Sign In to Follow Application
View All Documents & Correspondence

A Process For Simultaneous Hydrolysis And Fermentation Of Biomass

Abstract: A PROCESS FOR SIMULTANEOUS HYDROLYSIS AND FERMENTATION OF BIOMASS The present invention relates to a process for simultaneous hydrolysis and fermentation (SSF) of biomass to obtain bioethanol from lignocellulosic biomass. The thermochemically pre-treated and dried biomass is placed in a specific concentration in minimal medium containing inoculum of combination of Fusarium incarnatum KU377454 and S. cerevisiae in specific ratio and incubated under specific incubation conditions to obtain bioethanol. The process yields high bioethanol at high solid loading within short span of incubation time. The process is less cumbersome by removing all the individual steps as cellulase production, enzymatic hydrolysis and fermentation are performed in a single vessel with much simplicity.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
28 November 2020
Publication Number
42/2022
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
drjainbharti@gmail.com
Parent Application

Applicants

BANASTHALI VIDYAPITH
Banasthali, Newai, Tonk, Rajasthan – 304022 India

Inventors

1. KUILA, Arindam
Department of Bioscience and Biotechnology, Banasthali Vidyapith, Banasthali, Newai, Tonk, Rajasthan-304022, India
2. PANT, Shailja
Department of Bioscience and Biotechnology, Banasthali Vidyapith, Banasthali, Newai, Tonk, Rajasthan-304022, India
3. Ritika
Department of Bioscience and Biotechnology, Banasthali Vidyapith, Banasthali, Newai, Tonk, Rajasthan-304022, India
4. SHARMA, Shivani
Department of Bioscience and Biotechnology, Banasthali Vidyapith, Banasthali, Newai, Tonk, Rajasthan-304022, India

Claims

1. A process for simultaneous hydrolysis and fermentation (SSF) of biomass to obtain bioethanol, said process comprising: (a) drying the biomass, (b) reducing the particle size of the said biomass, (c) thermochemically treating the biomass, (d) washing said biomass (e) drying the washed biomass obtained in step (d) to obtain pretreated biomass, (f) placing said pretreated biomass in a specific concentration in minimal medium containing inoculum, wherein the inoculum comprises Fusarium incarnatum KU377454 and S. cerevisiae in specific ratio, and incubating under specific incubation conditions, (g) filtering the incubated biomass to obtain bioethanol.

2. The process as claimed in claim 1 wherein, the biomass is a lignocellulosic material.

3. The process as claimed in claim 1 wherein, the biomass is selected from rice straw, corn husk, sorghum straw or other agro-residues.

4. The process as claimed in claim 1 wherein, said thermochemical treatment is alkali treatment at specific reaction conditions.

5. The process as claimed in claim 3 wherein, said alkali is 0.2M NaOH and said specific reaction conditions are temperature of 160 °C and duration of 30 minutes.

6. The process as claimed in claim 1 wherein, concentration of said pre-treated biomass in the minimal medium is in the range of 18% to 22%.

7. The process as claimed in claim 1 wherein, the ratio of Fusarium incarnatum KU377454 and S. cerevisiae in inoculum ranges from 1.0:0.5 to 1:1.5.

8. The process as claimed in claim 7 wherein, the ratio of Fusarium incarnatum KU377454 and S. cerevisiae in inoculum is 1.0:1.0.

9. The process as claimed in claim 1 wherein, the specific incubation conditions in step (f) are temperature in the range of 30 °C to 40 °C, incubation time in the range of 72 hrs to 120 hrs at pH in the range of 3 to 7.

10. The process as claimed in claim 9 wherein, the specific incubation conditions are temperature 30 °C, incubation time 72 hrs at pH 6.

11. The process as claimed in any of the preceding claims wherein the optimum process conditions are 18% pretreated biomass concentration, with incubation time of 72 hours at 30 °C with inoculum ratio of Fusarium incarnatum KU377454 and S. cerevisiae at 1:1.

