Abstract: “A Nucleotide Sequence Encoding 7-Dehydrocholesterol Reductase, Recombinant Constructs And Recombinant Organisms Comprising Said Sequence” ABSTRACT: The present invneiton provides a novel nucleotide sequence represented by Seq ID No.1 encoding 7-dehydrocholesterol reductase (7-DHCR), recombinant DNA constructs and recombinant micro-organisms carrying the said nucleotide sequence. Further, the present invention relates to a process for the production of 7-DHC in the presence of a recombinant 7-DHCR and its application in the synthesis of vitamin D3.
1. A nucleotide sequence having Seq Id No. 1 encoding 7-dehydrocholesterol reductase (7DHCR).
2. A recombinant plasmid consisting the nucleotide sequence of claim 1.
3. The recombinant plasmid of claim 2 wherein the plasmid is selected from the group consisting of pET26b, pPICZa A, pPICZa B, pPICZa C, pPICZ A, pPICZ B and pPICZ C.
4. The host cell consisting the plasmid of claim 3, wherein the host cell is a strain of Pichia pastoris.
5. The host cell of claim 4, wherein the strain is Pichia pastoris GS115.
6. A process for the catalytic conversion of cholesterol to 7-dehydrocholesterol (7-DHC) by employing the recombinant 7-dehydrocholesterol reductase (7-DHCR), wherein the expression of 7-DHCR is extracellular or intracellular, the said process comprising; (a) introducing recombinant plasmid consiting of Seq Id No. 1 in host cell Pichia pastoris; (b) permeabilizing recombinant Pichia cells in the presence of a detergent and treating cells with cholesterol and NADP to catalyse the conversion of cholesterol to 7-dehydrocholestserol catalysed by the expressed protein having Seq Id No.2; and (c) extracting 7DHC and unreacted cholesterol substrate in a polar solvent which is then dried followed by diluting the extracted residue with methanol.
7. The process according to claim 6, wherein the plasmid for extracellular expression of 7-DHCR is pET26b, pPICZa A, B and C.
8. The process according to claim 6, wherein the plasmid for intracellular expression is selected from the group consisting of pPICZ A, pPICZ B and pPICZ C.
9. The process according to claim 6, wherein the host cell strain is Pichia pastoris GS115
10. The process according to claim 6, wherein the detergent is selected from the group consisting of sodium dodecyl sulphate (SDS), Triton X 100, Cetyl trimethyl ammonium bromide (CTAB), acetone, n-hexane or a combination thereof.
11. The process according to claim 10, wherein the concentration of the detergent is ranging from10 mM to 20 mM.
12. The process according to claim 6, wherein the cholesterol based substrates for catalysis to obtain 7-DHC is selected from cholesterol, pegylated cholesterol and micellar preparations of cholesterol.
13. The process according to claim 6, wherein cholesterol and NADP sodium salt is in molar ratio ranging from 1:0.5 to 1.5
14. Use of recombinant 7-dehydrocholestserol reductase (7-DHCR) to produce 7- dehydrocholestserol as a precursor of vitamin D.
DESC:TECHNICAL FIELD OF THE INVENTION:
The present invention relates to a novel nucleotide sequence encoding 7-dehydrocholesterol reductase (7-DHCR), recombinant DNA constructs and recombinant micro-organisms carrying the said nucleotide sequence. Further, the present invention relates to a process for the production of 7-DHC in the presence of recombinant 7-DHCR and its application in the synthesis of vitamin D3.
BACKGROUND AND PRIOR ART OF THE INVENTION:
Vitamin D from being a mere vitamin supplement has gained biological importance as a treatment molecule for various ailments linked to nervous disorders, cancer and a plethora of other diseases, mainly due to advances in research based on biological functioning and pathways involving production of vitamin D. In the human system, vitamin D3 is converted to calcidiol in the liver, part of which is converted by kidneys to calcitriol which is the biologically active form of vitamin D. Calcitriol circulates as a hormone in blood, regulating calcium and phosphate concentrations and promotes healthy growth and remodeling of bones. Calcidiol is also converted to calcitriol outside kidneys and is known to play an active role in cell proliferation, differentiation and apoptosis; calcitriol affects neuromuscular function and inflammation. This makes vitamin D3 a vital remedial solution and of late its demand has increased tremendously.
7-dehydrocholesterol (7-DHC), one of the sterols produced by the sterol biosynthetic pathway serves as pro-vitamin D3. In most mammals including humans, biosynthesis of sterols follows the mevalonate pathway that uses acetyl-CoA as building-blocks to form Dimethylallylpyrophosphate (DMAPP) and Isopentenylpyrophosphate (IPP) which are subsequently conjugated to form Geranyl pyrophosphate (GPP), which in turn is used to synthesize 7-DHC. 7-DHC is either biotransformed to vitamin D3 or cholesterol. The sterol synthesis mechanism in the human body is highly organized, efficient and serves as a factory which produces desired sterol only, on a need basis. The immediate product of 7-DHC ring-opening after ultraviolet irradiation is previtamin D3. The formation of pre-vitamin D3 is rapid and reaches plateau phase within hours. Subsequently it undergoes a temperature-catalyzed rearrangement of the triene structure at 37°C to form vitamin D3, which is also known as cholecalciferol. Human skin has evolved efficiently and is acclimatized to this mechanism, thus conversion of 7-DHC to vitamin D3 is considered to be the most efficient biochemical conversion. The conversion of 7-DHC to vitamin D3 takes place in two stages viz., conversion of 7-DHC to pre-vitamin D3, which is a photochemical reaction dependent on a suitable intensity and wavelength of UVB light and the conversion of pre-vitamin D3 to vitamin D3 which is carried out by a temperature dependent reaction. A limitation in the conversion lies with the availability of a UVB source of light, received from sunlight. An increased rate of irradiation escalates concentrations of biologically inactive photoisomers viz., lumisterol and tachysterol which are photo chemically generated from pre-vitamin D3. The generation of previtamin D3 metabolites appear to limit pre-vitamin D3 accumulation and vitamin D3 intoxication in human skin during excessive exposure to the sun. The photoproduction of pre-vitamin D3 is not only governed by UV light, but more importantly, by the availability of 7-DHC content because skin 7-DHC content is entirely derived from biosynthesis in the skin, and the highest skin concentrations of 7-DHC are found in the epidermis (Esvelt, et al. 1980 Biochemistry, 19 (26), 6158–61).
Further, the production of 7-DHC is five to eight times greater than the production of desmosterol, the final intermediate in the alternative ?24 reductase pathway of cholesterol synthesis (Herman et al (2003) Hum Mol Genet 12 Spec No 1: 75-88). As human keratinocytes display preferential utilization of ?7- reductase versus ?24 pathway, the ?7-reductase may be the rate-limiting enzyme in post-lanosterol cholesterol biosynthesis in the epidermis. Thus, the ?7-reductase may serve as a control point for both cholesterologenesis and vitamin D3 generation in the skin Nemanic, Whitney et al. (1983) and Holick et al (1995) have been able to grow skin cells in invitro and produce vitamin D3 from 7-DHC by exposing it to UVB range.
