FIELD OF INVENTION
[0001] The present disclosure relates to a process of constructing a phage display
library enriched for recombinant phages having in-frame protein encoding DNA
fragments (ORF), by employing a modified helper phage, comprising at least one
protease cleavage site in the polynucleotide encoding glll protein, this renders the
modified helper phage highly sensitive to protease digestion and abolishes its infectivity
function.
BACKGROUND OF THE INVENTION
[0002] Phage display is a molecular technique where DNA encoding a peptide or
^ k protein, when cloned in-frame with a coat protein of a bacteriophage, is displayed on
the phage surface, with the encoding DNA encapsulated in the same phage (Smith et
ai, Science, 1985, 228(4705), 1315-1317). This allows for a physical linkage between
the phenotype (the displayed protein) and the genotype (the encoding DNA). Because
of this unique property, a phage displaying a peptide or protein can be enriched from a
milieu of millions of other phages by a process of panning (affinity selection) on
immobilized baits and the identity of the displayed protein can be determined by
sequencing the encoding DNA contained within the phage. It is an extremely powerful
tool for studying protein-ligand interactions and identification of immunodominant
regions using gene fragment libraries. In addition, it has been exploited for epitope
mapping and construction of large antibody libraries to select desired binders with
g^ improved affinities (Pack et al.. Journal Of Immunological Methods, 1997, 206, 43-52;
Goletz et ai. Journal Of Molecular Biology, 2002, 315, 1087-1097).
[0003] The filamentous Ml3 phage has been most successfully exploited for surface
display. Ml3 has five coat proteins namely, glllP, gVIP, gVIIP, gVIIIP and glXP that
have been shown suitable for functional display. Among different phage display
systems, glllP has been most widely employed (McCafferty et al.. Nature, 1990, 348,
552-554). The glllP is a 406 amino acid modular protein which gets assembled on one
end of the phage during extrusion from the host with a maximum of five copies per
2
• 3
phage. It is essential for infection and comprises three functionally distinct domains
namely, Nl, N2 and CT separated by glycine rich linkers. The Nl domain binds to
TolA receptor, N2 domain mediates infection by binding to F-pilus and CT domain
anchors glllP to the phage particles. These domains play a crucial role in infection and
phage assembly; however, peptides and proteins can be inserted at the boundaries
between the glllP domains without affecting the infectivity of the phage. For glllPbased
display, vectors based on phagemid carry the gene encoding glllP under a
regulated promoter with the foreign DNA cloned between a signal sequence (mostly
PelBss) and glllP coding sequence (Breitling et al, Gene, 1991, 104, 147-153;
Hoogenboom et al.. Nucleic Acids Research, 1991, 19, 4133-4137; Marks et al.,
^ ^ Journal Of Molecular Biology, 1991, 222: 581-597). These vectors also carry plasmid
origin of replication, antibiotic selection marker and wild type filamentous Ml3 phage
origin of replication (fori). In this system, phage production is initiated by infection with
helper phage (such as M13K07 or VCSMI3) which itself has a conditionally defective
origin of replication in the presence of a phagemid, but provides all the proteins
necessary for replication and assembly of phage particles including the native glllP,
whose equivalent is also produced as glllP fusion protein from phagemid. The net result
is that majority of extruded phage particles encapsulate phagemid single stranded DNA
and carry two kinds of glllP protein, one encoded by the helper phage (native glllP
protein) and the other encoded by the phagemid (glllP fusion protein). However, in the
case of phagemid based glllP display vectors, only 1-10% of total phages display the
^ ^ glllP fusion protein while the remaining phages carry native glllP derived from the
helper phage.
[0004] Another important application of phage display has been in constructing cDNA
and fragmented whole genome libraries where use of glllP display vectors has been
challenging due to the presence of stop codon and poly(A) tails in the case of oligo dT
tailed cDNA. This problem can be alleviated using random primed cDNA fragments or
fragmented genomes, which can be cloned between the signal sequence and the glllP
coding sequence. However, in this approach only a small fraction (1/18 = 5.55 %) of
3
gene fragments are in reading frame with respect to the signal sequence and glllP
coding sequence to code for glllP fusion protein that matches with the proteome of the
organism due to three reading frames at each DNA terminus and two possible
orientation.
[0005] One of the major applications of glllP based Ml3 phage display system has
been in construction of antibody fragment libraries to select desired binders and
improve their affinity in conjunction with mutagenesis. However, during the
construction of complex antibody libraries, PCR is employed at multiple steps. PCR
generated errors result in a large number of cloned antibody fragments either having
stop codons or out of frame mutations, thus reducing the quality of the libraries.
t ^ p Consequently, large libraries with several million to billion clones are constructed;
however, the effective functional population of in-frame clones in these libraries is only
less than 5-6Vo. Further, when used for affinity selection, these libraries suffer from
non-specific interactions leading to poor enrichment of desired clones.
[0006] EP1078051 describes a method for the selection of a correctly folded fusion
polypeptide, comprising the steps of providing a plurality of virions which encode and
display a repertoire of fusion polypeptides, the fusion polypeptide comprises a
heterologous polypeptide inserted into the sequence of a viral coat protein polypeptide,
wherein a protease site is located within the fusion polypeptide such that the site is
protected from protease cleavage in correctly folded fusion polypeptides and not
^^ protected from cleavage in fusion polypeptides not correctly folded, and the repertoire
^ ^ comprises at least partially unfolded and folded members; exposing the virions to a
protease whereby virions which display correctly folded fusion polypeptides are
resistant to cleavage by the protease and those that do not display correctly folded
fusion polypeptides are not resistant to cleavage by the protease and propagating the
virions comprising intact fusion protein.
[0007] US6,027,930 describes a bacteriophage with improved efficiency as a helper
phage in the selection and amplification of a nucleic acid encoding a specific binding
4
protein, or a binding functional part thereof, characterized in that a gene III promoter is
kept, whereas the gene III coding sequence is deleted.
[0008] T7 phage has been successfully employed for ORF selection in large libraries
to obtain up to 90% ORF enrichment. However, the fragment sizes only ranged from
300 to 500 bp, which may be small to ensure representation of all protein domains
(Caberoy et al.. Journal Of Molecular Recognition, 2010, 23, 74-83). The use of various
solubility-based reporter systems such as chloramphenicol acetyltransferase (CAT)
(Maxwell et al., Protein Science, 1999, 8, 1908-1911) or dihydrofolate reductase
(DHFR) (Liu et al.. Protein Expression Purification, 2006, 47, 258-263) can also be
exploited for the purpose of ORF selection, but can face the problem of internal cryptic
^ p start sites within the gene fragments leading to expression of fusion proteins with the
selectable marker in a non-genic reading frame. In this regard, insertion of random gene
fragments between the signal sequence and P-lactamase gene has been used to
efficiently select ORFs at a genome scale (D'Angelo et al., BMC Genomics, 2011, 12
Suppl 1: S5). This method is predicted to allow the selection of gene fragments
encoding soluble proteins.
SUMMARY OF THE INVENTION
[0009] An aspect of the present disclosure relates to animproved process of producing
an open reading frame (ORF) enriched phage display library comprising: providing a
population of recombinant phagemids comprising at least one heterologous
^ ^ polynucleotide inserted upstream of polynucleotide encoding protease-resistant glll
protein; introducing the population of recombinant phagemids into host cells to obtain
transformants; infecting the transformants with a modified helper phage to obtain a
population of recombinant phages displaying heterologous protein and displaying no
heterologous protein; wherein the modified helper phage comprises at least one protease
cleavage site in polynucleotide encoding glll protein; treating the population of
recombinant phages with a protease wherein the protease can cleave the protease site in
the modified recombinant phage glllp to obtain treated recombinant phages; infecting
I 5
host cells with the treated recombinant phages from step (d) to obtain recombinant
transformants; rescuing the recombinant transformants from step (e) with a helper
phage to obtain a phage display library enriched for heterologous in-frame proteinencoding
DNA fragments (ORFs), wherein display of the heterologous protein is
indicative of in-frame protein-encoding DNA fragments.
