Sign In to Follow Application
View All Documents & Correspondence

A Novel Process For Production Of Recombinant Human G Csf

Abstract: The present invention relates to Recombinant human Granulocyte Colony Stimulating Factor (G-CSF) and describes a novel process for high-level expression, a simple, economically feasible, largely scalable production of RPG-CSF— from bacterial cells. The invention comprises of the development of transcriptional and translational conditions of G-CSF gene to improve the level of protein expression resulting in the increase of specific and volumetric product yield. The specific product yield in batch mode fermentation is 68mg/L/OD and the level of protein expression is 45% on total cellular protein. The volumetric product yield in fed batch mode fermentation is 4.2 g/L.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
05 February 2007
Publication Number
48/2008
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

NATCO PHARMA LIMITED
NATCO PHARMA LIMITED NATCO HOUSE, ROAD NO.2, BANJARA HILLS, HYDERABAD, ANDHRA PRADESH, INDIA - 500 033

Inventors

1. DASARI VENKATA KRISHNA RAO
NATCO PHARMA LIMITED NATCO HOUSE, ROAD NO.2, BANJARA HILLS, HYDERABAD, ANDHRA PRADESH, INDIA - 500 033
2. ADIBHATLA KALI SATYA BHUJANGA RAO
NATCO PHARMA LIMITED NATCO HOUSE, ROAD NO.2, BANJARA HILLS, HYDERABAD, ANDHRA PRADESH, INDIA - 500 033
3. VENKAIAH CHOWDARY NANNAPANENI
NATCO PHARMA LIMITED NATCO HOUSE, ROAD NO.2, BANJARA HILLS, HYDERABAD, ANDHRA PRADESH, INDIA - 500 033

Specification

A NOVEL PROCESS FOR PRODUCTION OF RECOMBINANT HUMAN G-CSF
Field of the invention:
The present invention relates to a novel process by simple, economically feasible and largely scalable production of rhG-CSF using novel mutant gene. The process leads to the synthesis of mutant gene, cloning into protein expression vector, transformation into E.Coli, and intracellular high-level expression of protein as inclusion body. More specifically the invention is directed to study and establishment of processing method for high-level expression of G-CSF. In this connection the specific and volumetric product yields are established by developing the transcriptional and translational conditions of G-CSF gene. The G-CSF product of this invention is amenable to purification to get high recovery of biologically active protein with pharmaceutical grade quality.
Background of the invention:
Colony stimulating factors are a group of hematopoietic proteins; which stimulate the proliferation and differentiation of hemopoietic cells from pluripotent stem cells. Among the colony stimulating factors G-CSF, GM-CSF and M-CSF are specific for prolifiration of granulocytes and macrophages.G-CSF is a lineage specific colony-stimulating factor and particularly increases the production of infection fighting white blood cells- neutrophils, by stimulating the specific bone marrow precursor cells and their differentiation into granulocytes. Neutrophils from a critical component of host defense mechanisms against bacterial and fungal infections. G-CSF is used for granulocytopenic recovery from neutropenia caused by Chemotherapy and Radiation. G-CSF is produced by monocytes, fibroblasts and endothelial cells. A single G-CSF gene exists on human chromosome 17 in region q21-q22 and splits into four introns of about 2500 nucleotides (Nagata etal 1986, Nature: 5 (3) 575-81). About 80% of the G-CSF mRNA is produced from human carcinoma cells (sqamous CHU2 and bladder 5637), encode a polypeptide (including signal sequence) containing 204 amino acids; while the rest of mRNA encode a polypeptide (including signal sequence) containing 207 amino acids. The first 30 amino