Among the various enzymes in the cholesterol biosynthesis pathway, 7-DHC reductase (EC No.1.3.1.21) is an oxidoreductase enzyme which converts 7-DHC to cholesterol in the serum of human beings and all the terrestrial vertebrates. 3ß-Hydroxysterol D7-reductase (7-DHCR) catalyzes the last reaction in the cholesterol biosynthetic pathway, by reduction of the double bond at C-7, 8 in 7-dehydrocholesterol to form cholesterol. This enzyme, also known as 7-dehydrocholesterol D7-reductase, is inherited defectively in the Smith-Lemli-Opitz syndrome, a recessive birth defect wherein low plasma and tissue cholesterol levels with the accumulation of the precursor, 7-dehydrocholesterol, and its 8-dehydrocholesterol isomer are prominent biochemical features. Studies on 7DHC enzyme are reported and related to gain better insight of Smith-Lemli-Opitz syndrome at biochemical and genetic level (Lee Ying, et al (2014) Mole Genet and Metabolism Rep ,vol 1, 103–113).
Granted US Patent No. 7,608,421 discloses a method for preparing 7-dehydrocholesterol and/or cholesterol by culturing yeast organisms which, compared to the wild type, have an increased activity of at least one of the activities selected from the group consisting of ?8-?7-isomerase ?5-desaturase and ?24-reductase activities. Even though the enhanced expression of nucleotide sequences involved in 7-dehydrocholesterol metabolism is disclosed in US’421the cloning of gene sequence encoding 7-DHCR involved in the conversion of cholesterol to 7DHC and demonstration of its enhanced activity is not proved.
A recombinant DNA technology based study by Fabian Moebius et al (Proc. Natl. Acad. Sci. USA Vol. 95, 1899–1902, February 1998, Pharmaco) teaches cloning of ?7-sterol reductase of mammalian sterol biosynthesis. A 2,597-bp cDNA containing an ORF for a protein with 475 amino acid residues was isolated. However, 7-DHCR catalysing the conversion of 7-DHC to cholesterol and not conversion of cholesterol to 7-DHC to vitamin D3 is demonstrated therein.
Therefore, keeping in mind, the need for an alternative bio-synthetic process for production of vitamin D3, the present inventors have synthesized a novel nucleotide sequence encoding 7- DHCR, and have employed the 7-DHCR enzyme as a catalyst in a reversible process to convert cholesterol to 7DHC, which in turn serves as pre-vitamin D3. The reaction conditions for the present biological process are less harmful compared to chemical process.
OBJECT OF THE INVENTION:
An object of the present invention is to provide a nucleotide sequence encoding 7-dehydrocholesterol reductase (7DHCR) which catalyses the conversion of cholesterol to 7- dehydrocholesterol.
Another object of the present invention is to provide intracellular and extracellular expression of 7-DHCR in a yeast expression vector system.
Yet another object of the present invention is to provide a process to produce 7- dehydrocholesterol (7-DHC) in the presence of recombinant 7-DHCR.
SUMMARY OF THE INVENTION:
The present invention provides a nucleotide sequence having Seq Id No.1 encoding recombinant 3ß-Hydroxysterol D7-reductase (7DHCR) represented by Seq Id No. 2. Further, the invention provides a catalytic process for synthesis of 7-dehydrocholesterol (7DHC) from cholesterol catalyzed by the instant recombinant 7-DHCR and the subsequent conversion of 7DHC to vitamin D3.
In an aspect the present invention provides a nucleotide sequence having Seq Id No.1 encoding 3ß-Hydroxysterol D7-reductase (7DHCR).
Accordingly, the nucleotide sequence is expressed in a yeast expression vector system such as Pichia pastoris with a suitable vector and the expressed enzyme is suitable for conversion of cholesterol to 7-dehydrocholestrol which acts as precursor of vitamin D3 in mammalian system.
In another aspect, the present invention provides the intracellular and extracellular expression of recombinant 7-DHC reductase by employing Seq No. 1 of the present invention.
The enzymatic process includes the method of solubilizing cholesterol and permeabilizing the cells of Pichia pastoris for the enzyme activity to be expressed to obtain the desired conversion of cholesterol to 7-dehydrocholestrol.
In yet another aspect, the present invention provides a process for the catalytic conversion of cholesterol to 7-dehydrocholesterol (7-DHC) by employing the recombinant 7-dehydrocholesterol reductase (7-DHCR), wherein the expression of 7-DHCR is extracellular or intracellular, the said process comprising;
(a) introducing recombinant plasmid consiting of Seq Id No. 1 in host cell Pichia pastoris;
(b) permeabilizing recombinant Pichia cells in the presence of a detergent and treating cells with cholesterol and NADP (Nicotinamide adenine dinucleotide phosphate) to catalyse the conversion of cholesterol to 7-dehydrocholestserol catalysed by the expressed protein having Seq Id No.2; and
(c) extracting 7-DHC and unreacted cholesterol substrate in a polar solvent which is then dried followed by diluting the extracted residue with methanol.
Advantageously, the present invention provides the use of recombinant 7-dehydrocholestserol reductase (7-DHCR) to produce 7- dehydrocholestserol which is employed at an industrial scale as a precursor of vitamin D.
In a further aspect, the present invention provides employing 7-dehydrocholestserol reductase expression system of the present invention in gene therapy to treat Smith-Lemli-Opitz syndrome.