[00010] Another aspect of the present disclosure relates to a process of selection of inframe
antibody fragments comprising: amplification of Vtand VH domains and splicing
together with a linker to produce "scFv" fragment; wherein the VH and VL domains are
amplified selected from group a consisting of cloned DNA using two sets of conserved
primers and synthetic DNA encoding VL and VH domains; cloning the "scFv" fragment
^ ^ upstream of polynucleotide encoding protease-resistant glllP phagemids to produce a
population of recombinant phagemids; introducing the population of recombinant
phagemids into host cells to obtain transformants; infecting the transformants with a
modified helper phage to obtain a population of recombinant phages displaying
functional "scFv" and other phages displaying non-functional "scFv" containing
aberrant chain; wherein the modified helper phage comprises at least one protease
cleavage site in polynucleotide encoding glll protein; treating the population of
recombinant phages with a protease; wherein the protease can cleave the protease site in
the modified helper phage to obtain treated recombinant phages; infecting host cells
with the treated recombinant phages to obtain recombinant transformants; obtaining the
recombinant transformants with a helper phage to obtain phages displaying in-frame
f | p functional "scFv" fragments that remain infectitious and the recombinant phages
displaying non-functional "scFv" containing aberrant chain are not infectitious; wherein
display of the functional "scFv" fragments is indicative of in-frame functional antibody
fragments.
[00011] This summary is provided to introduce concepts related to a process of
constructing a phage display library enriched for recombinant phages having in-frame
protein encoding DNA fragments, by employing a modified helper phage, comprising at
6
least one protease cleavage site in the polynucleotide encoding glll protein. This
summary is not intended to identify essential features of the claimed subject matter nor
is it intended for use in determining or limiting the scope of the claimed subject matter.
BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
[00012] The following drawings form part of the present specification and are included
to further illustrate aspects of the present disclosure. The disclosure may be better
understood by reference to the drawings in combination with the detailed description of
the specific embodiments presented herein.
[00013] Figure lA shows the schematic representation of glllP protein encoded by the
^ ^ modified helper phage AGM13. Figure IB shows the schematic representation of glllP
protein encoded by the helper phage VCSM13.
[00014] Figure 2 shows the western blot analysis of the modified helper phage
(AGM13) and VCSM13 phage samples treated with different concentrations of trypsin.
(M: Prestained marker; Lanes 1-5: 1.5 x 10'° AGM13 phages treated with 0, 0.1, 1, 10
and 100 ng/ml trypsin, respectively; Lane 6: empty; Lanes 7-11: 1.5 x 10'° VCSM13
phages treated with 0, 0.1, 1, 10 and 100 |ag/ml trypsin, respectively).
[00015] Figure 3A shows the titre and reactivity of phages rescued by the modified
helper phage AGM13. Figure 3B shows the titre and reactivity of phages rescued by the
helper phage VCSMl3.
^Ill [00016] Figure 4 shows the process of open reading frame (ORF) selection using the
modified helper phage AGM13.
[00017] Figure 5 shows the distribution oi Mycobacterium tuberculosis H37Rv gene
fragments in the MTBLIB27 library. Figure 5A shows bar graph depicting the size
distribution of M. tuberculosis H37Rv gene fragments in the MTBLIB27 at different
stages of library construction. Figure 5B shows schematic representation of the
distribution of gene fragments. The M. tuberculosis genome is -4.4 Mb and consists of
-4000 genes. (I) MTBLIB27C01 primary cells before ORF selection; (11)
j
7
MTBLIB27P01 after trypsin treatment (10 ^g/ml) of primary phages; (III)
MTBLIB27C02 secondary cells obtained after trypsin treatment (10 ng/ml) of primary
phages for ORF selection; (IV) MTBLIB27P02 obtained from rescue of C02. The non-
ORF selected inserts which align with the M tuberculosis genome are shown as black
arrows; the clones in-frame with PelBss and glllP are indicated as checkered arrows
(non-genic clones); the clones aligning with the M tuberculosis proteome are indicated
as white arrows (genie clones). The direction of the arrows indicates gene orientation.
The maps are to scale.
[00018] Figure 6 shows the alignment of the fragments of MTBLIB27 library selected
by the monoclonal antibodies (A) Ag85-12 and (B) 1912. The translated regions of
^ ^ Ag85A, Ag85B and 19-kDa antigens of Mycobacterium tuberculosis are represented as
solid bar. The location of the deduced peptide sequences displayed on affinity-selected
phages along with the position of the coded peptide is shown in bold on the right of the
corresponding clone bar. The minimal overlapping sequence representing the putative
epitope is shown below the alignment of each group.
[00019] Figure 7 shows the schematic representation of the vector pVCEP123964.
lacPO, lac promoter-operator; RBS, ribosome-binding site; PelB, pectate lyase signal
sequence; Stuffer, 1.8 Kbp nucleotide sequence flanked by Bsa\ sites (a) and (c); Tryp,
trypsin protease cleavage site; S, spacer; glllP, segment encoding amino acid residues 2
- 405 of the gene III of filamentous phage; fori, origin of replication of filamentous
^ ^ phage; Amp', p-lactamase gene; Ori, ColEl origin of replication; tHP, transcriptional
^ ^ terminator. Details of regions marked a, b and c by double-headed arrows are shown in
A, B and C, respectively. 'D' shows the sequence flanking the ORF after cloning into
the phagemid vector harboring a^^Bl and a//B2 site-specific recombination sites (in
bold) based on Gateway Technology. Amino acids are shown in single-letter code
below the nucleotide sequence. Restriction enzyme sites are shown above the
nucleotide.
[00020] Figure 8 shows the western blot analysis. Trypsin-untreated and trypsin-
8
treated VCSM13 and the modified helper phage AGM13 phages (1.5 x lO'^) were
separated by 10% SDS-PAGE under reducing conditions, transferred onto 0.45 \i PVDF
membranes and probed with anti-glllP MAb 30421, which targets an epitope located in
the N2 domain of glllP from the bacteriophage Ml3. (M, Prestained marker; Lanes 1-5,
1.5 X lO'" VCSM13 phages treated with 0, 0.1, 1, 10 and 100 ^ig/ml trypsin).
DETAILED DESCRIPTION OF THE INVENTION
[00021] Those skilled in the art will be aware that the disclosure described herein is
subject to variations and modifications other than those specifically described. It is to be
understood that the disclosure described herein includes all such variations and
^ ^ modifications. The disclosure also includes all such steps, features, compositions and
^ ^ compounds referred to or indicated in this specification, individually or collectively,
and any and all combinations of any or more of the steps or features.
Definitions
[00022] For convenience, before further description of the present disclosure, certain
terms employed in the specification and examples are collected here. These definitions
should be read in light of the remainder of the disclosure and understood as by a person
of skill in the art. Unless defined otherwise, all technical and scientific terms used
herein have the same meaning as commonly understood by a person of ordinary skill in
the art.
[00023] The articles "a", "an" and "the" are used to refer to one or to more than one
w ' (i.e., to at least one) of the grammatical object of the article.
[00024] The term "plurality" means more than one.
[00025] The terms "at least two," "more than one" and "plurality" are used
interchangeably.
[00026] Throughout this specification, unless the context requires otherwise the word
"comprise", and variations such as "comprises" and "comprising", will be understood to
imply the inclusion of a stated element or step or group of element or steps but not the
9
exclusion of any other element or step or group of element or steps.
[00027] The term "including" is used to mean "including but not limited to".
"Including" and "including but not limited to" are used interchangeably.
[00028] The term "glllP" means a 406 amino acid coat protein of filamentous phage
Ml 3. It gets assembled on one end of the phage during extrusion from the host with a
maximum of five copies per phage. It comprises three functionally distinct domains
namely, Nl, N2 and CT separated by glycine rich linkers.