12. The process of SSF as claimed in claim 1 wherein, said process is one pot.

Specification

FIELD OF THE INVENTION
The present invention relates to a process for simultaneous hydrolysis and fermentation of biomass. More specifically, the present invention relates to a process for simultaneous hydrolysis and fermentation of pretreated biomass using locally isolated Fusarium incarnatum KU377454. The invention also relates to a process for simultaneous hydrolysis and fermentation of pretreated biomass using co-culture of S. cerevisiae and locally isolated Fusarium incarnatum KU377454. The process of the present invention is a cost-effective process yielding improved bioethanol from different biomass.
BACKGROUND OF THE INVENTION
Bioethanol production from lignocellulosic biomass has received major research attention due to their abundance and immense potential as renewable source of energy in the form of sugars that can be converted into valuable products such as sugars, biofuel, bioethanol. The existing state of the art teaches isolation of potential strain for cellulase production, enzymatic hydrolysis using mixture of different cellulases (enoglucanase, exoglucanase and beta glucosidase) to enhance the reducing sugar yield. There are several reports on different approaches of utilizing both pentose and hexose sugars. Some reports on genetic engineering of yeast for utilization of both pentose and hexose sugars are also available. There are some reports on co-culture strategy (pentose and hexose sugar fermenting strains) for utilization of both pentose and hexose sugars. Some reports are there on genetic engineering of ethanologenic strain (S. cerevisiae) for cellulase enzyme production.
US5258293 discloses simultaneous saccharification and fermentation process for bioethanol production, wherein the culture of microorganisms is selected from the group consisting of Clostridium thermocellum, Fusarium oxysporum, and Clostridium cellulolyticum. It also suggests using co-culture of Fusarium oxysporum and C cellulolyticum with C thermosaccharolyticum or similar pentose-utilizing

organisms such as C. thermohydrosulfuricum and Thermoanaerobacter ethanolicus for bioethanol production.
CN107142297A addresses the shortcomings of high production cost of in-situ enzyme, low utilization rate of xylose and low conversion efficiency from lignocellulose to ethanol, and adopts a method of simultaneous saccharification and fermentation by utilizing two strains of Saccharomyces cerevisiae and Fusarium oxysporum on pretreated straw raw materials. By accretion of a small amount of commercial cellulase enzyme, pre-enzymatic hydrolysis of raw material is conducted, then by accretion oi Fusarium oxysporum and Saccharomyces cerevisiae at different time periods, the antagonistic actions of the two strains of bacteria are prevented, the utilization rate of hexoses and pentoses is improved, so that the aim of producing ethanol by using lignocellulose is achieved.
Sharma et al., J Pet Environ Biotechnol 2018, discloses simultaneous saccharification and fermentation of corn husk by co-culture strategy. The cellulase production was carried out using locally isolated Fusarium incarnatum KU377454. The drawback of this method is that it requires higher incubation time and different bioreactor for ethanol production.
Thomas Paschos etal, Industrial Crops and Products, Volume 76, 15 December 2015, Pages 793-802 discloses that simultaneous saccharification and fermentation by co-cultures of Fusarium oxysporum and Saccharomyces cerevisiae enhances ethanol production from liquefied wheat straw at high solid content.
However, there are several problems associated the existing state of the art such as cost of cellulase enzyme, different temperature optima for enzymatic hydrolysis and fermentation processes, lack of potential strain which can ferment both pentose and hexose sugars in case of simultaneous saccharification and fermentation^

The present invention overcomes the limitation of the existing state of the art and can be useful for consolidated bioprocessing of lignocellulosic bioethanol production. The present invention discloses bioethanol production by wild type strain of cellulolytic fungi which can ferment both pentose and hexose sugars effectively. The present study also demonstrated higher lignocellulosic bioethanol production by using co-culture of S. cerevisiae and Fusarium incarnatum KU377454.
OBJECTS OF THE INVENTION
In order to obviate the drawbacks in the existing state of the art, the main object of the present invention to provide a process for simultaneous hydrolysis and fermentation of biomass.
Another object of the present invention is to provide a process for simultaneous hydrolysis and fermentation of pretreated biomass.
Yet another object of the present invention is to provide a process for simultaneous hydrolysis and fermentation of pretreated biomass using locally isolated Fusarium incarnatum.
Yet another object of the present invention is to provide a process for simultaneous hydrolysis and fermentation of pretreated biomass using co-culture of S. cerevisiae and locally isolated Fusarium incarnatum KU377454.
Yet another object of the present invention is to provide a process for simultaneous hydrolysis and fermentation of pretreated biomass doing away with the different temperature optima for enzymatic hydrolysis and fermentation process by simultaneous saccharification and fermentation.