DETAILED DESCRIPTION OF DRAWINGS:
Figure 1 depicts an electrophoresed gel showing confirmation of 7-DHCR gene in recombinant E.coli DH5a cloned in extracellular vector(pPICZa) of Pichia pastoris GS115;
Figure 2 depicts an electrophoresed gel showing confirmation of electroporation of 7-DHCR gene with extracellular expression in Pichia pastoris GS115;
Figure 3 depicts extracellular protein expression of 7-DHCR of recombinant Pichia pastoris GS115 carrying Seq Id No.1. Screened Colonies numbered 3 and 10 were subjected to SDS Polyacrylamide gel electrophoresis (PAGE) for confirmation of insertion of the 7-DHC gene;
Figure 4 depicts an agarose gel run with an extract of Pichia cell comprising an intracellular vector confirming presence of the 7-DHCR gene in intracellular vector(pPICZ) and transformed in Pichia pastoris GS115 carrying Seq Id No.1 The 7-DHCR gene is highlighted and indicated;
Figure 5 depicts SDS-PAGE profile of 7-DHCR intracellular expression of recombinant Pichia pastoris in high expression colony (colony 5);
Figure 6 depicts cloning of Seq Id No. 1 encoding 7-DHCR in Pichia pastoris for extracellular expression;
Figure 7 depicts cloning of Seq Id No. 1 encoding 7-DHCR in Pichia pastoris for intracellular expression;
Figure 8 depicts the 7-dehydrocholesterol concentration in dicholromethane extract of permeabilized Pichia cells subjected to enzymatic conversion of cholesterol to 7DHC after 48h, as per the process described in Example 26;
Figure 9 depicts the 7-dehydrocholesterol concentration in dicholromethane extract of permeabilized Pichia cells subjected to enzymatic conversion of cholesterol to 7DHC after 48 h at 210 nm as per the process described in Example 27;
Figure 10 depicts the 7-dehydrocholesterol concentration in dicholromethane extract of permeabilized Pichia cells subjected to enzymatic conversion of micellar cholesterol to 7DHC after 24 h at 280nm in accordance with Example 28;
Figure 11 depicts the 7-dehydrocholesterol concentration in dicholromethane extract of permeabilized Pichia cells subjected to enzymatic conversion of micellar cholesterol to 7DHC after 48 h in accordance with Example 29;
Figure 12 depicts the sample extracted after 48 h in accordance with Example 30;
Figure 13 depicts the sample extracted after 48 h at 210nm in accordance with Example 31;
Figure 14 depicts the sample extracted after 48 h at 280nm in accordance with Example 31;
Figure 15 depicts the 7-dehydrocholesterol concentration in dicholromethane extract of permeabilized Pichia cells subjected to enzymatic conversion of micellar pegylated cholesterol to 7DHC after 48 h at 280nm as per the process described in Example 32;
Figure 16 depicts Standard Cholesterol RT at 32.75 minutes;
Figure 17 depicts Standard PEG Cholesterol RT at 27.08 and 47.59 minutes; and
Figure 18 depicts Standard 7DHC Rt at 24.52 nm
DETAILED DESCRIPTION OF THE INVENTION:
The invention will now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more fully understood and appreciated.
The present invention provides a nucleotide sequence having Seq Id No.1 encoding recombinant 3ß-Hydroxysterol D7-reductase (7DHCR) represented by Seq Id No. 2. Further, the invention provides a process for the synthesis of 7-dehydrocholesterol (7DHC) from cholesterol catalyzed by the instant recombinant 7-DHCR and the subsequent conversion of 7DHC to vitamin D3.
In a preferred embodiment, the present invention provides a nucleotide sequence represented by Seq Id No. 1 encoding 7- dehydrocholestrol reductase (7-DHCR).
The nucleotide sequence was designed based on thesynthetic construct of Homo sapiens clone. GenBank: DQ895014.2
The present invention further covers fragments of Seq Id No. 1, recombinant constructs and recombinant micro-organisms selected from bacteria and fungi carrying Seq Id No.1.
In accordance with the above embodiment, the nucleotide sequence represented by Seq Id No.1 encoding 3ß-Hydroxysterol D7-reductase (7-DHCR) has a size of 1431 base pairs. The said sequence encodes an amino acid sequence of 7-DHCR having a size of 475 amino acids. The amino acid sequence of 7-DHCR is represented by Seq Id No. 2.
In an embodiment, the present invention provides the expression of a nucleotide sequence having Seq Id No.1 encoding 7DHC reductase enzyme in a yeast expression vector system using a suitable plasmid.
Accordingly, nucleotide sequence (Seq Id No. 1) encoding 7-DHCR was codon optimized for Pichia and chemically synthesized. The synthesized gene was cloned in pET26b vector. Appropriate forward and reverse primers were designed and the gene was amplified by Polymerase Chain Reaction. The gene was cloned in Pichia pastoris using Pichia vector for extracellular/ intracellular expression. Pichia vectors employed in the present invention are selected from pPICZa A, B and C for extracellular secretion and pPICZ A, B, C for intracellular expression.. Both the vectors were used in the invention to express the instantly synthesized 7-DHCR recombinant protein in Pichia pastoris. Zeocin was used as the antibiotic marker. Forward and reverse primers were designed to identify the gene of interest. The forward primer sequence is 5’ CGCCTCGAGATGGCTGCTAAGA GTCAACCTAAC 3’ (Seq Id No: 3) and the reverse primer is 5’ CTAGTCTAGACTATTAGAAGATACCAGGAAG 3’(Seq Id No: 4). Enzymes that were used to digest the vector namely were XhoI and XbaI which were also used to digest the gene of interest. The gene of interest was gel purified and ligated with vector. The ligated plasmid was then transformed into E.coli DH5a. The transformed E.coli DH5a colonies were screened for the presence of 7-DHCR gene. After confirmation of the E.coli colony, the colony was grown in Luria Beratani (LB) Broth/media, the plasmid extracted for electroporation into Pichia pastoris. The recombinant DNA method illustrated herein was used for the intracellular and extracellular expression of the recombinant protein. Figure 1 provides confirmation of the presence of the 7-DHCR gene in E.coli DH5alpha. After extraction of the plasmid comprising Seq Id No. 1 from E.coli cells, Pichia pastoris GS115 were electroporated to facilitate the insertion of the 7-DHCR gene in the P. pastoris genome. Figure 2 shows the conformation of the insertion of the 7-DHCR gene in P. pastoris GS115 strain after screening of colonies. Further, extracellular expression of Seq Id No. 1 to produce 7-DHCR was confirmed by SDS polyacrylamide gel electrophoresis as observed in Figure 3. Intracellular expression of Seq Id No.1 was also indicated and confirmed in agarose gel electrophoresis in Figure 4.
Advantageously, in view of the oxidoreductase activity of 7-DHCR obtained by the recombinant DNA technology method, the recombinant enzyme can be employed for therapeutic treatment of Smith-Lemli-Opitz syndrome.
In another preferred embodiment, the present invention provides a method of cell permeabilization by employing a detergent or a combination of detergents, whereby the active enzyme is made accessible to cholesterol which serves as the substrate for reaction to be catalyzed.
Accordingly, the cholesterol based substrates for catalysis to obtain 7-DHC are selected from cholesterol, pegylated cholesterol and micellar preparations of cholesterol.
The nucleotide sequence encoding 7-DHCR is expressed in recombinant micro-organisms using recombinant technology. This enzyme synthesized is highly specific and yields increased concentrations of high purity 7-DHC from cholesterol without the use of synthetic chemical methods.
The recombinant strain of Pichia pastoris was grown in minimal nutrition fermentation media in a reaction vessel for intracellular as well as extracellular expression of 7-DHCR. Since the active enzyme is membrane bound protein and loses its activity when extracted, whole cells were used for enzymatic reaction. In order to make the substrate and enzyme interact, cells were permeabilized with detergents selected from range consisting of Sodium Dodecyl sulfate (SDS), Triton X 100, Cetyl trimethyl ammonium bromide, acetone, n-hexane.