[00029] The term ''PelBss" means pectate lyase B signal sequence.
[00030] The term "trypsin sensitive glll protein" means the glll protein that carries
^m trypsin-sensitive sites within the linker regions of glllP.
[00031] The term "trypsin-resistant glll protein" means the intact glll protein that
does not have trypsin sensitive sites within the linker regions of glllP.
[00032] The term "open reading frame (ORF)" means the part of a reading frame that
contains no stop codons.
[00033] The term "VH domain" means variable domain of the heavy chain in an
antibody.
[00034] The term "VL domain" means variable domain of the light chain in an
antibody.
^ ^ [00035] The term "amino acid sequence" means the sequence of amino acids that
^ ^ characterizes a given protein.
[00036] The term "polypeptide" means a polymer of amino acids joined together by
peptide bonds.
[00037] The term "polynucleotide" used in the present disclosure refers to a DNA
polymer composed of multiple nucleotides chemically bonded by a series of ester
linkages between the phosphoryl group of one nucleotide and the hydroxyl group of the
sugar in the adjacent nucleotide.
10
< t
[00038] The polynucleotides described in the present description include "genes" and
nucleic acid molecules described including "vectors" or "plasmids". Accordingly, the
term "gene", also called a "structural gene" refers to a polynucleotide that codes for a
particular sequence of amino acids, which comprise all or part of one or more proteins
or enzymes, and may include regulatory (non-transcribed) DNA sequences, such as
promoter sequences, which determine for example the conditions under which the gene
is expressed.
[00039] The term "nucleotide sequence" means the order in which nucleotides are
situated in a chain relative to one another.
^^ [00040] The term "heterologous" means a component that is introduced into or
^W produced within a different entity from that in which it is naturally located.
[00041] The term "heterologous polynucleotide" means a polynucleotide derived from
one organism and introduced by genetic engineering techniques into a different
organism which, if expressed, can encode a heterologous polypeptide.
[00042] The term "heterologous polypeptide" means polypeptides foieign to tlie host
cell being utilized, such as a human protein produced by £ coli. The heterologous
polypeptide may be prokaryotic or eukaryotic. It is recombinantly produced or
recombinant polypeptide.
[00043] The term "sequence identity" means the number (%) of matches in positions
from an alignment of two molecular sequences.
[00044] A "vector" is any means by which a nucleic acid can be propagated and/or
transferred between organisms, cells or cellular components. Vectors include viruses,
bacteriophage, pro-viruses, plasmids, phagemids, transposons and artificial
chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial
chromosomes), and PLACs (plant artificial chromosomes), and the like, that are
"episomes", that is, that replicate autonomously or can integrate into a chromosome of a
host cell. A vector can also be a naked RNA polynucleotide, a polynucleotide composed
11
of both DNA and RNA within the same strand, a poly-lysine-conjugated DNA or RNA,
a peptide conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that are
not episomal in nature, or it can be an organism which comprises one or more of the
above polynucleotide constructs such as agrobacterium or a bacterium.
[00045] The term "recombinant vector" means a vector carrying a foreign DNA
fragment.
[00046] The term "recombinant host cell" means a host cell carrying a recombinant
vector.
[00047] The term "recombinant phagemids" means phagemids comprising at least one
^ ^ heterologous polynucleotide inserted upstream of the polynucleotide encoding proteaseresistant
glll protein.
[00048] The term "recombinant transformants" means the transformants obtained
after infecting the host cells with recombinant phages treated with protease wherein the
protease can cleave the protease site in the modified helper phage glllp.
[00049] The terms "test sample", "sample", and "biological sample" are used
interchangeably and refer to materials obtained from a biological source, environmental
source, or a processed sample. The processed sample may include extraction of genetic
material from the sample.
[00050] The present disclosure is not to be limited in scope by the specific
^|k embodiments described herein, which are intended for the purposes of exemplification
only. Functionally equivalent products, compositions, and methods are clearly within
the scope of the disclosure, as described herein.
[00051] Phage display is a powerful technique for studying protein-ligand
interactions. Despite the incredible success of antibody and peptide libraries, the use of
phage display in cDNA libraries has been limited. This is related to the inefficient
display of proteins and peptides, due to the occurrence of stop codons and poly(A) tails
in cDNA, and insertion of the out-of-frame fragments, which means that only one of
12
every 18 clones is capable of displaying a protein that could match with the proteome.
For cDNA, the problem of stop codon and poly(A) tails can be overcome by using
randomly primed libraries; however, the reading frame problem persists, which also
hampers the use of gene fragments from a non-intron genome.
[00052] In accordance with the present disclosure, in one of the embodiments, there is
provided an improved process of constructing a phage display library enriched for
recombinant phages having an open reading frame (ORF) or in-frame protein-encoding
DNA fragments comprising:
a. providing a population of recombinant phagemids comprising at least
^ ^ one heterologous polynucleotide inserted upstream of polynucleotide
^ ^ encoding protease-resistant glll protein;
b. introducing the population of recombinant phagemids into host cells to
obtain transformants;
c. infecting the transformants with a modified helper phage to obtain a
population of recombinant phages displaying heterologous protein and
displaying no heterologous protein; wherein, the modified helper phage
comprises at least one protease cleavage site in polynucleotide encoding
glll protein;
d. treating the population of recombinant phages with a protease wherein
the protease can cleave the protease site in recombinant phage glllp to
^(F obtain treated recombinant phages;
e. infecting host cells with treated recombinant phages from step (d) to
obtain recombinant transformants;
f rescuing the recombinant transformants from step (e) with a helper phage
to obtain a phage display library enriched with heterologous in-frame
protein-encoding DNA fragments (ORPs), wherein display of the
heterologous protein is indicative of in-frame protein-encoding DNA
13
fragments. The helper phage in step (f) can be either protease-sensitive
or protease-resistant in the nucleotide encoding glllp. In the process of
the present disclosure, the phages displaying no heterologous protein are
not infectious which leads to a construction of an ORF-enriched library.
The protease resistant site in the phagemid and the protease cleavage site
in the modified helper phage are for the same protease.
[00053] In another embodiment of the present disclosure, the process further
comprises multiplying the recombinant phages having in-frame protein-encoding DNA
fragments after library construction.
^ ^ [00054] In yet another embodiment of the present disclosure, the recombinant
^ ^ phagemids from step (a) optionally comprises a protease cleavage site between the
heterologous polynucleotide and the polynucleotide encoding protease resistant glll
protein. The protease is selected from the group consisting of trypsin, collagenase and
TEV protease.
[00055] In another embodiment of the present disclosure, the phage is filamentous
phage. In an embodiment of the present disclosure, the filamentous phage is selected
from the group consisting of Ml3, Fl and Fd. The experiments provided in this
disclosure are with filamentous phage Ml3, however, a person skilled in the art can
perform the experiments with any other filamentous phage.
[00056] In yet another embodiment of the present disclosure, the modified helper
^ p phage is protease sensitive. The protease cleavage site is present in the linker regions
between Nl, N2 and N2, CT domains of the polynucleotide encoding glll protein. The i
protease is selected from the group consisting of trypsin, collagenase and TEV protease.
In an embodiment of the present disclosure, the modified helper phage is AGM13
which has a trypsin cleavage site in the linker regions between Nl, N2 and N2, CT
domains of the polynucleotide encoding glll protein. In another embodiment of the
present disclosure, the trypsin cleavage site is provided by an amino acid sequence as
set forth in SEQ ID NO: l.The experiments provided in this disclosure are with trypsin,
14
• 1
however a person skilled in the art can perform the experiments with any other protease
such as collagenase and TEV protease.
[00057] In an embodiment of the present disclosure, the recombinant phages are
treated with protease wherein the protease is selected from the group consisting of
trypsin, collagenase and TEV protease.