acids at N-Terminal region of G-CSF polypeptide is signal sequence. The two different mRNAs are generated by alternative use of the 3' donor sequence of the intron -2 of the G-CSF gene. The protein containing 174 amino acid chain is more potent than the protein containing 177 aminoacid chain. Generally for many therapeutics, glycosylation of protein is required for bio-potency and stability. Similarly Human G-CSF protein has only one single O-Glycosylation site at Threonine 133. But the O-glycosylated sugar moiety is not required for biological potency and stability. The nonglycosylated E.coli derived human G-CSF is also biologically active as produced in mammalian cell lines [Oh-eda et al 1990, J. Biol. Chem. 256, 11452-11435; Arkowa et.al 1993} J. protein Chem. 12, 525-531 and Hill et al 1993, Proc. Nat Acad Sci, USA 90, 5167-5171 J.
Human G-CSF can be produced in eukaryotic organisms (yeast and mammalian cell lines) and prokaryotic organisms like bacteria. The form of G-CSF produced depends on the type of host organism used for expression. If the G-CSF is expressed in eukaryotic cells, it is produced in a soluble form and secreted. When G-CSF is produced in prokaryotic cells, the product is formed as inactive inclusion bodies. Normally inclusion bodies have a secondary structure and are densely aggregated. It is revealed that the combination of so many factors of physiological state of host cell and growth conditions are affected by the formation of inclusion bodies.
The gene encoding G-CSF from a tumor cell line and peripheral blood monocytes can be used for cloning. Production of biologically active human G-CSF protein from inactive inclusion bodies expressed by rDNA technology in commonly used prokaryotic host cells is very difficult. Efficient process methodologies are desirable for manufacture of therapeutically useful G-CSF on industrial scale. Various methods have been reported in scientific literature for the production of G-CSF in E.Coli, yeast, or CHO cells.
Recombinant human G-CSF has been produced by expressing the G-CSF gene in E.Coli and purifying it to homogeneity. Many U.S patents US-4,810,643; 4,999,291; 5,055,555; 5416195; 5,580,755; 5,582,823; 5681720; 5714581; 5,830,705; 5,849,883, and many European patents EP-0215126; 0169566; 0237545; 0272703; 0459630; 0256843 and other patents like GB2213821; WO 03/051922; WO8604506; WO8604605; WO8703689; WO2004/001056 and WO2006/097944 describe various aspects of

expression and purification of G-CSF protein from different expression systems like prokaryotic and eukaryotic cells.
Expression of G-CSF in bacterial systems is described in US 4,810643 and US 4,999,291. In the preferred processes, G-CSF gene is synthesized, cloned and transformed into in E.Coli. The protein is expressed by inducing the culture by elevating the temparature upto 42°C. Conditions and parameters for cloning and expression by fermentation are not clear. A number of steps are involved in clone construction. The process is performed under flask conditions and the level of protein expression is 3 - 5% only on total cellular protein basis. The optical density (OD600) of the culture is L2 at the end of the process. The process yield is also not disclosed in the processes described by the above patents.
EP 220520, WO87/01132 and WO88/01297 describe the cloning of G-CSF. In the preferred process, a cDNA clone is constructed from the human bladder carcinoma cell line No.5637. This cell line has been deposited with ATCC as described in U.S patent 5,055,555. Cloning strategies and expression vectors for eukaryote and prokaryote hosts are described by Pouwela et.al (cloning vectors: A laboratory manual, Elsevier, N.Y., 1985) and Sambrook and Russell et.al (Molecular cloning. A laboratory manual. Cold spring harbor laboratory press. 1989). United States patent, US 5,055,555 describes a simplified process for production of human G-CSF from eukaryotic cells. Achieving protein secretion through extracellular eukaryotic organisms forms an entirely different technology in comparison with protein expression through intracellular prokaryotic organisms. United States patent, US 5416195 describes a simple and fed batch fermentation process for expression of G-CSF analog in E.Coli. The process time before induction, culture optical density at the time of induction, concentration of inducer, time and mode of induction and the other key process parameters like, agitation speed and dissolved oxygen concentration are not mentioned. The exact values of Process yield and level of expression are not disclosed in this patent.
United States patents, US 5582823 and 5,830,705 describe the synthesis of G-CSF gene,cloning and transformation into E.Coli. The protein is expressed by inducing the culture by elevating the temparature upto 42° C. A number of steps are involved in clone construction. The conditions and parameters for cloning and expression by