Detergents in various concentration from 1-5%w/v were used singly or in combination to make 10% cell suspension of yeast cells and stirred at 800-1000 rpm at 20ºC using a magnetic stirrer. The degree of permeabilization in different detergents was compared by difference in the absorbance measured at 260 nm and 280 nm. Permeabilized cells containing the enzyme were tested for its ability to convert cholesterol to 7-DHC in reaction mixture containing cholesterol and NADP sodium salt in molar ratio between 1:0.5 to 1.5. Cholesterol used as one of the substrate is a water insoluble lipid.
Solubility of cholesterol is important from point of view of absorption or accessibility to the enzyme. In aqueous medium, cholesterol monomers exist upto to a concentration limit of 10-8M. With such a reduced solubility, cholesterol forms Cholesterol monohydrate precipitate in aqueous phase. Cholesterol forms stacked aggregates up to 10-6 M and coalesce into separate phase.
In another embodiment, anhydrous cholesterol is solubilized in surfactants selected from the group consisting of sodium dodecyl sulphate (SDS), Triton X 100, Cetyl trimethyl ammonium bromide (CTAB), acetone, Tween 80 and Tween 20, or combinations thereof.
Various concentration of the said surfactant components were used in combination to prepare diluent systems labeled as system 1, system 2 and so on. The concnetrations of surfactants used in preparation of micellar cholesterol is in the range of 10mM to 20 mM. The surfactant form mixed micellar environment in and around their critical micellar concentration which is suitable to form micellar solution of cholesterol. Cholesterol added in quantity to make 10 mg/ mL micellar solution. The solution was stirred in magnetic stirrer for 2 h and used for reaction.
Alternatively, cholesterol-PEG which is more soluble in aqueous solution was also used as substrate for enzymatic conversion. Cholesterol –PEG (sigma) is of 20% purity and soluble upto more than 60% in aqueous solution.
In another preferred embodiment, the present invention provides the enzymatic conversion of cholesterol to 7-DHC in presence of the recombinant 7-DHCR.
The present invention provides a process for the catalytic conversion of cholesterol to 7-dehydrocholesterol (7-DHC) by employing the recombinant 7-dehydrocholesterol reductase (7-DHCR), wherein the expression of 7-DHCR is extracellular or intracellular, the said process comprising;
(a) introducing recombinant plasmid consiting of Seq Id No. 1 in host cell Pichia pastoris;
(b) permeabilizing recombinant Pichia cells in the presence of a detergent and treating cells with cholesterol and NADP to catalyse the conversion of cholesterol to 7-dehydrocholestserol catalysed by the expressed protein having Seq Id No.2; and
(c) extracting 7DHC and unreacted cholesterol substrate in a polar solvent which is then dried followed by diluting the extracted residue with methanol.
Accordingly, the recombinant enzyme catalyzed conversion of cholesterol involves oxidation to 7DHC in presence of NADP which in turn is reduced to NADPH. It is difficult to simulate the conditions of mammalian system in external environment as the state and concentration of NADP and NADPH in mammalian system is highly regulated. However to drive the oxidation reaction, the equilibrium level of NADP and NADPH in cell system was analysed by the present inventors.
In rat liver, the total amount of NAD+ and NADH is approximately 1 mole per gram of wet weight, about 10 times the concentration of NADP+ and NADPH in the same cells. The actual concentration of NAD+ in cell cytosol is harder to measure, with recent estimates in animal cells, ranging around 0.3 mM, and approximately 1.0 to 2.0 mM in yeast. However, more than 80% of NADH fluorescence in mitochondria is from bound form, therefore the concentration in solution is much lower.
The balance between the oxidized and reduced forms of nicotinamide adenine dinucleotide is called the NAD+/NADH ratio. This ratio is an important component of what is called the redox state of a cell, a measurement that reflects both the metabolic activities and the health of cells. The effects of the NAD+/NADH ratio are complex, controlling the activity of several key enzymes, including glyceraldehyde 3-phosphate dehydrogenase and pyruvate dehydrogenase. In healthy mammalian tissues, estimates of the ratio between free NAD+ and NADH in the cytoplasm typically lie around 700; the ratio is thus favorable for oxidative reactions. The ratio of total NAD+/NADH is much lower, with estimates ranging from 3–10 in mammals. In contrast, the NADP+/NADPH ratio is normally about 0.005, so NADPH is the dominant form of this coenzyme. These different ratios are key to the different metabolic roles of NADH and NADPH.
Therefore, NADP in 1.1 to 1.3 times of cholesterol in molar quantities was dissolved in a selected diluent system. The peramebilized cells were used with 10% dry weight content. The reaction was carried out at 28°C for a period up to 48h. Samples of known weight were withdrawn at regular intervals and extracted in 10 times volume of Dichloromethane (DCM) twice. The product, i.e. 7DHC and unreacted substrate i.e. cholesterol are extracted in a polar solvent such as dichloromethane which is then dried and the extracted residue is diluted with methanol and quantified by HPLC.
In one more embodiment, the present invention provides yield of 7-DHCR in the range of 1% to 3% wrt cholesterol by weight.
Accordingly, the production of 7-DHC using the process disclosed by the present invention may be carried at an industrial scale in fermenters of 1 L to 1000L, by fermenting the recombinant Pichia pastoris carrying Seq Id No.1 encoding 7-DHCR in the presence of cholesterol and NADP in appropriate concentrations. Permeabilization of the yeat cells may be performed prior to the catalytic conversion to promote the accessibility of the recombinant enzyme produced by the Pichia cells with the substrate.
In an advantageous embodiment, the present invention provides the use of recombinant 7-dehydrocholestserol reductase (7-DHCR) to produce 7- dehydrocholesterol which is employed at an industrial scale as a precursor of vitamin D.
In one more preferred embodiment, th present invention provides employing the 7-dehydrocholestserol reductase expression system of the present invention in gene therapy to treat Smith-Lemli-Opitz syndrome.
The following examples, which include preferred embodiments, will serve to illustrate the practice of this invention, it being understood that the particulars shown are by way of example and for purpose of illustrative discussion of preferred embodiments of the invention.
Examples
Example 1: Cloning of Seq Id No. 1 encoding 7-DHCR in Pichia pastoris for extracellular expression (Figure 6)
(i) Extraction of plasmid carrying Seq Id No. 1
The nucleotide sequence represented by Seq Id No. 1 encoding 7-DHCR was codon optimized for Pichia and chemically synthesized and cloned in pET26b vector. Plasmid extracted using Qiagen plasmid extraction kit. Forward and Reverse primers were designed and the gene of 7-DHCR was amplified using Polymerse Chain Reaction.The gene was cloned in Pichia pastoris using Pichia vector for extracellular expression. Zeocin was used as the antibiotic marker. Forward and reverse primer was designed to pull out the gene of interest. The forward primer sequence is 5’ CGCCTCGAGATGGCTGCTAAGAGTCAACCTAAC 3’ (Seq Id No: 3) and the reverse primer is 5’ CTAGTCTAGACTATTAGAAGATACCAGGAAG 3’ (Seq Id No: 4). Enzymes that were used to digest the vector namely were XhoI and XbaI which were used to digest the gene of interest. The gene of interest was gel purified and ligated with vector. The ligated plasmid was then transformed into E.coli DH5a. The transformed E.coli DH5a colonies were screened for the presence of 7-DHCR gene. After confirmation of the E.coli colony, the colony was grown in Luria Beratani (LB) Broth/media, the plasmid extracted for electroporation into Pichia pastoris.