[00058] In yet another embodiment of the present disclosure, the heterologous
polynucleotides is selected from the group consisting of genomic DNA and cDNA
obtained from different organisms and the organism is selected from the group
consisting of bacteria, virus, animal and plant. In an embodiment of the present
^ . disclosure, the heterologous polynucleotides is selected from the group consisting of
^ ^ cDNA, amplified DNA fragments, PCR amplified DNA fragments, DNA encoding
antibodies, gene sequences, "scFv", cloned DNA fragments, random sequences, and
synthetic DNA.
[00059] In another embodiment of the present disclosure, the host cell is a bacterial
cell. In yet another embodiment of the present disclosure, the host cell is E. coli.
[00060] In another embodiment of the present disclosure, there is provided a kit for
cloning DNA fragments and selecting for heterologous in-frame protein-encoding DNA
fragments comprising; a phagemid vector with protease-resistant glll protein, a
modified helper phage (AGM13) having at least one protease cleavage in the
polynucleotide encoding glll protein of the phage, bacterial strains and protease.
^r [00061] In yet another embodiment of the present disclosure there is provided a kit for
cloning DNA fragments and selecting for heterologous in-frame protein-encoding DNA
fragments, wherein the protease cleavage site in the modified helper phage (AGM13) is
present in the linker regions between Nl, N2 and N2, CT domains of the polynucleotide
encoding glll protein. The experiments provided in this disclosure are conducted with
Ml3 filamentous phage and trypsin, however, a person skilled in the art can perform the
experiments with any other filamentous phage and any protease.
' 15
[00062] In another embodiment of the present disclosure, there is provided a process
of selection of functional antibody fragments or in-frame antibody fragments
comprising:
a. amplification of VL and VH domains and splicing together with a linker to
produce "scFv" fragment; wherein the VH and VL domains are amplified
selected from group a consisting of cloned DNA using two sets of
conserved primers and synthetic DNA encoding VL and VH domains;
b. cloning the "scFv" fragment upstream of the polynucleotide encoding
protease-resistant glllP phagemids to produce a population of
recombinant phagemids;
^ c. imroducing .he population of recombinant phagentids into Itost cells to
obtain transformants;
d. infecting the transformants with a modified helper phage to obtain a
population of recombinant phages displaying funcfional "scFv" and
other displaying non-functional "scFv" containing aberrant chain;
wherein the modified helper phage comprises at least one protease
cleavage site in the polynucleotide encoding glll protein;
e. treating the population of recombinant phages with a protease; wherein
the protease can cleave protease in the modified helper phage to obtain
treated recombinant phages;
f infecting the host cells with the treated recombinant phages from step (e)
^ ^ to obtain recombinant transformants;
g. obtaining the recombinant transformants displaying the in-frame
functional "scFv" fragments that remain infectious and the recombinant
phages displaying non-functional "scFv" containing aberrant chain are
not infectious; wherein display of the functional "scFv" fragments is
indicative of in-frame fianctional antibody fragments.
[00063] In yet another embodiment of the present disclosure, the recombinant
phagemids optionally comprises a protease cleavage site between the cloned "scFv" and
16
the polynucleotide encoding protease resistant glll protein. The protease is selected
from the group consisting of trypsin, collagenase and TEV protease. The experiments
provided in this disclosure are with trypsin, however a person skilled in the art can
perform the experiments with any other protease such as collagenase and TEV protease.
[00064] In another embodiment of the present disclosure, the phage is filamentous
phage. In an embodiment of the present disclosure, the filamentous phage is selected
from the group consisting of Ml3, Fl and Fd. The experiments provided in this
disclosure are with filamentous phage Ml3, however, a person skilled in the art can
perform the experiments with any other filamentous phage.
^ ^ [00065] In yet another embodiment of the present disclosure, the modified helper
^ ^ phage is protease sensitive. The protease cleavage site is present in the linker regions
between Nl, N2 and N2, CT domains of the polynucleotide encoding glll protein. The
protease is selected from the group consisting of trypsin, collagenase and TEV protease.
In an embodiment of the present disclosure, the modified helper phage is AGM13
which has a trypsin cleavage site in the linker regions between Nl, N2 and N2, CT
domains of the polynucleotide encoding glll protein. The experiments provided in this
disclosure are conducted with Ml3 filamentous phage and trypsin, however, a person
skilled in the art can perform the experiments with any other filamentous phage and any
protease.
[00066] In an embodiment of the present disclosure, the protease is selected from the
^ ^ group consisting of trypsin, collagenase, and TEV protease. In yet another embodiment
of the present disclosure, the protease cleavage site is present in the linker regions
between Nl, N2 and N2, CT domains of the polynucleotide encoding glll protein. In
another embodiment of the present disclosure, the trypsin cleavage site is provided by
an amino acid sequence as set forth in SEQ ID NO: 1.
[00067] In another embodiment of the present disclosure, the host cell is a bacterial
cell. In yet another embodiment of the present disclosure, the host cell is E. coli.
[00068] The present disclosure describes an improved process of constructing phage
17
• •
display library enriched for recombinant phages having in-frame protein encoding DNA
fragments, by employing a modified helper phage, comprising at least one trypsin
cleavage site in the linker regions between Nl, N2 and N2, CT domains of
polynucleotide encoding glllP. The modified helper phage of the present disclosure is
AGM13 which comprises two trypsin cleavage sites in the linker regions between Nl,
N2 and N2, CT domains of polynucleotide encoding glllP.
[00069] Figure 1 shows the schematic representation of glllP encoded by the
modified helper phage (AGM13) and VCSM13. The Nl, N2 and CT domains of the
coat protein glllP are are joined by the linkers LI and L2. (A) A four-amino acid
'KDIR' (SEQ ID NO: 1) trypsin cleavage site was introduced into both LI and L2
^ j p linkers in the modified helper phage AGM13, to encode trypsin-sensitive glllP. (B)
VCSM13 is the wild-type helper phage without any trypsin cleavage sites, which
encodes a trypsin-resistant glllP. The 'KDIR' amino acid sequence was inserted after
residue 70 of glllP in LI (shown in bold in A) and replaced four amino acids between
residues 239-242 of glllP in L2 (shown in bold in B).
[00070] The modified helper phage (AGMI3), as described in the present disclosure,
has unique applications due to the incorporation of trypsin cleavage sites in between
both the flexible linkers present in Nl, N2 and N2, CT domains of glll protein. As a
result, the modified helper phage (AGM13) encodes for a trypsin-sensitive glllP and
treatment with 10|ag/ml of trypsin reduces the phage infectivity by several orders of
^1^ magnitude due to the cleavage of this glllP. w
[00071] Figure 2 shows the western blot analysis of the modified helper phage
(AGM13) and VCSM13 phage samples treated with different concentrations of trypsin.
Aliquots equivalent to 1.5 x 10^" trypsin-untreated and -treated phages were separated
by 10% SDS-PAGE under reducing conditions, transferred onto 0.45 |i PVDF
membranes and probed with polyclonal antibodies against bacteriophage Ml3. (M:
Prestained marker; Lanes 1-5: 1.5 x lO"* AGM13 phages treated with 0, 0.1, 1, 10 and
100 ng/ml trypsin, respectively; Lane 6: empty; Lanes 7-11: 1.5 x 10'° VCSM13 phages
18
treated with 0, 0.1, 1, 10 and 100 fig/ml trypsin, respectively).
[00072] The process of constructing a phage display library enriched for recombinant
phages having in-frame protein encoding DNA fragments (ORFs) as described in the
present disclosure employs a modified helper phage (AGM13) to produce genome scale
open reading frames (ORF)-enriched libraries of gene or genomic fragments cloned in
glllP-based phage display vector. The improved process as described in the present
disclosure has been employed for the efficient cloning of functional variable domain of
the light chain and the heavy chain from the hybridoma in the presence of aberrant
kappa light chain. The improved process as described in the present disclosure has been
employed for estimating the display density by determining the number of phages
^ P displaying a phagemid-encoded foreign protein.