fermentation are not clear. The process is performed under flask conditions and the level of protein expression is 3 to 5% only on total cellular protein. The optical density (OD600) of the culture is 1.2 only at end of the process. Process yield is not clear in the processes described in the above patents. United States patent, US 5,849,883 describes a process for isolation of human and bovine G-CSF gene cloning and transformation into E.Coli. The level of expression is 5% on total cellular basis and the expression level of analog of Bovine G-CSF in E.Coli is 30% on total cellular basis. The conditions, compositions and key parameters of the fermentation process are not clearly disclosed. Process yields are not mentioned in this patent.
EP0169566, WO8604506 and WO 8604605 describe methodology for the expression of human gene encoding a novel polypeptide (CSF) having the capacity to promote differentiation and proliferation of bone marrow cells. GB 2213821 discloses the construction of a synthetic human G-CSF gene; other patents for production of G-CSF include US 5,681,720; US 5,714,581 EP0256843, EP0272703, EP0335423 and EP 0459630. These patents describe the modifications of amino acid sequence, their expression and biological activities. Similarly the Australian patent publication No: AU A-76380/91 reported the construction of various muteins of G-CSF and their comparative activities. But fermentation processing conditions and compositions are not clear and process yields are not mentioned and level of expression of desired protein on total cellular protein is not disclosed.
WO 2004/001056, describes the synthesis of G-CSF gene from human bladder carcinoma cell line NO: 5637, cloning the G-CSF gene in to pET-3a expression vector and transformation in to E.Coli (BL21(DE3). Expression of the G-CSF protein is performed by induction with IPTG. The product yield is 3.0 to 3.5 g/L and level of expression is 30-40 % on total cellular protein. But the sequence of the primers is not mentioned. The key parameters like composition of growth medium, composition of feed medium, mode of feeding in fed batch fermentation, process time before induction, culture optical density at the time of induction, concentration of inducer, time and mode of induction are not discussed. The exact values of process yield and level of expression are not disclosed in this patent.

WO2006/097944 describes the synthesis of G-CSF gene from human urinary bladder carcinoma cell line, cloning the G-CSF gene in to pTCF -01 expression vector and transformation in to E.Coli. Expression of the G-CSF protein is performed by induction with IPTG. But the sequence of the primers is not mentioned. Also the conditions and key parameters like composition of medium, concentration of inducer, processing time, processing temp, pH, level of aeration, culture optical density, and mode of fermentation process are not discussed. Process yields and level of expression are not disclosed in this patent.
Various production methods discussed in the above patents involve different cloning techniques using different vectors and promoters for expression of G-CSF from bacteria. None of the above patents disclosed a simple and viable processing method for high-level expression of G-CSF on industrial scale. Since G-CSF is a therapeutic protein, rich in G+C content at N-terminal region of native gene and the protein is hydrophobic in nature, highly controlled processing parameters are essential for improving the transcriptional and translational conditions of gene to get high-level expression. Practical enabling conditions, compositions and key parameters for High-level expression of G-CSF were not reported so far and it is desirable to have them in place.
On a commercial scale, loss in yield and quality of finished product become significant in an un-established process with low-level protein expression. Hence simplified and practical enabling procedures with fewer steps are desirable to produce higher yields with high-level protein expression.
In an effort to obviate the major problems associated with the manufacture of recombinant human G-CSF, a simple, industrially viable process for high-level expression of G-CSF has been now developed and disclosed through the present invention.
Summary of the invention:
The present invention relates to Recombinant human Granulocyte Colony Stimulating Factor (G-CSF) and describes a novel process for high-level expression of rhG-CSF from bacterial cells. The methodology of the present invention consists of developing the transcriptional and translational conditions of G-CSF gene, high-level

expression of protein in bacteria for maximizing the specific and volumetric product yield,
The said invention comprises of the follow discrete steps:
a) Synthesis of novel mutant gene from native G-CSF gene.
b) Construction of recombinant clones with mutant G-CSF genes.
c) Establishing the key parameters for specific product yield by shake flask study and Volumetric product yield by specific growth rate based fed batch fermentation process.
Preferably, the mutant G-CSF gene is synthesized by site directed mutagenesis for developing the translational conditions of native gene and transcriptional conditions of gene is developed by inserting the gene under strong promoter of plasmid vector to enhance the expression of protein. The recombinant clone is transformed in to suitable E.Coli host organism. The key parameters like composition of medium, concentration of inducer, post induction time for specific product yield and specific growth rate is established for volumetric product yield. The level of protein expression is 32 to 45 % on total cellular protein and the volumetric product yield is 3.0 to 4.2 g/L depending on the characteristics of the mutant gene present in the recombinant clone, type of host, conditions, compositions and key parameters of the process.
DETAILED DESCRIPTION OF THE INVENTION:
A simple and innovative method for high-level expression of recombinant Human G-CSF has been developed. In this invention microbial expression (bacterial) systems are used to produce nonglycosylated human G-CSF in genetic engineering technology. The human mutant G-CSF gene is synthesized by site directed mutagenesis from native gene, which is isolated from human peripheral blood monocytes. The mutant gene is cloned into a suitable bacterial expression vectors and transformed into suitable host strains and the recombinant bacterial clones are screened by antibiotic markers. Specific and volumetric product yields are established by study of high-level expression of G-CSF.