(ii) Electroporation of 7-DHCR gene into Pichia pastoris GS115
GS115 strain from the glycerol stock was inoculated in 3 mL YPD and incubated at 28°C in the shaker overnight. The overnight culture was inoculated in 100 mL YPD medium and was incubated in 28°C shaker till a constant absorbance (Optical density) of 1 was achieved. The grown culture was transferred to a pre chilled Oak ridge tube. The culture was centrifuged at 4000 rpm for 10 min at 4°C. The supernatant was discarded, and the pellet was resuspended in ice cold distilled water. The pellet was resuspended in 1M sorbitol and was centrifuged at 4000 rpm for 10 min at 4 °C. This step was repeated twice. After which the pellet was resuspened with 200 µL of 1M sorbitol, (GS115 competent cell) the competent cell and linearized pPICZaA (Pichia vector)/7DHCR. This mixture was then transferred to a pre- chilled electroporation cuvette. Electroporation conditions were as follows: 1500 V, 250 ohms, 4 – 6 ms.
1M sorbitol was added to the electroporated mix which was subjected to incubation at 28°C for 3 – 5 h. The electroporated cells were plated in YPD agar plate with Zeocin concentration of 300 µg/ mL for screening the cells. Plate was incubated for 3 to 4 days to observe any positive colonies.
(iii) Protein expression of Pichia clone expressing 7-DHCR
GS115 (negative control strain), Colony 3 and 10 from the screened colonies were chosen for checking the expression. Three cultures were subjected to same growth parameters; care was taken to maintain a constant OD for the cultures. Then the cells were centrifuged and resuspended in 150 mL Buffered Methanol Complexed medium (BMMY). 10 mL of uninduced cells were taken for analysis experiment. After induction samples were collected at a 3 h interval for the first day and from the 2nd day samples were collected after a 12 h duration for 3 days. From the previous experiments and analysis it was known that the extracellular expression was not observed, hence cell lysis using sonication was performed and intracellular expression was analysed using SDS PAGE.
From the SDS PAGE analysis in Figure 3 from the colony 10 it can be observed that till 24 h two bands were observed in the range of 53 to 57 kDa and in 48 h sample the band with higher molecular weight was observed prominently than the lower molecular weight band.
Example 2: Cloning of the 7-DHCR gene in Pichia pastoris for intracellular expression (Figure 7)
(i) Extraction of plasmid carrying Seq Id No. 1
The methodology adopted for cloning the 7-DHCR gene in Pichia pastoris for intracellular expression selected from vector pPICZ A,B,C is the same as that for extracellular expression. Gene sequence of 7-DHCR was codon optimized for Pichia and synthesized. The gene was cloned in Pichia pastoris using Pichia vector for intracellular expression. Zeocin was used as the antibiotic marker. Forward and reverse primer was designed to pull out the gene of interest.
Primer sequences:
Forward primer: 5’ CGCCTCGAGATGGCTGCTAAGAGTCAACCTAAC 3’ (Seq Id No: 3)
Reverse primer: 5’ CTAGTCTAGACTATTAGAAGATACCAGGAAG 3’(Seq Id No: 4)
The enzymes that were used to digest the vector namely XhoI and XbaI , were used to digest the gene of interest also. The gene of interest was gel purified and ligated with vector.The ligated plasmid was then transformed into E.coli DH5alpha. E.coli DH5alpha colonies were screened for presence of the 7-dhcr gene. After confirmation of the E.coli colony, the colony was grown in Luria Broth media,plasmid extracted for Electroporation into Pichia pastoris.
(ii) Electroporation of 7-DHCR gene into Pichia pastoris GS115
GS115 competent cell preparation: GS115 strain from the glycerol stock was inoculated in 3 mL YPD and incubated at 28°C in shaker for overnight. Overnight culture was inoculated in 100 mL YPD medium and was incubated in 28°C shaker till OD – 1. The grown culture was transferred to pre chilled Oak ridge tube. The culture was centrifuged at 4000 rpm for 10 min at 4 °C.Discard supernatant, re suspend the pellet in ice cold distilled water.Re suspend pellet in 1M sorbitol- centrifuge at 4000 rpm for 10 min at 4 °C.- Twice. Re suspend pellet with 200 µL of 1M sorbitol (GS115 competent cell).Mix the competent cell and linearized pPICZA, B, C/7DHCR. Transfer the mix to the pre chilled electroporation cuvette. Electroporation conditions: 1500 V, 250 ohms, 4 – 6 ms. 1M sorbitol was added to the electroporated mix and incubated at 28°C for 3 – 5 h. The electroporated cells were plated in YPD agar plate with Zeocin concentration of 300 µg/ mL for screening the cells. Plate was incubated for 3 to 4 days to observe any positive colonies.
Out of many colonies screened, colony no. 5 was found to contain high copy number as evidenced by its ability to grow in high concentration of Zeocin. This clone was taken up for further studies.
Example 3: Permeabilization of Pichia pastoris cells using Triton X 100
Pichia cells from fermentation broth were centrifuged and washed with water. The cell pellet was suspended in water to 10% dry weight. 5%w/v surfactant solution of Triton X 100 prepared in water was added to cell solution in ratio of 6: 1v/v. The resultant suspension was stirred for 3 - 4 h at 800 rpm in magnetic stirrer. Increase in OD of suspension measured at 260 nm and 280 nm form the initial value was considered as degree of permeabilization.
Example 4 : Permeabilization of Pichia pastoris cells using Sodium dodecyl sulphate (SDS)
Pichia cells were permeabilized by the procedure described in Example 3, and the surfactant solution Triton X was replaced with 2% w/v Sodium dodecyl sulphate (SDS).
Example 5: Permeabilization of Pichia pastoris cells using CTAB
Pichia cells were permeabilized by the procedure described in Example 3 and the surfactant solution Triton X was replaced with 2% w/v cetyl trimethylammonium bromide (CTAB).
Example 6:
Pichia cells were permeabilized by the procedure described in Example 3 and the surfactant solution TritonX 100 was replaced with 5%w/vTriton X 100 and 2%w/v CTAB in 1:1 proportion.
Example 7:
Pichia cells were permeabilized by the procedure described in Example 3 and the surfactant solution TritonX 100 was replaced with 5%w/v Triton X 100 and 2%w/v SDS in 1:1 proportion.