[00073] Figure 4 shows the process of open reading frame (ORF) selection using the
AGM13 helper phage. The gene-fragment library of Mycobacterium tuberculosis was
constructed in a phagemid vector by inserting the fragments between the PelB signal
sequence and full length native glllP, and transformants (COl, primary unselected
library) are obtained in E. coli TOPI OF', (i) The COl cells are used for producing
phages using the modified helper phage AGM13, which has a trypsin cleavage site (T)
in the linker regions between the Nl and N2, and N2 and CT domains of glllP. During
rescue, three types of phages are produced: A, Phages displaying protein matching with
the Mycobacterium tuberculosis proteome (genie clones) expressed as fusion protein
t with full length trypsin-resistant glllP; B, phages displaying protein not matching with
the M. tuberculosis proteome (non-genic clone) but expressed as fusion protein with full
length trypsin-resistant glllP. C, phages not displaying any protein as the insert is outof-
frame with the signal sequence and trypsin-resistant glllP, which carry only
AGM13-encoded trypsin-sensitive glllP. (ii) Trypsin treatment of the phage population
renders non-displaying phages (type C) non-infectious, while A and B become fully
infectious due to removal of the displayed protein by cleavage of the trypsin site present
between glllP and the fusion partner. Subsequent infection of the trypsin-treated library
19
produces ORF-selected transductants (C02). (iii) Upon rescue with the modified helper
phage (AGM13) or any other helper phage, the C02 transductants produce ORFselected
phages displaying protein, which could be from genie or non-genic DNA
sequences.
[00074] In the improved process as described in the present disclosure, there is no size
bias observed in ORP-enrichment and the same insert size distribution is observed in
POl and P02 libraries (Figure 4). This is because trypsin treatment of POl phages (ORFunselected
primary phages) not only destroys the AGM13-encoded glllP, but also
makes the trypsin-resistant glllP fusion protein fully infectious by removing the
displayed peptide/protein. Thus, the transductants of ORF-selected phages (C02) are
^ ^ produced with equal efficiency, irrespective of the size of the inserts. Unlike the Plactamase
selection system, no re-cloning step is involved in the system described in the
present disclosure.
[00075] The improved process of constructing a phage library results in ORF
enrichment of the recombinant phages as described in the present disclosure eliminates
internal start site clones and facilitates the generation of large and highly diverse ORFselected
phage libraries without any change in the average size distribution of the
clones, and can be directly employed for affinity selection procedures to select binding
ligands.
[00076] The improved process using the modified helper phage AGM13 offers
^ ^ additional advantages during affinity selection and elution of bound phages with trypsin
as only specific binders would remain infectious after elution with trypsin, whereas
non-specific phages would become non-infectious.
[00077] The present disclosure provides an improved process of producing genome
scale open reading frames (ORF)-enriched libraries of gene or genomic fragments,
wherein the foreign DNA to be displayed is cloned in a phagemid vector between the
signal sequence and the wild type trypsin-resistant glllP. There is also a trypsin site
located just before the first codon of wild type glllP in the phagemid vector, which
20
results in conversion of phagemid encoded trypsin resistant glllP fusion protein into
trypsin resistant glllP with full infectivity upon trypsin treatment. Thus, upon rescue of
the phagemid-bome DNA fragment library with a modified helper phage (AGM13)
having trypsin cleavage site in the glllP site, the in-frame clones encode trypsinresistant
glllP fusion protein, which gets incorporated into the phages, along with other
copies of helper phage AGM13-encoded trypsin-sensitive glllP. On the contrary, the
clones harboring out-of-frame inserts produce phages carrying only trypsin-sensitive
glllP. Treatment of such phage display library with trypsin renders the phages produced
by clones with out-of-frame inserts non-infectious, whereas the phages rescued from
clones having in-frame inserts remain fully infectious due to the presence of at least one
^ ^ copy of trypsin-resistant glllP. As a result, the transductants of a trypsin-treated library
only carry clones with in-frame inserts and thereby result in ORF-enriched phage
library.
[00078] The modified helper phage AGM 13, as described in the present disclosure
can be used for selecting functional antibody fragments (in-frame) in the presence of
hybridoma derived out-of-frame aberrant kappa light chain. This unique application is
based on the premise that a single chain Fv ("scFv") comprising of functional variable
domains of the light chain (VL) and heavy chain (VH) from a hybridoma would be inframe
with the glll of a phagemid display vector, whereas a "scFv" comprising of
functional VH, but the VL derived from an hybridoma-generated aberrant kappa light
chain transcript would be out of frame due to the deletion of 4 bases in CDR3 region
^ ^ that results in frame shift and a termination codon (TAA) at position 105 of VL
(according to kabat numbering system). Therefore, PCR amplification of VL and VH
from hybridoma-derived RNA (cDNA), and their cloning to assemble "scFv" in a
trypsin-resistant glllP-based phagemid display vector would generate two types of
clones, one carrying functional "scFv" (in-frame clone) and the other carrying nonfunctional
"scFv" containing the aberrant chain (out-of-frame clone). The trypsin
treatment of AGM 13-rescued phages from such a library will render phages displaying
non-functional aberrant VL containing "scFv" non-infectious, while those displaying
21
• >
functional "scFv" will remain infectious and be selected by infecting E. coli cells. This
concept was tested for rapid cloning of the functional "scFv" from hybridoma that
showed the presence of aberrant chain (as tested by aberrant chain-specific primers,
abVKl and abVK2 based on CDRl and CDR3 of kappa aberrant chain, respectively, to
produce a 206 bp product (Duan et al. Nucleic Acids Research, 1994, 22(24): 5433-
5438).
[00079] The use of the modified helper phage (AGM13) for genome-scale ORF
selection as described in the present disclosure is expected to facilitate the construction
of randomly primed cDNA libraries in glllP-based M13 vectors. Such ORF-selected
libraries could then be subcloned into an expression vector to produce the whole
^ p proteome in a test tube. These ORF-selected libraries could be transferred to an
eukaryotic expression vector and be used for DNA immunization. The technology of
genome-wide ORF selection would be of immense value for the identification of
vaccine candidates using techniques such as proteomic-based expression library
screening and in vivo induced antigen technology [IVIAT], both of which currently
require the cloning of randomly fragmented gene inserts into inducible expression
vectors. After ORF selection with AGM13, the inserts could be transferred into yeast
two-hybrid vectors for protein-protein interaction studies or to another phage display
system for high-density display. The libraries described in the present disclosure have
been constructed by incorporating features of non-enzymatic recombinational transfer.
^ [00080] The modified helper phage AGM13-based ORF enrichment technique
^ ^ described in the present disclosure eliminates internal start site clones and facilitates the
generation of large and highly diverse ORF-selected phage libraries without any change
in the average size distribution of the clones, and can be directly employed for affinity
selection procedures to select binding ligands.
[00081] The modified helper phage AGMI3 allows selection of open reading frames
(ORFs) with high efficiency in three simple steps. The use of AGM 13 results in
efficient selection functional "scFv" from hybridoma despite the presence of aberrant
22
kappa chain transcripts. Further, AGMI3 also allows accurate estimation of
incorporation of phagemid-encoded glllP in the rescued phages. Thus, AGM13
provides a simple method for determining the true display density and serve as a useful
tool for understanding the reasons for poor display of phagemid-encoded glllP fusion
protein. It has a wide range of applications in the production of ORF-enriched phage
displayed cDNA gene fragment and antibody libraries.
[00082] The ORF-enriched pahge display library as described in the present
disclosure can be used to select binders to antibodies, proteins, peptides, small
molecules, cell surfaces, to study interactions with proteins, carbohydrates, lipids, DNA
or RNA, cells or viruses. It can also be used to identify biomarkers, prognostic markers,
^[p isolate auto-reactive antibodies from serum and produce whole genome antibodies.