Construction of recombinant clone with mutant G-CSF gene
The present invention relates to a novel process for the Production of human G-CSF protein from transformed E.Coli using a mutant gene. Various genetic engineering and fermentation techniques are used to result in a highly efficient and industrially viable process for high-level expression of G-CSF. The present invention is described in detail below.
The human G-CSF gene used in the present invention has resulted by
incorporating mutations in the native gene, without changing the amino acid sequence.
Six and Eight mutations are incorporated by site directed mutagenesis to maintain the
A+T content at N-terminal region of the native gene, "GCGCCATATGACACCATTAG
GACCTGCCAGCTCCCTGC" and
"GCGCCATATGACACCATTAGGACCTGCCAGCTC CTT ACCCCAG" as final forward primers and "GCGC GGATCCTTATCAGGGCTGGG CAAGGT" as reverse primer are used to amplify the mutant genes including Ndel and BamHl restriction sites (indicated by underlines) by PCR. The PCR amplified each mutant gene (548bp) and pET- based vectors like pET-3, pET-9, pET-11, pET-21, pET-23 etc, preferably pET-3a, pET-9a, pET-lla, are individually digested with Ndel and BamHl restriction enzymes and ligated with T4 DNA ligase. BL21 (DE3) series like BL21 (DE3), BL21 (DE3) PlysS and BL21 (DE3) PLysE competent cells are transformed with recombinant vector containing the mutant G-CSF gene and the transformants are screened by antibiotic markers.
Protein expression
High level Expression of protein can be achieved by developing the transcriptional and translational conditions of human G-CSF gene. The translational rate is enhanced by maintaining the G+C content at N-terminal region of gene according to E.Coli codon bias preference. The G+C content at N-terminal region of gene is maintained by adopting the mutations through site directed mutagenesis. The transcriptional rate is enhanced by inserting the mutant G-CSF gene under strong promoter of expression plasmid vector like pET series, PR.SET series etc. preferably pET series vectors like pET-3a, pET-9a and pET-lla comprising the T7 promoter and T7 RNA polymerase, which is one of the most important and strong promoters for high-level

transcription of heterologous gene in E.Coli. Basal or leaky expression of protein during the pre induction phase of culture is controlled by reducing the T7 RNA polymerase through T7 lysozyme (produced by PlysS and PlysE plasmids). Consequently toxicity is prevented to the host cell and the culture growth rate is enhanced.
High-level expression of protein is also based on the study of a number of parameters of the fermentation process. Some key parameters like composition of medium, concentration of the inducer and effect of heterologous protein expression on cell growth are established for specific product yield. Similarly volumetric product yield is enhanced by employing the key parameters for amplifying the biomass in fermentation. The fermentation process is carried out in a 15L fermenter (B.Brown international,Germany) while maintaining the key process paramieters throughout the run. The fermentation process is controlled by maintaining the levels of nutrients, dissolved oxygen, pH, temparature etc., by suitable probes incorporated into the fermenter equipment.
The culture medium used in the embodiment of the present invention is selected from, Luria Bertani broth [LB] (bactotryptonel0g/L, yeast extract 5g/L and NaCl 5g/L), Minimal media [M9] (NaCl 0.5 g/L, NH4CI 1 g/L, K2HP04 3 g/L, 1 M CaCl2 0.1 mL/L, 1 M MgS04 2 mL/L, and 20% glucose 10 mL/L), Modified Terrific broth [MTB] (Tryptone: 12g/L, Yeast extract 24g/L, Glucose: 0.75%, KH2P04: 2.2g/L, and K2HP04: 9.4g/L and Defined medium (10 g/L glucose, lOg/L Tryptone, lg/L Thiamine, 2g/L (NH4) 2 HP04, 6.75g/L KH2P04, 0.85 g/L Citric acid, 0.7 g/L MgS04.7H20 and 5 mL of trace metal solution. Antibiotics used are selected from 100 μg/mL of ampicillin, 50^g/mL kanamycin and 34 ng/mL chloramphenicol. The composition of trace metal solution is (CuS04.5H20 2 mg/L, A12(S04)3 10 mg/L, MgCl2.4H20 20 mg/L, Sodium molybdate dihydrate 50 mg/L, Boric acid 1 mg/L, Cobalt chloride 2.5 g/L, Zinc sulfate 5 mg/L, Ferrous sulfate 50 mg/L and Nickel chloride hexa hydrate 1 mg/L).
Specific product yield is studied by batch mode fermentation while volumetric product yield is studied by the specific growth rate based fed batch fermentation process. In batch mode fermentation, the transformed bacterial cells containing recombinant vector single colony is inoculated into seed medium (Luria bertani broth) with desired antibiotics selected from ampicillin, kanamycin and chloramphenicol and grown in shake

