 | 562-chenp-2008-correspondnece-others.pdf | 2011-09-03 |
| 9 | 562-chenp-2008-drawings.pdf | 2011-09-03 |
| 9 | 562-chenp-2008-claims.pdf | 2011-09-03 |
| 10 | 562-chenp-2008-abstract.pdf | 2011-09-03 |
| 10 | 562-chenp-2008-form 1.pdf | 2011-09-03 |
| 11 | 562-CHENP-2008 FORM-13 08-08-2012.pdf | 2012-08-08 |
| 11 | 562-chenp-2008-form 26.pdf | 2011-09-03 |
| 12 | 562-chenp-2008-form 3.pdf | 2011-09-03 |
| 12 | 562-CHENP-2008 FORM-1 08-08-2012.pdf | 2012-08-08 |
| 13 | 562-chenp-2008-form 5.pdf | 2011-09-03 |
| 13 | 562-CHENP-2008 CORRESPONDENCE OTHERS 08-08-2012.pdf | 2012-08-08 |
| 14 | 562-CHENP-2008_EXAMREPORT.pdf | 2016-07-02 |
| 14 | 562-CHENP-2008 FORM-13 11-06-2009.pdf | 2009-06-11 |