[00083] The ORF-enriched DNA fragments can be used for making expression
libraries in various hosts including bacterial and mammalian. The ORF-encoding
sequences can be used as domain libraries to study domain structure and function.
EXAMPLES
[00084] The disclosure will now be illustrated with working examples, which is
intended to illustrate the working of disclosure and not intended to take restrictively to
imply any limitations on the scope of the present disclosure. Unless defined otherwise,
all technical and scientific terms used herein have the same meaning as commonly
understood to one of ordinary skill in the art to which this disclosure belongs. Although
^ ^ methods and materials similar or equivalent to those described herein can be used in the
practice of the disclosed methods and compositions, the exemplary methods, devices
and methods are described herein.
Materials
Escherichia coli strains TOPI OF' (F' [lacP TnIO {tet^)] mcrk A(mrr-hsdRMS-mcrBC)
(p80/acZAM15 A/acX74 deoR nupG recAX araDU9 A{ara-leu)1691 galV galK
rpsL(Str^) endAl X) and TGI {[F', traD36proAB* lacf lacZAM\5] supE thi-\ A{lac-
23
proKB) A(/wcrB-/25c/SM)5, (rK"mK")]} were obtained from commercial sources (Life
Technologies Corporation, Carlsbad, USA). MAb 2911 and 30421 are monoclonal
antibodies produced in-house against the gVIIIp and glllP coat protein of Ml3 phage.
MAb Ag85-12 and MAb 1912 are monoclonal antibodies produced in-house against
Ag85B (Rvl886c) and 19KDa (Rv3763) proteins of M. tuberculosis. Trypsin was
purchased from Sigma Chemical Co. (Sigma, St Louis, MO, USA); Sepharose CL-6B
was purchased from GE Healthcare (GE-Amersham Health Science, Uppsala, Sweden).
MAbl905 is a monoclonal antibody produced in-house against a 19 kDa M
tuberculosis antigen encoded by the gene Rv3763. The MPT64 antigen, a histidinetagged
recombinant protein encoded by the Mycobacterium tuberculosis gene Rv 1980c,
^ ^ was produced in E. coli and purified to homogeneity by affinity chromatography. In
different formats, 33 "scFv" is a single chain antibody fragments derived from genes
encoding the variable domains of MAb 33 against the Mycobacterium tuberculosis
protein MPT64; the fragments were displayed fused to full-length glllP using a
phagemid-based vector. The polyclonal antibody to Ml3 phage was produced by
commercial service provider (Bangalore Genei Pvt. Ltd., India) and was obtained from
the serum of a rabbit immunized with purified Ml3 phages obtained after cesium
chloride density centrifugation.
Example 1
Construction of AGM13 helper phage
M^ [00085] The sequence encoding a trypsin cleavage site as set forth in amino acid
sequence SEQ ID NO: 1 (KDIR) was introduced into the helper phage VCSM13
(Agilent Technologies, Texas, USA) by site-directed mutagenesis using Kunkel's I
method (Kunkel TA, Proceeding of the National Academy of Science, 1985, 82: 488-
492)
[ [00086] The oligonucleotide 5'-
AGCCACCACCCTCAGAGCCGCCACCACGAATATCTTTAGAGCCGCCGCCGG
CATTGACAGG-3' (SEQ ID NO: 2) was used to insert the codons for KDIR within the
24
two linker regions of glllP. Following in vitro second strand synthesis, the mutagenesis
mixture was electroporated in E. coli TGI and plated to obtain plaques. The plaques
were suspended in 100 ^1 NET buffer (0.15 M NaCl in 20 mM Tris pH 8.0, containing
1 mM EDTA) and used as a template for PCR to amplify the glllP coding sequence.
The presence of the KDIR sequence was confirmed by sequencing the amplified
product. The selected clones were grown to produce phages by infecting log-phase E.
coli TGI and the cell free supernatant was used for phage titration. One of the clones
was cultured in a large volume to obtain phages, which were purified by PEG-NaCl
precipitation and Sepharose CL-6B column chromatography as described below.
Phage production and purification
^ ^ [00087] To prepare AGM13 stock, E. coli TGI cells were grown to a mid-log phase
(OD600 = 0.5). Cells of 100 \A were infected with 100 \A dilution of helper phage and
incubated at 37°C for 30 min. Cultures were mixed with LB soft agar and poured on LB
plates. Plates were incubated overnight at 37°C. Plaques were counted to determine the
number of plaque-forming units (PFUs). A plaque of AGM13 was mixed with 2 ml log
phase E. coli TGI cells and grown at 37°C for 30 min with no shaking followed by 1 hr
at 37°C with shaking at 100 rpm. The TG1-AGM13 mixture was then diluted in 200 ml
2x YTK (2x YT medium containing 50 i^g/ml kanamycin) and grown at 37°C with
shaking at 200 rpm for 16 hr. The supernatant was harvested by two successive
centrifugation cycles (23,434g for 10 min at 4°C). The phage particles were precipitated
^H. from the supernatant by incubating with 0.15 volume of 16.67% polyethylene glycol
^ (PEG 6000-8000) / 3.3 M NaCl for 4 hr at 4°C followed by centrifugation at 23,440g
for 30 min at 4°C. The precipitated phages were resuspended in NET buffer and
centrifuged at 26,900g for 10 min at 4°C to remove the insoluble material. The phage
particles in the clear supernatant were finally purified on a 10 ml Sepharose CL-6B
column. The phage supernatant (3 ml) was loaded onto column equilibrated with NET
buffer and flow through was discarded. NET buffer of 0.2 ml was added in the column
and eluate was discarded. Finally, the phages were eluted using 3.8 ml NET buffer. The
25
phage titre was determined as PFU by infecting log phase E. coli TGI. AHquots of
purified phages were stored at -20°C.
Phage quantification and reactivity determination by ELISA
[00088] The wells of 3 84-well MaxiSorp™ microtitre ELISA plates (Nalge Nunc
IntT, New York, USA) were coated with 25 ^1 of anti-gVIIIp MAb (2911 IgG), antiglllP
MAb (30421 IgG), MPT64 antigen or MAb 1905, all diluted to 2 |ig/ml in
phosphate buffered saline (PBS). After blocking with 2% non-fat dry milk, serial
dilutions of purified phages rescued with either AGM13 or VCSM13 (3 x 10^ - 3 x
lOVml for the MPT64 antigen and MAb 1905 plates, and 1 x 10^- 1 x lOVml for anti-
Ml3 MAb plates) were added to the coated wells and incubated for 1 hr at room
^ ^ temperature. After washing, the bound phages were detected with HRP-conjugated antigVIIIp
MAb 2911. The plates were washed, developed with 3,3',5,5'-
tetramethylbenzidine (TMB) as a substrate, and absorbance was determined at 450 nm
using an ELISA plate reader (SpectraMax M5; Molecular Devices, Sunnyvale, CA,
USA).
Assay of helper phage trypsin sensitivity and immunoblotting
[00089] Purified phage particles of AGM13 and VCSM13 (2 x lO'^; as estimated by
the plaque-forming units [PFU] assay) were incubated in total volume of 1.0 ml with
different concentrations of trypsin (0, 0.1, 1.0, 10, 100 |J.g/ml) in PBS for 30 min at
37°C. The phage suspensions were immediately used for titration with E. coli TOPI OF'
^ g to score the number of PFU. Separately, for western blot analysis, 1.5 x lO'" trypsintreated
phages were electrophoresed under reducing conditions on 10% SDS-PAGE,
followed by electroblotting onto 0.45 i^ PVDF membranes (Immobilon; Millipore,
Bedford, MA, USA). After blocking, the blots were probed with mouse anti-glllP MAb
(30421) and a rabbit polyclonal antibody against whole Ml3 phage, followed by HRPconjugated
goat anti-mouse and goat anti-rabbit IgG (H+L) antibodies (Jackson
Immuno-Research Laboratories, West Grove, PA, USA), respectively, and the bands
were visualized using 3,3'-diaminobenzidine (DAB) as a substrate.