flask (100 mL capacity) on Orbital shaker (Orbitek) at 100- 150 RPM for 2 to 12 hrs at 30 to 37° C. The culture is aseptically isolated by centrifugation. The MTB medium with desired antibiotics is prepared in 1000 mL flask and inoculated with above seed culture. The cultures are grown on Orbital Shaker until the optical density of the culture medium reaches 0.7 to 5.0, preferably 1.5 to 3.0, more preferably 2.0 to 2.5 at UV 600 nm. Then the cells are induced with IPTG in a concentration of 1.0 to 5.0mM preferably 1.5 to 4.0 mM , more preferably 2.0 to 2.5mM and the post-induced samples are drawn on an hourly basis for 8 hrs and analyzed on SDS-PAGE (15% gel). The level of protein expression is observed by gel densitometry method. The composition of media is also studied and established using above parameters by propagating the culture in different compositions like LB, M9, MTB and Define medium, preferably M9, MTB and Define, more preferably MTB and Define medium. Under the above conditions a specific product yield of 48 to 68 mg/L/OD with 32 to 45 % protein expression is realized on total cellular protein based on the characteristics of the mutant gene present in recombinant clone.
Volumetric product yield is enhanced by culture specific growth rate based fed-batch fermentation using well-established parameters as described below in the present embodiment. Carbon source concentration in the culture media is maintained at a maximum of 0.75 g/L. When the optical density of the culture reaches the desired level, the feed is started with appropriate flow rate while monitoring the cell growth. The feed medium comprises of a suitable carbon source, a nitrogen source, suitable salts and nutrients and suitable antibiotics. The carbon source is selected from the group comprising of glycerol, glucose, fructose, maltose, galactose and the like or mixtures thereof. The preferred carbon source of the present invention is glucose. The nitrogen source is selected from the group comprising of complex nitrogen sources like Tryptone, casein enzyme hydrolysate, soyabean casein hydrolysate, gelatin digest, and the like, their combinations & combinations with yeast extract. The preferred nitrogen source of the present invention is Tryptone with yeast extract. The salts/nutrients selected from the group comprising of citric acid, potassium chloride, sodium chloride, magnesium sulphate, diammonium hydrogen phosphate, potassium dihydrogen ortho phosphate, sodium butyrate, thiamine, glycine and zinc chloride. Suitable antibiotics like ampicillin, kanamycin and chloramphenicol etc., are selected as required by the process. The

preferred composition of the nutrient feed medium is Tryptone 60 g/L, yeast extract 120 g/L, glucose 120 g/L, 1 M K2HPO410 mL/L, 1 M MgS04 20 mL/L, and trace metal solution 10 mL/L along with suitable antibiotics with desired concentrations.
The process key parameters comprise of aeration, temperature, pH, dissolved oxygen, inducer concentration, cell density, and agitation speed. The aeration at 0.5 to 1.5 VVM, preferably 0.8 to 1.2 VVM is maintained. The temperature at 34 to 37° C, preferably 36.5 to 37.5° C is maintained. The pH is maintained at 6.5 to 8.0 preferably 6.8 to 7.2 by acid/base addition through automatic feed control. Dissolved oxygen is maintained at 20 to 50%, preferably 30 to 45% more preferably 42 to 44%. Nutrient feeding is monitored on the basis of high specific growth rate of culture. The optical density of culture medium at pre-induction phase is maintained in the range of 5 to 60 at UV 600nm, preferably 15 to 45 at UV 600nm, more preferably 30 to 35 at UV 600nm. The preferred inducer is IPTG and is used in a concentration of 0.5 to 5.0mM, preferably 1.0 to 3.0 mM more preferably 1.5 to 2.5 mM. Under the above conditions, surprisingly the resulting volumetric product yield of G-CSF is 3.0 to 4.2 g/L with 32 to 45 % protein expression on total cellular protein. Level of expression is estimated through densitometry using protein bands obtained by SDS-PAGE. The fermented broth is harvested after 9-10 hrs of post induction. The harvested cell mass is subjected to down stream process according to the purification techniques described elsewhere forming the subject for another patent application.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig-1: The Native nucleotide sequence of Human G-CSF gene along with derived amino acid sequence.
Fig-2: The nucleotide sequence of Human G-CSF mutant gene (eight mutations) in the cloned fragment along with derived amino acid sequence.
Fig-3: The nucleotide sequence of Human G-CSF mutant gene (six mutations) in the cloned fragment along with derived amino acid sequence.