Example 8:
Pichia cells were permeabilized by the procedure described in Example 3and the surfactant solution TritonX 100 was replaced with 2%w/v SDS and 2%w/v CTAB in 1:1 proportion.
Example 9: Pichia cells were permeabilized by the procedure described in Example 1, and the surfactant solution Triton X 100 was replaced with 4 volumes of acetone and suspension dried in to obtain dry cell powder. Results from Example 3 to Example 9 are listed in Table 1 below.
Table 1: Absorbance values of the permeabilized suspensions obtained in Examples 3 to 9
Example OD at 260 nm OD at 280 nm
3 1.233 1.334
4 2.313 2.577
5 1.831 2.033
6 1.443 1.628
7 2.373 2.628
8 2.162 2.419
9 2.287 2.614
10 1.898 1.888
11 2.424 2.321
12 2.108 2.223
13 2.113 2.135
14 2.532 2.557
As observed from the Table above, the increase in absorbance of the Pichia cellpermeabilized suspensions measured at 260 nm and 280 nm form the initial value was considered as degree of permeabilization. Increase in permeablization observed indicated an increase in the accessibility of the recombinant 7DHCR synthesized by Pichia cells with the cholesterol substrate and NADP.
Example 10: Pichia cells were permeabilized by the procedure described in Example 3, and the surfactant solution TritonX 100 was replaced with 5% Tritox X 100, 2%w/v CTAB and 2%w/v SDS in 2:1:1 in volume proportion.
Example 11: Pichia cells were permeabilized by the procedure described in Example 3, and the surfactant solution TritonX 100 was replaced with 5% Tritox X 100, 2%w/v CTAB and 1%w/v SDS in 1:1:1 in volume proportion.
Example 12: Pichia cells were permeabilized by procedure described in Example 3, and the surfactant solution TritonX 100 was replaced with 5% Tritox X 100, 2%w/v CTAB and 1%w/v SDS in 1:2:1 in volume proportion.
Example 13: Pichia cells were permeabilized by procedure described in Example 3, and the surfactant solution TritonX 100 was replaced with 5% Tritox X 100, 2%w/v CTAB and 1%w/v SDS in 1:2:1 in volume proportion.
Example 14: Pichia cells permeabilized by procedure described in Example 3, and the surfactant solution TritonX 100 was replaced with 2% Tritox X 100, 2%w/v
CTAB and 1%w/v SDS in 2:1:1 in volume proportion.
Example 15 (a): Micellar solution of Cholesterol
5mL solution containing 10 mM CTAB and 20 mM Triton X 100 was prepared in water and was designated to be system 1. 250 mg of cholesterol was added to the said system 1 and stirred in a magnetic stirrer at 300 rpm for 24 h in dark. Absorbance of the resultant micellar solution was measured at 430nm.
Example 16:
Micellar solution of cholesterol was prepared by the procedure described in Example 15 and 50mM sodium chloride was added to system 1
Example 17:
Micellar solution of cholesterol was prepared by the procedure described in Example 15 and 2mM calcium chloride was added to system 1.
Example 18:
Micellar solution of cholesterol was prepared by the procedure described in Example 15 and 1mM potassium hydrogen phthalate was added to system 1.
Example 19:
Micellar solution of cholesterol was prepared by the procedure described in Example 15 and 1mM trisodium citrate was added to system 1.
Example 20:
Micellar solution of cholesterol prepared by procedure described in Example 10 wherein 1mM SDS was added to system 1.
Example 21: 5mL of solution containing 20 mM CTAB and 10 mM Triton X 100 was prepared in water. This was system 2 to which 250 mg of cholesterol was added and stirred in magnetic stirrer at 300 rpm for 24 h in dark.OD of the resultant micellar solution was measured at 430nm.
Example 22:
Micellar solution of cholesterol prepared by procedure described in Example 21 wherein 50mM sodium chloride was added to system 2
Example 23:
Micellar solution of cholesterol prepared by procedure described in Example 21 wherein 2mM calcium chloride was added to system 2.
Example 24:
Micellar solution of cholesterol prepared by procedure described in Example 21 wherein 1mM potassium hydrogen phthalate was added to system 2.
Example 25:
Micellar solution of cholesterol prepared by procedure described in Example 21 wherein 1mM trisodium citrate was added to system 2.
Results from Example 15 to Example 25 are listed in Table 2
Table 2: Absorbance values of Micellar cholesterol solutions in Examples 15 to 25
Example OD 430 nm after 2 hr OD at 430 nm after 24 h
15 0.287 0.104
16 0.290 0.146
17 0.352 0.156
18 0.257 0.169
19 0.256 0.110
20 0.202 0.116
21 0.232 0.141
22 0.178 0.182
23 0.20 0.197
24 0.276 0.176
25 0.233 0.112
Example 26: Enzymatic conversion of cholesterol to 7DHC
1g dry equivalent of permeabilized Pichia cells with the recombinant enzyme 7DHC reductase obtained in Example 2 were permeabilized as per Example 4 and added to a reaction mixture containing 150 mM of micellar cholesterol prepared as per Example 18, 165 mM of NADP sodium salt solution was prepared in water such that concentration of cholesterol in a reaction mixture is 5mg/mL. Enzymatic conversion was allowed to take place at 27°C in dark for 24 h. A Parallel Blank reaction was also incubated without the cells (Enzyme Blank). Weighed amount of samples were withdrawn from both the solutions at specific intervals 24 to 48 h and extracted in twice the volume of DCM (Dicholromethane). DCM extract were pooled and evaporated. Residue was diluted in known volume of methanol and quantified by HPLC for cholesterol and 7DHC in the sample. Table 3 below exhibits the 7-dehydrocholesterol production estimated by HPLC. HPLC analysis in Figure 8 depicts 7DHC production. Proportionate conversion of cholesterol to 7DHC is observed.
Example 27:
The enzymatic conversion of cholesterol to 7DHC as in Example 26 was conducted by employing permeabilized Pichia cells obtained in Example 7 and micellar cholesterol prepared as per Example 18 wherein the reaction was allowed to take place for 24h.
Example 28:
The enzymatic conversion of cholesterol to 7DHC as in Example 26 was conducted by employing permeabilized Pichia cells obtained in Example 9.Micellar cholesterol was prepared as described in Example 23 such that the concentration of cholesterol in reaction mixture was 10 mg/ mL
Example 29:
The enzymatic conversion of cholesterol to 7DHC as in Example 26 was conducted by employing permeabilized Pichia cells obtained in Example 11. Micellar cholesterol was prepared as described in Example 24 such that the concentration of cholesterol in reaction mixture was 5 mg/ mL
Example 30
The enzymatic conversion of cholesterol to 7DHC as in Example 26 was conducted by employing permeabilized Pichia cells obtained in Example 14. Micellar cholesterol was prepared as described in Example 24 such that the concentration of cholesterol in reaction mixture was 10 mg/ mL.