26
Phagemid display vector and gene fragment libraries
[00090] The high copy number phagemid vector pVCEPI23964 (Figure 7) has a
backbone derived from pUC119 and carries (under the control of lacFO between
Hindlll and EcoRl sites) a DNA cassette comprising a Xbal site, ribosome binding site
(RBS), pectate lyase B signal sequence (PelBss), 1.8 kb stuffer flanked by unique
restriction sites followed by the codons for a trypsin cleavage site (SEQ ID NO: 1,
KDIR) and full length glllP (2-405 codons), with appropriate spacers comprising
glycine and serine residues. The gene fragments were inserted in place of the 1.8 kb
stuffer using a restriction enzyme-free cloning strategy. The vector backbone further
comprises the ColEl origin of replication (Ori), the wild-type filamentous phage origin
^ P of replication (fori) and the P-lactamase gene as a selection marker. The lac?0 is
preceded by a tHP transcriptional terminator from the glutamine permease operon
{glnHPQ) ofE. coli (Krebber et al., Journal Of Immunological Methods, 1997, 201: 35-
55)
[00091] Two gene fragment libraries containing fragments of 100-300 bp and 300-800
bp from the Mycobacterium tuberculosis genome were constructed by ligating three
molar excess of the fragments with 2 \ig of the vector pVCEPI23964, for display of the
encoded proteins fused to full-length glllP. The entire ligated sample was
electroporated in E. coli TOPI OF' cells (50 electroporations), regenerated in SOC
medium for 1 hr, and then plated on one hundred 150 mm plates containing LBAmpGlu
^l|. (LB agar containing 100 ng/ml ampicillin and 1% w/v glucose). The grown cells were
cultured overnight, scraped into 2x YT mixed with glycerol storage solution (65%
glycerol, 0.1 M Tris pH 8.0, 25 mM MgS04) and stored at -80°C labeled as COL The
library size was determined by plating a dilution of regenerated cells on LBAmpGlu
plates. The libraries were named MTBLIB25 for the 100-300 bp fragments and
MTBLIB27 for the 300-800 bp fragments.
Production of phages from primary transformants
[00092] An aliquot of pooled transformants (COl) containing 2.5 x 10*^ cells was
27
diluted in 200 ml of 2x YTG (2x YT containing 1% w/v glucose) and grown at 37°C
with shaking at 200 rpm to an ODeoonm of 0.1-0.2. Ampicillin was added to a final
concentration of 100 i^g/ml, followed by growth at 37°C with shaking at 220 rpm until
the ODeoonm reached 0.4-0.5. At this point, the culture was maintained with slow
shaking at 100 rpm for 30 min, and then 50 ml culture (-2.5 x lO"* cells) was infected
with helper phage AGM13 at multiplicity of infection (MOI) of 20 (5.0 x lO" phages).
The culture was kept at 37°C without shaking for 30 min, followed by shaking at 100
rpm for 1 h at 37°C. The infected culture was diluted 10-fold in 2x YTAK (2x YT
medium containing 100 ng/ml ampicillin and 50 |J.g/ml kanamycin) and grown at 32°C
with shaking at 220 rpm for 16 hr. The phages were harvested from the culture
^ ^ supernatant, and purified by PEG-NaCl precipitation followed by column
chromatography, as described above. The phage titre was determined as the number of
colony-forming units (CFU) by infecting log-phase E. coli TOPI OF' cells. The phage
libraries of 100-300 bp and 300-800 bp were named MTBLIB25P01 and
MTBLIB27P01, respecfively.
Selection of clones with open reading frames by trypsin treatment
[00093] To optimize the trypsin treatment of primary library phages (POl), 1 x lO"
purified phage particles were diluted in PBS, incubated with 0, 10, 100 and 200 |ag/ml
trypsin in a total volume of 1.0 ml at 37°C for 30 min, then the phage titre was
determined as the number of Amp'^ transductants on E. coli TOPI OF'. The transductants
^k obtained were analyzed by colony PCR using the 5' primer M13R (5'-
^ AGCGGATAACAATTTCACACAGGA-3') (SEQ ID NO: 3) and 3' primer U251 (5'-
AGTTTTGTCGTCTTTCCAGACGT-3') (SEQ ID NO: 4). The PCR products obtained
were sequenced using M13R and U251 primers by ABI PRISM dye terminator cycle
sequencing ready reaction kit on Applied Biosystems 3730 automated sequencer.
[00094] For ORF selection, 1 x 10 purified phages from the primary library (POl)
were treated with 10 \iglm\ trypsin in a total volume of 1.0 ml for 30 min at 37°C.
Trypsin-treated phages were used to infect 1 x 10^ TOPI OF' cells (grown to ODeoonm
28
j
0.4-0.5) at 37°C for 30 min without shaking, followed by slow shaking at 100 rpm for
30 min at 37°C. The infected cells were pelleted by centrifugation at 1500 g at room
temperature (23-25°C) for 5 min, washed twice with 5 ml of 2x YTAG (2x YT medium
containing 100 |ag/ml ampicillin and 1% w/v glucose) to ensure complete removal of
trypsin, re-suspended in 20 ml 2x YTAG, plated on twenty 150 mm LBAmpGlu plates
and grown overnight. The colonies were scraped into 30 ml 2x YT, stored at -80°C in
glycerol storage solution and labeled MTBLIB25C02 and MTBLIB27C02 for ORFselected
transductants of 100-300 bp and 300-800 bp, respectively.
[00095] The phage libraries were rescued from 1.0 x lO'" cells of the ORF-selected
transductants (C02) using AGM13 as described above and labeled as MTBLIB25P02
^ and MTBLIB27P02 for the ORF-selected phage libraries of 100-300 bp and 300-800
bp, respectively. PCR analysis and DNA sequencing were used to screen for
recombinant clones. The nucleotide and protein sequences of the recombinants were
analyzed using BLASTn or BLASTp (NCBI) and aligned to the Mycobacterium
tuberculosis genome.
Affinity selection protocol
[00096] For panning of the whole genome-fragment libraries on MAbs, test wells
were coated with 2 \iglm\ of MAb Ag8512 (Ag85A and Ag85B specific) or MAb 1912
(19 KDa specific) antibodies, or buffer PBS (Control wells) and incubated at 4°C
overnight. After blocking with 2% PBSTB (PBS buffer containing tween 20 and 2%
^K bovine serum albumin), purified phages (1x10^ phages per well of MTBLIB25 and
MTBLIB27 libraries) were added to each well, incubated at 37°C for 1 h and unbound i
phages removed by washing. For both the libraries, the captured phages were eluted
using low-pH buffer, 0.2 M glycine-HCl, pH 2.2 and determined as the number of
colony-forming units (CFU) by infecting log-phase E. coli TOPI OF' cells. To amplify
phages for the next round of panning, ToplOF' cells were infected at MOI of 0.1 with
phages eluted above by incubating cells with phages at 37°C for 90 min. The infected
cells were pelleted by centrifugation at 1500 g at room temperature (23-25°C) for 5 min
29
and re-suspended in 20 ml 2x YTG. The culture was processed as described above for
the production of phages from primary transformants.
[00097] For the second round of panning, 1 x 10 amplified phages were used and
panning was carried out as described above for the first round. The eluate of second
panning (Pan II eluate) was used to determine titre of phages in eluate and was
amplified further for the third round of panning (Pan III eluate).