Fig-4: Restriction map of E.Coli expression vector containing the mature coding sequence of human mutant G-CSF gene.
Fig-5: Restriction map of E.Coli expression vector containing the mature coding sequence of human mutant G-CSF gene.
Fig- 6: Restriction map of E.Coli expression vector containing the mature coding sequence of human mutant G-CSF gene.
Fig-7: Expression of G-CSF by different concentrations of IPTG.
Technical abbreviations used in the text:
1. G-CSF: Granulocyte Colony Stimulating Factor
2. GM-CSF:Granulocyte Macrophage Colony Stimulating Factor
3. M-CSF: Macrophage Colony Stimulating Factor
4. PCR: Polymerase chain reaction.
5. WCB : Working cell bank..
6. LB: Luria Bertani Broth
7. M9 : Minimal medium.
8. MTB: Modified Terrific Broth.
9. VVM: volume of air per unit volume of mass per minute.
10. RPM: Revolutions per minute.
11. OD:Optical density.
12. IPTG : Iso propyl thio galactosidase.
13. IB : Inclusion bodies.
14. SDS-PAGE: Sodium dodecyl sulphate polyacrylamide gelelectrophorisis.
Example -1
Construction of clone:
This example describes the synthesis of a mutant gene, construction of clone, high-level expression of Human G-CSF. Eight mutations are incorporated at N-terminal

region of native gene by site directed mutagenesis, according to E.Coli codon bias preference. "GCGCCATATGACACCATTAGGACCTGCCAGCTCCTTACCCCAG" as final forward primer and "GCGCGGATCCTTATCAGGGCTGGGCAAGGT" as reverse primer are used to amplify the mutant gene including Ndel and BamHl restriction sites (indicated by underlines) by PCR. The product is analyzed on 1% agarose gel and purified by usual DNA extraction methods. The PCR amplified mutant gene (548bp) and pET-3a vector are digested with Ndel and BamHl restriction enzymes and is ligated with T4 DNA ligase in the proportion of 1:5. The reaction mass is incubated at 16°C overnight. The recombinant vector is transformed into BL21 (DE3) PLysS competent cells and is plated on LB agar with lOO^ig/mL of ampicillin and 34|ag/mL of chloramphenicol. The transformants are screened by antibiotic markers.
Protein expression:
The transformed BL21 (DE3) PlysS cells containing recombinant vector (pET-3a-G-CSF mutant gene) positive single colony is inoculated into 10 mL of L.B medium containing both antibiotics (ampicillin 100|xg/mL and chloramphenicol 34|ig/mL) and grown in shake flask (100 mL capacity) on orbital shaker (orbitek) at 150 RPM for 12 hrs at 37° C. The culture is aseptically isolated by centrifugation at 8000 RPM for 15 min at 4° C. MTB medium of 100 mL along with both antibiotics are prepared and inoculated with above seed culture. The cultures are grown on orbital shaker at 37° C with 220 RPM until the optical density of the culture reaches 2.0 at 600nm (UV). Then the cells are induced with 2.0 mM IPTG and the post-induced samples are drawn on an hourly basis for 8 hrs and analyzed on SDS-PAGE (15%gel). The level of protein expression is observed by gel densitometry method. The specific product yield is 68 mg/L/OD and the level of protein expression is 45% on total cellular basis.
Seed culture is prepared from 900^iL of glycerol stock (WCB) of BL21 (DE3) PlysS harboring pET-3a-G-CSF recombinant vector by inoculating into 900 mL of LB medium containing both antibiotics. The Culture is grown on orbital shaker at 150 RPM for 15 hrs at 37°C. The culture is aseptically isolated by centrifugation at 8000 RPM for 15 min at 4°C. MTB medium (9L) along with antibiotics are taken into 15L Biostat fermentor (B.Brown International, Germany). The medium is aseptically inoculated with