The process of the present invention is a cost-effective and time effective process yielding bioethanol for production of biofuel, sugars and other such products.
SUMMARY OF THE INVENTION
It will nevertheless be understood that no limitation of the scope of the invention is thereby intended by way of embodiments and examples. Such alterations and further modifications in the present invention, and such further applications of the principles of the invention as would normally occur to those skilled in the art are to be construed as being within the scope of the present invention.
It will be understood by those skilled in the art that the summary of the invention provided herein is exemplary and explanatory of the invention and are not intended to be restrictive thereof. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. The composition, methods, and examples provided herein are only illustrative and not intended to be limiting.
The terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process or method that comprises a list of steps does not include only those steps but may include other steps not expressly listed or inherent to such a process or method. Similarly, one or more steps of method or components preceded by "comprises... a" does not, without more constraints, preclude the existence of other, steps or components. Appearances of the phrase "in a preferred embodiment", "in an embodiment", "in another embodiment" and similar language throughout this specification may, but not necessarily do, all refer to the same embodiment.
Accordingly, the present invention relates to a process for simultaneous hydrolysis and fermentation of pretreated biomass. In one aspect of the present invention, the

process for simultaneous enzymatic hydrolysis and fermentation of pretreated biomass is carried out by using locally isolated Fusarium incarnatum.
In another aspect of the present invention, the simultaneous enzymatic hydrolysis and fermentation of pretreated biomass is carried out by using co-culture of S. cerevisiae and locally isolated Fusarium incarnatum KU377454.
The biomass used in the present invention can be any abundantly available agro-residues (rice straw, corn husk, sorghum straw etc).
In a preferred embodiment, the present invention provides utilization of com husk for bioethanol production. The com husk is obtained from local agricultural field of Banasthali Vidyapith, Tonk, Rajasthan, India. The Fusarium incarnatum KU377454 was isolated from soil of local agricultural field of Banasthali Vidyapith, Tonk, Rajasthan, India. S. cerevisiae of deposit number MCC 1034 was procured from National Centre for Cell Science (NCCS), Pune.
In another aspect of the present invention, the biomass is thermochemically pretreated by an alkaline solution, said alkaline solution preferably being dilute sodium hydroxide. Then, simultaneous saccharification and fermentation (SSF) is carried out by using pretreated biomass. SSF of pretreated biomass is carried out by using locally isolated Fusarium incarnatum KU377454 and/or by co-culture strategy. S. cerevisiae and Fusarium incarnatum KU377454 are used together as co-culture. The isolated cellulolytic fungal strain Fusarium incarnatum KU377454 showed significant ethanol production from both pentose and hexose sugars. There is an increase in yield in case of SSF when co-culture of S. cerevisiae and Fusarium incarnatum KU377454 is used. The present process can be used for lignocellulosic bioethanol production through consolidated bioprocessing approach.

The present invention describes bioethanol production from thermochemically pretreated substrate by using cellulolytic strain of Fusarium incarnatum KU377454. Enzymatic hydrolysis and fermentation steps are carried out together in one pot using single fungal strain Fusarium incarnatum KU377454. Higher bioethanol production is achieved at high solid loading within short span of incubation.
The process is less cumbersome process by removing all the individual steps and can be performed in a single vessel with much simplicity. Addition of tween 60 results in enhanced ethanol production. The co-culture of S. cerevisiae and Fusarium incarnatum KU377454 results in increased ethanol production. Cellulase production, enzymatic hydrolysis and fermentation processes are carried out together in one pot.
One of the Gene sequences of isolated Fusarium incarnatum KU377454 is:
TGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATA
CCTATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGC
CCGCCCGAGGACCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAAC
AAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCG
ATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAG
TGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGG
GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTGTTGGG
ACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTT
CCATAGCGTAGTAATCATACACCTCGTTACTGGTAATCGTCGCGGCCACG
CCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACC
CGCTGAACTTAAGCATATC
Therefore, the present invention provides a process for simultaneous hydrolysis and fermentation of pretreated biomass doing away with the different temperature optima for enzymatic hydrolysis and fermentation process by simultaneous saccharification and fermentation. The process of the present invention is a cost-effective and time