Example 31:
The enzymatic conversion of cholesterol to 7DHC as in Example 26 was conducted by employing permeabilized Pichia cells but with replacement of micellar cholesterol with cholesterol-PEG dissolved water such that concentration of PEG cholesterol was 25 mg / mL
Example 32:
The enzymatic conversion of cholesterol to 7DHC as in Example 26 was conducted by employing permeabilized Pichia cells but by replacing micellar cholesterol with cholesterol-PEG dissolved in system 1 and hydrolyzed with 0.01 N sodium hydroxide such that concentration of cholesterol in solution is 5 mg/ mL. Figure 15 depicts consistent yield of the 7DHC catalyzed from a micellar cholesterol substrate comprising pegylated cholesterol.
Example 33: Reaction as in Example 16 was repeated using Cho Suc TGMME equivalent to 200 mM of cholesterol prepared in 30 : 70 w/w Water -PEG 300 mixture.
Example 34: Reaction as in Example 16 was repeated using Cho Suc TGMME equivalent to 200 mM of cholesterol prepared in 30 : 70 w/w Water -PEG 400 mixture.
Example 35: Reaction as in Example 16 was repeated using Cho Suc TGMME equivalent to 200 mM of cholesterol prepared in 40 : 60 w/w Water -PEG 600 mixture.
Example 36: Reaction as in Example 16 was repeated using Cho Suc TGMME equivalent to 200 mM of cholesterol prepared in 50 :50 w/w Water -PEG 600 mixture.
Example 37: Reaction as in Example 16 was repeated using Cho Suc TGMME equivalent to 200 mM of cholesterol prepared in 80 : 20 w/w Water -PEG 6000 mixture.
Results: Table 3
HPLC analysis details
Column: Inertsil C18 250mm X 4.6 mm (5micron), Buffer: Methanol: Acetonitrile: 25: 75 Diluent Methanol Column oven temperature 25 °C, Detection Wavelength: 210 nm and 280 nm, Isocratic, Flow Rate: 1.2 mL/min, Injection Volume: 20 µl.
Example Time of reaction (h) Retention Time of Cholesterol in minutes Area of cholesterol Retention Time of 7-DHC in minutes Area of
7-DHC Figure No
Wavelength of detection 210 nm 280nm
26 48h 32.22 17551177 23.86 1361778 8
27 48h 33.74 4270304 23.80 126006 9
28 24h 35.67 21143469 24.65 5219811 10
29 48h 32.96 948605 23.779 5434636 11
30 48h 32.84 177746 24.198 653914 12
31 48h 27.1 2338822 23.84 1141258 13 & 14
47.53 6643732 -
32 48 h 30.209 216644 23.29 308859 15
Std cholesterol 1mg/ mL 32.75 6211631 - - 16
PEG cholesterol 2mg/ ml 27.08
47.59 915659
3361151 - - 17
Std 7DHC 0.976mg/ mL - - 24.52 29509946 18
Reaction mixture from Examples 33 to 37 was qualitatively analyzed by TLC system with DCM : methanol and spots developed with sulphuric acid and ethyl alcohol and compared with corresponding Rf of substrate and product .compared with standards.
Table 3 provides data relating to the peak area of cholesterol at 210nm and that of 7-DHC at 280nm. A variation in the peak area was observed due to the differing cholesterol substrate concentrations, detergents and surfactants used in the catalytic conversion of cholesterol to 7DHC.
Advantages of the invention:
• 7-dehydrocholesterol reductase (7-DHCR) synthesized by the nucleotide sequence having Seq Id No. 1 catalyses the conversion of cholesterol to 7-DHC, a precursor of vitamin D, thus serving as an excellent substitution for chemically synthesized 7DHC on commercial scale.
• Present commercial scale 7DHC production methods involves 4 chemical steps to convert cholesterol to 7DHC with use of hazardous reagents like bromine and acetic anhydride.
• The present invention intends to use an enzymatic step for direct conversion of cholesterol to 7DHC catalyzed by 7DHC enzyme.
• 7-DHCR works reversibly, by including oxidized form of a coenzyme (NADP +) along with cholesterol as a substrate to yield 7-DHC. Since this reaction is catalyzed by enzyme, it is more specific with lower probability of loss due to isomer formation which is critical factor for loss of yield in chemical process.
• Increased production of 7-DHCR may help in the treatment of Smith-Lemli-Opitz syndrome.
SEQUENCE LISTING
<110> FERMENTA BIOTECH LIMITED
<120>
<140> 543/MUMNP/2012
<150>
<151> 24/09/2015
<210> Sequence ID No 1
<211> Length: 1431
<212> Type: DNA
<213> Organism: Artificial sequence
<220> Feature:
<223> Other information: Recombinant DNA
<400> Sequence 1
atggctgcta agagtcaacc taacattcca aaggcaaagt ccctggatgg tgttacaaac gataggactg cttcacaggg 80
tcagtgggga agggcctggg aggttgactg gttctctctt gcttcagtga tattcctgtt gctgtttgct ccattcatcg 160
tgtactactt catcatggct tgtgatcagt actcttgtgc tttaactggt ccagtggtcg atatagtaac tggtcacgct 240
agattgtctg acatctgggc taagacacca cctattacta gaaaggctgc tcagttgtat accctgtggg ttacattcca 320
agtcttgttg tatacttccc tgcctgattt ctgtcacaag ttcctgcctg gatacgttgg tggtattcaa gaaggtgccg 400
ttacaccagc aggagtagta aacaaatacc agatcaacgg tcttcaggca tggcttctga cacatttgtt gtggtttgct 480
aacgctcatc ttctttcttg gttctctcct accatcatct tcgacaattg gattcctctg ctttggtgtg caaacatctt 560
gggatacgct gtttcaacat tcgccatggt gaagggatac ttctttccta cctctgctag ggattgcaag ttcactggta 640
acttcttcta caattacatg atgggtatcg agttcaaccc aaggattggt aagtggttcg acttcaagct gttcttcaat 720
ggaagacctg gaatcgtggc ttggaccttg ataaacctgt cctttgccgc caagcaaaga gagttgcatt cccatgttac 800
aaacgctatg gtgttagtta atgtgttgca ggctatctat gtgatcgact tcttctggaa tgagacatgg tatttgaaga 880
ctattgacat ttgtcacgat cacttcggat ggtatctggg ttggggagac tgcgtttggc ttccttatct gtatactttg 960
cagggtttgt acttagttta ccatccagtt cagctttcca ctccacacgc tgtaggtgta ttgttgttag gattggtggg 1040