the above described seed culture pellet. Aeration is maintained at 0.8 to 1.2 VVM, pH is maintained constantly at 7.0 by acid/base addition through automatic feed control. Dissolved oxygen is maintained at 42 to 44%. A nutrient is fed on the basis of high specific growth rate of culture. The culture is induced with 2.0mM IPTG when the optical density of culture (OD600) reaches 30. Maximum cell density is observed (OD600: 62) at 7 hrs of post induction. The volumetric product yield is 4.2 g/L, which indicates the reproducibility of specific product yield in the fermenter.
ExampIe-2
Construction of clone:
This example describes the construction of recombinant clone using a mutant G-CSF gene from PCR as in example-1. The PCR amplified mutant gene (548bp) and pET-9a vector are digested with Ndel and BamHl restriction enzymes and is ligated with T4 DNA ligase in the proportion of 1:5. The reaction is incubated at 16° C overnight. The recombinant vector is transformed in to BL21 (DE3) competent cells and plated on LB agar with 50jag/mL of kanamycin and 34jig/mL of chloramphenicol. The transformants are screened by antibiotic markers . Protein expression:
The transformed BL21 (DE3) cells containing recombinant vector (pET-9a-G-CSFmutant gene) are used for the study of specific and volumetric product yield of G-CSF as in example-1. The specific product yield is 60 mg/L/OD and the level of expression is 40% on total cellular proptein. Similarly in fed batch fermentation process, the volumetric product yield is 3.7 g/L.
Example-3
Construction of clone;
This example describes the construction of recombinant clone using a mutant G-CSF gene from PCR as in example-1. The PCR amplified mutant gene (548bp) and pET-11a vector are digested with Ndel and BamHl restriction enzymes and is ligated with T4 DNA ligase in the proportion of 1:5/The reaction is incubated at 16° C overnight. The

recombinant vector is transformed in to BL21 (DE3) PLysE competent cells and plated on LB agar with 100μg/mL of ampicillin and 34μ/mL of Chloramphenicol. The transformants are screened by antibiotic markers.
Protein expression:
The transformed BL21 (DE3) PlysE cells containing recombinant vector (pET-1 la-G-CSFmutant gene) are used for the study of specific and volumetric product yield as in example-1. The specific product yield is 68 mg/L/OD and the level of expression is 45 % on total cellular protein, similarly in fed batch fermentation process, the volumetric product yield is 4.2 g/L.
Example -4 Construction of clone:
This example describes the synthesis of a mutant gene, construction of clone,
high-level expression, purification with high recovery and purity and of Human G-CSF.
Six mutations are incorporated at N-terminal region of native gene by site directed
mutagenesis, according to E.Coli codon bias preference.
"GCGCCATATGACACCATTA GGACCTGCCAGCTCCCTGC as final forward primer and * GCGCGGATCCTTA TCAGGGCTGGGCAAGGT as reverse primer are used to amplify the mutant gene including Ndel and BamHl restriction sites (indicated by underlines) by PCR. The product is analyzed on 1% agarose gel and purified by usual DNA extraction methods. The PCR amplified mutant gene (548bp) and pET-3a vector are digested with Ndel and BamHl restriction enzymes and is ligated with T4 DNA ligase in the proportion of 1:5. The reaction is incubated at 16° C overnight. The recombinant vector is transformed in to BL21 (DE3) PLysS competent cells and plated on LB agar with lOOjxg/mL of ampicillin and 34^g/mL of chloramphenicol. The transformants are screened by antibiotic markers. Protein expression;
The transformed BL21 (DE3) PlysS cells containing recombinant vector (pET-3a-G-CSFmutant gene) are used for the study of specific and volumetric product yield as explained in example-1. The specific product yield is 52 mg/L/OD and the level of

expression is 35 % on total cellular proptein. Similarly in fed batch fermentation process the volumetric product yield is 3.2 g/L.
Example-5 Construction of clone:
This example describes the construction of recombinant clone using a mutant G-CSF gene from PCR as in example-4 . The PCR amplified mutant gene (548bp) and pET-9a vector are digested with Ndel and BamHl restriction enzymes and is ligated with T4 DNA ligase in the proportion of 1:5. The reaction is incubated at 16° C overnight. The recombinant vector is transformed in to BL21 (DE3) competent cells and plated on LB agar with 50μg/mL of kanamycin and 34|ig/mL of chloramphenicol. The transformants are screened by antibiotic markers. Protein expression:
The transformed BL21 (DE3) cells containing recombinant vector (pET-9a-G-CSFmutant gene) are used for the study of specific and volumetric product yield as in example-1. The specific product yield is 48 mg/L/OD and the level of expression is 32% on total cellular protein. Similarly in fed batch fermentation process, the volumetric product yield is 3.0 g/L.
Example-6
Construction of clone:
This example describes the construction of recombinant clone using a mutant G-CSF gene from PCR as in example-4. The PCR amplified mutant gene (548bp) and pET-1 la vector are digested with Ndel and BamHl restriction enzymes and is ligated with T4 DNA ligase in the proportion of 1:5. The reaction is incubated at 16° C overnight. The recombinant vector is transformed in to BL21 (DE3) competent cells and plated on LB agar with 100μg/mL of ampicillin and 34|ig/mL of chloramphenicol. The transformants are screened by antibiotic markers. Protein expression:

The transformed BL21 (DE3) PlysE cells containing recombinant vector (pET-lla-G-CSFmutant gene) are used for the study of specific and volumetric product yield as in example-1. The specific product yield is 52 mg/L/OD and the level of expression is 35 % on total cellular proptein. Similarly in fed batch fermentation process, the volumetric product yield is 3.2 g/L.

We claim:
1) A method for high-level expression of recombinant human granulocyte colony
stimulating factor, comprising of:
a) Synthesis of novel mutant G-CSF gene by site directed mutagenesis.
b) Construction of clone using different vectors and bacterial hosts.
c) High-level expression of G-CSF resulting in specific product yield and volumetric product yield.

2) A method as claimed in claim 1 wherein, the gene translational condition is enhanced by maintaining the G+C content at N-terminal region of native gene.
3) A method as claimed in claim 2 wherein, the G+C content at N-terminal region of native gene is maintained as 50%.
4) A method as claimed in claim 3 wherein, the G+C content is maintained as 50% by incorporation of eight mutations at N-terminal region of native G-CSF gene by site directed mutagenesis.
5) A method as claimed in claim 4 wherein, the mutations are incorporated at N-terminal region of native gene and with out changing the amino acid sequence.
6) A method as claimed in claim 1 wherein, the gene transcriptional 1 condition is enhanced by insert the gene under strong promoter of protein expression vector.
7) A method as claimed in claim 6 wherein, the gene is inserted under strong T7 promoter of pET based expression vectors are.
8) A method as claimed in claim 7 wherein, the expression vectors are used in this invention are pET-3a, pET-9a, pET-1 la.
9) A method as claimed in claim 1 wherein, BL21 (DE3), BL21 (DE3) PlysS and BL21 (DE3) PlysE are used as host organisms
10) A method as claimed in claim 9 wherein, the basal expression of protein during the uninduced growth phase of culture is inhibited by reducing the T7RNA polymerase..
11) A method as claimed in claim 10 wherein, the T7RNA polymerase is reduced at uninduced phase of culture by T7 Lysozyme, which is produced by T7 Lysogen gene present in PlysS/PlysE plasmids.
12) A method as claimed in claim 11 wherein, BL21 (DE3) PlysS and BL21 (DE3) PlysE contained the PlysS/PlysE plasmids.

13) A method as claimed in claim 1 wherein, the specific product yield is established by
study of the composition of medium, concentration of inducer and effect of protein
expression on cell growth.
14) A method as claimed in claim 13 wherein, the composition of medium is modified
terrific broth.
15) A method as claimed in claim 14 wherein, the inducer concentration is 2.0mM IPTG.
16) A method as claimed in claim 15 wherein, the specific product yield is 68mg/L/OD.
17) A method as claimed in claim 16 wherein, the level of protein expression is 45% on
total cellular protein.
18) A method as claimed in claim 1 wherein, the volumetric product yield is established
by culture specific growth rate based fed batch fermentation method,
19) A method as claimed in claim 18 wherein, the optical density (OD600) of the culture
at induction stage is 30.
20) A method as claimed in claim 1 wherein, the volumetric product yield of G-CSF is
4.2 g/L.
21) A process for production of Recombinant human G-CSF as in claim-1 and
essentially as discussed in examples-1-6.
Dated this 1st day of February, 2007

Documents

Application Documents

# Name Date
1 254-che-2007 form-18-13-07-2009.pdf 2009-07-13
2 254-che-2007 correspondence others-13-07-2009.pdf 2009-07-13
10 0254-che-2007 form-5.pdf 2011-09-02
11 254-CHE-2007-FER.pdf 2016-08-24
12 254-CHE-2007-AbandonedLetter.pdf 2017-07-20