effective process yielding bioethanol for production of biofuel, sugars and other such products.
BRIEF DESCRIPTION OF DRAWINGS
Fig. 1 shows graphical representation of residual glucose vs. ethanol production Fig. 2 shows graphical representation of residual xylose vs. ethanol production
DETAILED DESCRIPTON OF THE INVENTION WITH NON-LIMITING EXAMPLE AND EMBODIMENTS
The present invention relates to a process for simultaneous hydrolysis and fermentation of pretreated biomass. In one aspect of the present invention, the process for simultaneous enzymatic hydrolysis and fermentation of pretreated biomass is carried out by using locally isolated Fusarium incarnatum KU377454.
One of the Gene sequences of isolated Fusarium incarnatum KU377454
TGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATA
CCTATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGC
CCGCCCGAGGACCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAAC
AAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCG
ATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAG
TGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGG
GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTGTTGGG
ACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTT
CCATAGCGTAGTAATCATACACCTCGTTACTGGTAATCGTCGCGGCCACG
CCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACC
CGCTGAACTTAAGCATATC

Analysis of Pentose fermentation by the Fusarium incarnatum KU377454
The Fusarium incarnatum KU377454 of viable cell concentration 1 x 109 cells/mL has been suspended in 10 mL of YPX media (1% yeast extract, 2% peptone, and 2% xylose sugar) and incubated at 25 °C 45 °C for 4 days and then the ability of the F. incarnatum KU377454 to co-utilize the xylose and glucose as well as tolerance to ethanol and acetic acid has been evaluated.
Tolerance activity
F. incarnatum KU377454 has been grown on YEPX media (1 percent yeast extract, 2 percent peptone, and 2 percent xylose) supplemented with varied concentrations of ethanol (1-10 percent) and acetic acid (0.1-2 percent) and incubated at 35 °C for four days to test their resistance to ethanol and acetic acid. Strain has been grown in YEPX medium and incubated at different temperatures (25-45 °C) for five days to test thermotolerance activity. Adjusting the pH of culture media within the range of 3-8 has been used to determine pH tolerance. After four days of incubation, evaluations have been conducted. The vitality of the cells has been determined using a standard procedure.
Table 1: Effect of different temperature, pH, ethanol concentration and acetic acid concentration on viability (number of viable cells/ml of sample) of Fusarium incarnatum KU377454.

Temp
CO Cell viability pH Cell viability Ethanol concentration
(v/v, %) Cell viability Acetic acid
(%) Cell viability
25 5000000 ± 150000 3 2500000 ± 120000 1 480000000 ± 3500000 0.1 560000000 ± 2500000
30 35000000± 4 34000000 2 250000000 0.3 32000000 ±

2500000 ± 2300000 ± 2500000 2700000
35 500000000 ± 4500000 5 85000000 ± 3500000 3 180000000 ± 3500000 0.5 1800000± 150000
40 28000000 ± 2200000 6 540000000 ± 9200000 5 22500000 ± 2700000 1 500000± 27000
45 4200000 ± 180000 7 220000000 ± 2300000 8 1200000 ± 250000 1.5 38000± 1200
8 1500000± 230000 10 550000± 23000 2 12000± 800
Thus, the Fusarium incarnatum KU377454 could withstand a temperature range of 30 °C to 40 °C, at pH ranging from 6 to 7 and could withstand maximum of 15%> (w/v) glucose, 10%o (w/v) xylose, and 1%> (v/v) acetic acid. The optimum temperature is 35 °C at pH 6 to co-utilize the xylose and glucose as well as tolerance to ethanol and acetic acid.
Sugar assimilation assay
The F. incarnatum KU377454 has been grown in YP media (yeast extract 1%, peptone 2%>), with xylose (10%>) and glucose (10%>), respectively as sole carbon sources, and incubated in an incubator at 35 °C, pH 6 for seven days under static circumstances. All experiments have been carried out in a 250 mL conical flask with a 150 mL working volume. After every 24 hours, samples have been taken and ethanol and residual sugars have been measured using the HPLC method. (Fig. 1 and Fig. 2).
It was observed after 96 hrs of incubation, glucose consumption rate was 0.99 mg/mL/h and ethanol production rate was 0.47 mg/mL/h (Fig. 1). It was also