ttactacatc tttagagtcg ctaaccacca gaaagacctg tttcgtcgta ctgacggtag atgtttgatc tggggaagaa 1120
agccaaaggt aatagaatgt tcctacacat ccgcagatgg tcaacgtcac cattcaaagt tgcttgtttc aggattctgg 1200
ggtgttgcta ggcacttcaa ctatgtagga gatttgatgg gttctcttgc ttactgctta gcttgtggtg gaggtcattt 1280
gttgccttac ttctacatca tatacatggc tatcctgtta acacatcgtt gtctgagaga cgaacacaga tgtgcttcta 1360
agtatggtcg tgattgggag agatacactg ctgctgtgcc ttatagactt cttcctggta tcttctaata g 1431
<210> Sequence ID No 2
<211> Length: 475
<212> Type: Polypeptide sequence
<213> Organism: Artificial sequence
<220> Feature:
<223> Amino acid sequence of 7- Dehydrocholestrol reductase (7-DHCR)
<400> Sequence 2
10 20 30 40 50
MAAKSQPNIP KAKSLDGVTN DRTASQGQWG RAWEVDWFSL ASVIFLLLFA
60 70 80 90 100
PFIVYYFIMA CDQYSCALTG PVVDIVTGHA RLSDIWAKTP PITRKAAQLY
110 120 130 140 150
TLWVTFQVLL YTSLPDFCHK FLPGYVGGIQ EGAVTPAGVV NKYQINGLQA
160 170 180 190 200
WLLTHLLWFA NAHLLSWFSP TIIFDNWIPL LWCANILGYA VSTFAMVKGY
210 220 230 240 250
FFPTSARDCK FTGNFFYNYM MGIEFNPRIG KWFDFKLFFN GRPGIVAWTL
260 270 280 290 300
INLSFAAKQR ELHSHVTNAM VLVNVLQAIY VIDFFWNETW YLKTIDICHD
310 320 330 340 350
HFGWYLGWGD CVWLPYLYTL QGLYLVYHPV QLSTPHAVGV LLLGLVGYYI
360 370 380 390 400
FRVANHQKDL FRRTDGRCLI WGRKPKVIEC SYTSADGQRH HSKLLVSGFW
410 420 430 440 450
GVARHFNYVG DLMGSLAYCL ACGGGHLLPY FYIIYMAILL THRCLRDEHR
460 470 475
CASKYGRDWE RYTAAVPYRL LPGIF
<210> Seqence ID No 3
<211> Length: 33 bp
<212> Type: DNA
<213> Organism:Artificial sequence
<220> Feature:
<223> Other information: primer
<400> Sequence 3
cgcctcgaga tggctgctaa gagtcaacct aac
<210> Sequence ID No: 4
<211> Length: 31 bp
<212> Type: DNA
<213> Organism: Artificial sequence
<220> Feature:
<223> Other information: primer
<400> Sequence 4
ctagtctaga ctattagaag ataccaggaa g
,CLAIMS:We claim,
1. A nucleotide sequence having Seq Id No. 1 encoding 7-dehydrocholesterol reductase (7DHCR).
2. A recombinant plasmid consisting the nucleotide sequence of claim 1.
3. The recombinant plasmid of claim 2 wherein the plasmid is selected from the group consisting of pET26b, pPICZa A, pPICZa B, pPICZa C, pPICZ A, pPICZ B and pPICZ C.
4. The host cell consisting the plasmid of claim 3, wherein the host cell is a strain of Pichia pastoris.
5. The host cell of claim 4, wherein the strain is Pichia pastoris GS115.
6. A process for the catalytic conversion of cholesterol to 7-dehydrocholesterol (7-DHC) by employing the recombinant 7-dehydrocholesterol reductase (7-DHCR), wherein the expression of 7-DHCR is extracellular or intracellular, the said process comprising;
(a) introducing recombinant plasmid consiting of Seq Id No. 1 in host cell Pichia pastoris;
(b) permeabilizing recombinant Pichia cells in the presence of a detergent and treating cells with cholesterol and NADP to catalyse the conversion of cholesterol to 7-dehydrocholestserol catalysed by the expressed protein having Seq Id No.2; and
(c) extracting 7DHC and unreacted cholesterol substrate in a polar solvent which is then dried followed by diluting the extracted residue with methanol.
7. The process according to claim 6, wherein the plasmid for extracellular expression of 7-DHCR is pET26b, pPICZa A, B and C.
8. The process according to claim 6, wherein the plasmid for intracellular expression is selected from the group consisting of pPICZ A, pPICZ B and pPICZ C.
9. The process according to claim 6, wherein the host cell strain is Pichia pastoris GS115
10. The process according to claim 6, wherein the detergent is selected from the group consisting of sodium dodecyl sulphate (SDS), Triton X 100, Cetyl trimethyl ammonium bromide (CTAB), acetone, n-hexane or a combination thereof.
11. The process according to claim 10, wherein the concentration of the detergent is ranging from10 mM to 20 mM.
12. The process according to claim 6, wherein the cholesterol based substrates for catalysis to obtain 7-DHC is selected from cholesterol, pegylated cholesterol and micellar preparations of cholesterol.
13. The process according to claim 6, wherein cholesterol and NADP sodium salt is in molar ratio ranging from 1:0.5 to 1.5
14. Use of recombinant 7-dehydrocholestserol reductase (7-DHCR) to produce 7- dehydrocholestserol as a precursor of vitamin D.
| # | Name | Date |
|---|---|---|
| 1 | Sequence listing [24-09-2015(online)].pdf | 2015-09-24 |
| 2 | Form 3 [24-09-2015(online)].pdf | 2015-09-24 |
| 3 | Drawing [24-09-2015(online)].pdf | 2015-09-24 |
| 4 | Description(Provisional) [24-09-2015(online)].pdf | 2015-09-24 |
| 5 | OTHERS [24-09-2016(online)].pdf | 2016-09-24 |
| 6 | Drawing [24-09-2016(online)].pdf | 2016-09-24 |
| 7 | Description(Complete) [24-09-2016(online)].pdf | 2016-09-24 |
| 8 | Assignment [24-09-2016(online)].pdf | 2016-09-24 |
| 9 | CERTIFIED COPIES TRANSMISSION TO IB [18-10-2016(online)].pdf | 2016-10-18 |
| 10 | Form 3 [01-12-2016(online)].pdf | 2016-12-01 |
| 11 | Form-2(Online).pdf | 2018-08-11 |
| 12 | 3636-MUM-2015-Power of Attorney-301115.pdf | 2018-08-11 |
| 13 | 3636-MUM-2015-Form 1-301115.pdf | 2018-08-11 |
| 14 | 3636-MUM-2015-Correspondence-301115.pdf | 2018-08-11 |
| 15 | 3636-MUM-2015-FORM 18 [20-09-2019(online)].pdf | 2019-09-20 |
| 16 | 3636-MUM-2015-FORM 3 [19-12-2019(online)].pdf | 2019-12-19 |
| 17 | 3636-MUM-2015-FER.pdf | 2021-10-18 |
| 1 | 2021-05-2522-39-02E_26-05-2021.pdf |