observed that after 96 hrs, xylose consumption rate was 0.54 mg/mL/h and ethanol production rate was 0.27 mg/mL/h (Fig. 2).
Thus, the isolated cellulolytic fungal strain Fusarium incarnatum KU377454 showed significant ethanol production from both pentose and hexose sugars.
There is an increase in yield in case of SSF when the co-culture of S. cerevisiae and Fusarium incarnatum KU377454 is used. Thus, the present process is used for lignocellulosic bioethanol production through consolidated bioprocessing approach.
According to an aspect of the present invention, the simultaneous enzymatic hydrolysis and fermentation of pretreated biomass is carried out by using co-culture of S. cerevisiae and locally isolated Fusarium incarnatum KU377454. The co-culture of S. cerevisiae and Fusarium incarnatum KU377454 results in increased ethanol production. Cellulase production, enzymatic hydrolysis and fermentation processes are carried out together in a single vessel with much simplicity.
The biomass used in the present invention can be any abundantly available agro-residues such as rice straw, corn husk, sorghum straw etc.
The biomass is thermochemically pretreated by an alkaline solution, said alkaline solution preferably being dilute sodium hydroxide. Then, simultaneous saccharification and fermentation (SSF) is carried out on the pretreated biomass.
According to another aspect of the present invention, the bioethanol production from thermochemically pretreated substrate or biomass is carried out using the cellulolytic strain of Fusarium incarnatum KU377454. Enzymatic hydrolysis and fermentation steps are carried out together in one pot using the single fungal strain Fusarium

incarnatum KU377454. Higher bioethanol production is achieved at high solid loading within short span of incubation.
Influence of inoculum ratio of F. incarnatum KU377454 and S. cerevisiae on ethanol production
Both strains (F. incarnatum KU377454 and S. cerevisiae) have been co-cultured in YEP media supplemented with glucose/xylose (10%, w/v) and incubated at 35 °C for four days to evaluate the influence of inoculum ratios on the growth of the co-cultivated microbial strains as well as on ethanol production. The growth of the cells has been measured using a standard procedure.
Following the NREL technique, a compositional analysis of the original and treated biomass was performed. HPLC was used to determine the amounts of reducing sugars (glucose and xylose) and ethanol. An HPLC system with a carbohydrate column (Shimadzu carbohydrate column) and a refractive index detector was used to analyse sugars. The method used an isocratic elution (water:acetonitrile 25:75, v/v) as the mobile phase, which was degassed before use. The eluent flow rate was 1.8 mL/min at a column temperature of 25 °C. The sample injection volume was 20 litres, and the run time was 15 minutes. Sugar standards were employed to quantify different sugars. With O.OOIM H2SO4 as the mobile phase and a flow rate of 0.8 mL/min, ethanol was quantified using a carbohydrate column. A refractive index detector was used to measure the ethanol.
Table 2: Comparative analysis of total ethanol production by co-cultivated microbial strains using glucose and xylose as substrate, respectively

Effect of glucose
Ratio of S. cerevisiae and F. incarnatum Cell growth (g/L) Ethanol (g/L)
1:0.1 0.5 25.50 ±0.80

1:0.5 0.8 38.27 ±0.59
1:1 0.7 45.50 ±0.50
1:1.5 0.9 40.25 ± 0.28
1:2 0.6 38.70 ±0.55
Effect of xylose
Ratio of S. cerevisiae and F. incarnatum Cell growth (g/L) Ethanol (g/L)
1:0.1 0.4 25.57 ±0.34
1:0.5 0.5 30.17 ±0.79
1:1 0.9 35.50 ±0.56
1:1.5 0.8 28.25 ± 0.40
1:2 0.9 20.15 ±0.45
Thus, the range of ratio of S. cerevisiae and F. incarnatum KU377454 for bioethanol production is from 1.0:0.5 to 1:1.5, while the optimal ratio is 1.0:1.0.
The simultaneous saccharification and fermentation (SSF) process conditions have been optimized by using variations in pre-treated biomass/substrate concentration, ratio of Fusarium incarnatum KU377454 and and S. cerevisiae, incubation temperature, and incubation time. Low (18%), medium (20%), and high (22%), respectively, have been the levels of variables for substrate concentration. Low (30 °C), medium (35 °C), and high (40 °C) have been the temperature levels of variables, respectively. Variable incubation time levels have been low (72 h), middle (96 h), and high (120 h), respectively. The pH is ranging from 3 to 7.
The optimum incubation temperature for SSF using the co-culture of Fusarium incarnatum KU377454 and and S. cerevisiae is 30 °C and the incubation time is 72 hrs. at pH 6. The optimum pretreated biomass concentration is 18%.

In an aspect of the invention, the process of the present invention comprises the steps of drying the biomass, milling and filtering the dried biomass to reach particle size of 0.18-0.90 mm, thermochemically treating the filtered biomass, washing said treated biomass with water multiple times, drying of washed biomass to obtain pretreated biomass, placing said pretreated biomass in minimal medium containing inoculum, wherein the inoculum comprises Fusarium incarnatum KU377454 and and S. cerevisiae in specific ratio, and incubating under specific incubation conditions, filtering the incubated biomass to obtain a clear supernatant which is tested for bioethanol production.
The thermochemical treatment is carried out using dilute alkali solution at specific reaction conditions.
In a specific embodiment, the thermochemical treatment is conducted by placing filtered and dried biomass in 0.2M NaOH at 160 °C for 30 minutes. Thereafter, the biomass is washed multiple times with water and then oven dried at a temperature of 80 °C to reach the dried biomass at a consistent weight.
In another embodiment, the concentration of said pre-treated biomass in the minimal medium is in the range of 18% to 22%.
In another embodiment, the ratio of Fusarium incarnatum KU377454 and S. cerevisiae in inoculum ranges from 1.0:0.5 to 1:1.5, while the preferred ratio is 1.0:1.0.
In another embodiment, the specific incubation conditions comprises a temperature in the range of 30 °C to 40 °C, incubation time in the range of 72 hrs to 120 hrs at pH in the range of 3 to 7.

In a preferred embodiment, the optimum incubation conditions are temperature 30 °C, incubation time 72 hrs at pH 6.
In a further embodiment, the process further comprises addition of tween 60 in the minimal medium leading to enhanced bioethanol yield.
The process of SSF is performed in a single vessel removing all the individual steps of cellulase production, enzymatic hydrolysis and fermentation.
In a preferred embodiment, the corn husk is sun-dried and milled. It was then filtered through 20 and 80 meshes to reach particle sizes of 0.18-0.90 mm. The sieved biomass was stored at room temperature. The sieved biomass is pre-treated with 0.2M NaOH for 30 minutes at 160 °C to obtain pre-treated biomass. The pre-treated biomass is washed with water multiple times before being oven dried to a consistent weight at 80 °C to obtain dried pre-treated biomass. The dried pre-treated biomass has been analysed for major components using known techniques.
Simultaneous Saccharification and Fermentation by co-culture strategy
5 g of pre-treated biomass has been placed in 25 mL of minimal medium (NaNCb: 2.5 g/L, KH2PO4: 1 g/L, KC1: 0.5 g/L and MgS04.7H20: 0.5 g/L) in a 100 mL Erlenmeyer flask containing 5% inoculum (equal mixture of Fusarium incarnatum and S. cerevisiae). The co-culture of Fusarium incarnatum and S. cerevisiae with viable cell concentrations of 1 x 109 cells/mL and 1 x 108 cells/mL, respectively is used on substrate concentrations of 18%, 20% and 22%. To produce a partly anaerobic state, the flask has been wrapped in parafilm. The flask has been then incubated for three to four days at 30 °C - 40 °C. After incubation, the filtrate has been centrifuged for 5 minutes at 10,000 rpm to obtain a clear supernatant, which has been then tested for ethanol using the HPLC method.

Table 3: Experimental design and responses for simultaneous saccharification and fermentation of pretreated substrate by co-culture strategy

Run order Substrate concentration
(%) Temperature (°C) Incubation time (h) Ethanol (%, v/v)
Experimental Predicted
1 18 30 72 6.28 6.27
2 22 30 72 4.32 4.33
3 18 40 72 4.55 4.56
4 22 40 72 3.10 3.09
5 18 30 120 3.75 3.76
6 22 30 120 4.57 4.57
7 18 40 120 3.75 3.74
8 22 40 120 5.01 5.02
9 18 35 96 4.52 4.52
10 22 35 96 4.20 4.19
11 20 30 96 4.42 4.42
12 20 40 96 3.80 3.79
13 20 35 72 3.96 3.96
14 20 35 120 3.69 3.68
15 20 35 96 3.95 3.93
16 20 35 96 3.90 3.93
17 20 35 96 3.92 3.93
18 20 35 96 3.91 3.93
19 20 35 96 3.94 3.93
20 20 35 96 3.95 3.93
The optimum ethanol production of 6.28% v/v using co-culture strategy is obtained at substrate concentration of 18%, incubation time of 72 hrs at 30 °C. The co-culture comprises of S. cerevisiae and F. incarnatum KU377454 at a ratio of 1.0:1.0. Under same conditions, S. cerevisiae alone produced maximum ethanol production of

4.5% (v/v) and F. incarnatum KU377454 alone produced maximum ethanol production of 4.05%> (v/v).
Thus, the present invention provides a process of high bioethanol production at high solid loading within short span of incubation time. The process is less cumbersome by removing all the individual steps as cellulase production, enzymatic hydrolysis and fermentation are performed in a single vessel with much simplicity.

We claim:

1. A process for simultaneous hydrolysis and fermentation (SSF) of biomass to
obtain bioethanol, said process comprising:
(a) drying the biomass,
(b) reducing the particle size of the said biomass,
(c) thermochemically treating the biomass,
(d) washing said biomass
(e) drying the washed biomass obtained in step (d) to obtain pretreated biomass,
(f) placing said pretreated biomass in a specific concentration in minimal medium containing inoculum, wherein the inoculum comprises Fusarium incarnatum KU377454 and S. cerevisiae in specific ratio, and incubating under specific incubation conditions,
(g) filtering the incubated biomass to obtain bioethanol.

2. The process as claimed in claim 1 wherein, the biomass is a lignocellulosic material.
3. The process as claimed in claim 1 wherein, the biomass is selected from rice straw, corn husk, sorghum straw or other agro-residues.
4. The process as claimed in claim 1 wherein, said thermochemical treatment is alkali treatment at specific reaction conditions.
5. The process as claimed in claim 3 wherein, said alkali is 0.2M NaOH and said specific reaction conditions are temperature of 160 °C and duration of 30 minutes.
6. The process as claimed in claim 1 wherein, concentration of said pre-treated biomass in the minimal medium is in the range of 18% to 22%.

7. The process as claimed in claim 1 wherein, the ratio of Fusarium incarnatum
KU377454 and S. cerevisiae in inoculum ranges from 1.0:0.5 to 1:1.5.
8. The process as claimed in claim 7 wherein, the ratio of Fusarium incarnatum
KU377454 and S. cerevisiae in inoculum is 1.0:1.0.
9. The process as claimed in claim 1 wherein, the specific incubation conditions in
step (f) are temperature in the range of 30 °C to 40 °C, incubation time in the range
of 72 hrs to 120 hrs at pH in the range of 3 to 7.
10. The process as claimed in claim 9 wherein, the specific incubation conditions are temperature 30 °C, incubation time 72 hrs at pH 6.
11. The process as claimed in any of the preceding claims wherein the optimum process conditions are 18% pretreated biomass concentration, with incubation time of 72 hours at 30 °C with inoculum ratio of Fusarium incarnatum KU377454 and S. cerevisiae at 1:1.
12. The process of SSF as claimed in claim 1 wherein, said process is one pot.

Documents

Application Documents

# Name Date
1 202011051947-STATEMENT OF UNDERTAKING (FORM 3) [28-11-2020(online)].pdf 2020-11-28
2 202011051947-PROVISIONAL SPECIFICATION [28-11-2020(online)].pdf 2020-11-28
3 202011051947-FORM 1 [28-11-2020(online)].pdf 2020-11-28
4 202011051947-DECLARATION OF INVENTORSHIP (FORM 5) [28-11-2020(online)].pdf 2020-11-28
5 202011051947-Proof of Right [08-01-2021(online)].pdf 2021-01-08
6 202011051947-FORM-26 [08-01-2021(online)].pdf 2021-01-08
7 202011051947-ENDORSEMENT BY INVENTORS [08-01-2021(online)].pdf 2021-01-08
8 202011051947-SEQUENCE LISTING (.txt) [26-08-2021(online)].txt 2021-08-26
9 202011051947-DRAWING [26-08-2021(online)].pdf 2021-08-26
10 202011051947-CORRESPONDENCE-OTHERS [26-08-2021(online)].pdf 2021-08-26
11 202011051947-COMPLETE SPECIFICATION [26-08-2021(online)].pdf 2021-08-26
12 202011051947-Power of Attorney-120121.pdf 2021-10-19
13 202011051947-OTHERS-120121.pdf 2021-10-19
14 202011051947-Form 5-120121.pdf 2021-10-19
15 202011051947-Correspondence-120121.pdf 2021-10-19
16 202011051947-FORM 18 [09-11-2022(online)].pdf 2022-11-09
17 202011051947-FORM-8 [31-10-2024(online)].pdf 2024-10-31