Design and characteristics of the trypsin-sensitive helper phage AGM13
j
I
[00098] To create the modified helper phage AGM13, expressing glllP with trypsin
cleavage sites (trypsin-sensitive glllP), the sequence encoding the four amino acids
^k. KDIR (SEQ ID NO: 1) was introduced within the two linkers (LI and L2) between the
domains of glllP in the phage VCSM13 by site directed mutagenesis (Figure 1). The
four amino acid sequence was inserted after amino acid 70 in LI between the Nl and
N2 domains, and also replaced the four amino acids at 239-242 in L2 between the N2
and CT domains of wild-type glllP. Table 1 shows the yield of AGM13 and VCSM13 i
phage particles in E. coli TGI cells was comparable, with titres of 2 x 10"/ml. AGM13
phages were highly sensitive to trypsin; treatment with 0.1 |-ig/ml trypsin reduced the
titre of infectious phages by 6 orders of magnitude, and by an additional 3 orders of
magnitude at 10 |ag/ml, indicating that the trypsin cleavage sites in glllP were fully
exposed. In contrast, VCSM13 remained fully infectious, even after incubation with 100
l^g/ml trypsin, while AGM13 was non-infectious at this concentration.
^ [00099] Purified phages (2 x lO'^) were treated with trypsin in total volume of 1.0 ml
for 30 min at 37°C. The phages were titrated by infecting E. coli TGI and the numbers
of PFU were scored.
Table 1: Trypsin sensitivity assay
Trypsin concentration PFU/ml
^^^^"^^^ AGM13 VCSM13
30
0.0 4.6x10'^ 5.4x10'^
0.1 3.4x10^ 3.2x10'^
1.0 2.6x10^ 3.0x10'^
10.0 2.6x10^ 2.2x10'^
100.0 0 1.6x10'^
I 1 1 1
[000100] Furthermore, Western blot analysis using polyclonal antibodies against Ml3
phage particles (Figure 2) revealed that more than 50% of the glllP expressed by
AGM13 was cleaved upon treatment with 0.1 |Jg/ml trypsin, releasing an approximately
^ ^ 50 kDa immunoreactive band. This band probably corresponds to the N2-CT fragment
(Fig. 2, Lane 2), as the same band was also detected using a monoclonal antibody
against glllP that recognizes an epitope located in the N2 domain (Fig. 8, Lane 2). At
higher concentrations of trypsin, the full-length glllP band, as well as the N2-CT band,
disappeared completely (Figure 2, Lanes 3-6). Bioinformatic analysis identified
multiple putative trypsin cleavage sites within glllP, which probably became exposed
after initial cleavage of the KDIR sequences in the glllP of AGM13, resulting in total
degradation of glllP and loss of phage infectivity. The glllP of VCSM13 remained
unaffected even when incubated with 100 |ag/ml trypsin, suggesting that the putative
trypsin sites are not exposed in wild-type glllP (Figure 2, Lanes 7-11). Figure 3 shows
the titre and reactivity of phages rescued by AGM13 and VCSM13. (A) The phagemid
gk clones rescued with AGM13 and VCSM13 were titrated on E. coli TGI and scored as
the number of ampicillin-resistant Amp^ transductants (CFU/ml); 3301 "scFv" is an
antibody fragment specific to the protein MPT64 encoded by the M. tuberculosis gene
Rv 1980c; 19 kDa antigen is encoded by the M. tuberculosis gene Rv3763; and MAb
1905 is a monoclonal antibody against the 19 kDa antigen. Phage production from a
phagemid vector for glllP display using AGM13 was comparable to that using
VCSM13, when scored as the number of ampicillin-resistant (Amp"^) transductants for
two different displayed molecules, namely a single chain fragment variable ("scFv")
31
and 19 kDa protein (Figure 3 A). (B) Different dilutions of rescued phages were added
to Maxisorb^'^ plates coated with MPT64 (for 3301 "scFv"-displaying phages) or MAb
1905 (for 19 kDa antigen-displaying phages). The bound phages were detected using a
HRP conjugated anti-phage MAb. Values are mean ± SD of three independent
experiments. Moreover, using a phage ELISA to estimate the functional activity of the
displayed molecules, the phages rescued by the modified helper phage AGM13 had
comparable reactivity to the phages produced by VCSM13 (Figure 3B). These results
clearly demonstrated that incorporation of the trypsin cleavage sites did not alter the
"helper" properties of the phage AGM13.
AGM13 enables efficient selection of ORF bearing phages
^ ^ [000101] The rationale of the trypsin-sensitive helper phage AGM13 (modified helper
phage) for ORF selection is based on the premise that once a DNA fragment is cloned
in between the signal sequence and the coding sequence of trypsin-resistant glllP in a
phagemid vector, trypsin-resistant glllP fusion proteins will only be produced by clones
in which the cloned DNA fragment is in-frame with both the signal sequence and glllP
(in-frame clones), since a complete fusion protein with both a signal sequence and glllP
is required for periplasmic export and incorporation into the extruding phages.
Therefore, upon phage rescue with the modified helper phage AGM13, the in-frame
phagemid clones would produce phages expressing a fusion moiety with phagemidderived
trypsin-resistant glllP along with some copies of trypsin-sensitive glllP
^ 1 ^ supplied by AGM13. In contrast, clones carrying a DNA fragment which is out-offrame
with the signal sequence and glllP (out-of-frame clones) would not produce
trypsin-resistant glllP fusion proteins and the extruding phages would incorporate only
trypsin-sensitive glllP supplied by the modified helper phage AGM13. When this phage
population is treated with trypsin, only phages expressing trypsin-resistant glllP fusion
proteins, with the insert in-frame with glllP, would remain infectious.
[000102] Based on this principle of ORF selection by the modified helper phage
AGM13 at the genome scale, two large gene fragment libraries (> 0.5-1 x 10^ clones)
32
i
containing 100-300 bp and 300-800 bp fragments of the Mycobacterium tuberculosis
genome were constructed by cloning randomly generated fragments in between the
PelB signal sequence (PelBss) and full-length trypsin-resistant glllP in a phagemid
vector (Figure 4). The library of 100-300 bp fragments contained - 5 x 1 0 independent
clones and was named MTBLIB25C01; the library of 300-800 bp fragments contained
o
~1 X 10 independent clones was named MTBL1B27C01 (COl represents cells
containing unselected primary clones; Figure 4).
[000103] Table 2 shows analysis of randomly clones at various stages of library
construction. Randomly selected clones were analyzed from (A) MTBLIB25 library
(100-300 bp) and (B) MTBLIB27 library (300-800 bp) at various stages of library
^0 construction: 1, transformants obtained after large-scale electroporation of the ligation
sample; 2, transductants obtained after infection of TOPI OF' cells with the primary
phage library; 3, transductants obtained after infection of TOPI OF' cells with the
trypsin-treated primary phages; 4, transductants obtained after infection of TOPI OF'
cells with the secondary ORP-selected phage library.
Table 2: Analysis of randomly clones at various stages of library construction
Stage Stage 1. Aligning to 11. ORF in-frame with III. Aligning to
No. M. tb genome PelBss (and glllP) • M. tb proteome :
*
_ _ ^ A. MTBLIB25 Library (100-300 bp)
1. MTBLIB25C01 96.8(92/95) 1.05(1/95) -
C 2. MTBL1B25 POl 100 (47/47) 2.1 (1/47) -
3. MTBL1B25C02 100(48/48) 89.6 (43/48) 46.5 (20/43)
4. MTBLIB25P02 100(48/48) 93.7 (45/48) 55.5 (25/45)
___^ B. MTBLIB27 Library (300-800 bp)
1. MTBLIB27C01 97.8(90/92) 1.1 (1/92) 100(1/1)
2. MTBLIB27P01 100(46/46) 2.2 (1/46)
I 3. MTBL1B27C02 | 100(45/45) 95.5 (43/45) 53.5 (23/43)
33
4. MTBLIB27PQ2 100(46/46) 97.8 (45/46) 64.4 (29/45)
* Percentage of recombinant clones that aligned to the M. tuberculosis (M. tb) genome.
\ Percentage of clones in-frame with the PelB signal sequence (FelBss) and glllP in the
phagemid.
f Percentage of total in-frame clones (as in III) that aligned with the M. tb proteome
(genie ORFs).
Number of positive clones/total clones analyzed is provided in brackets
[000104] Sequence analysis of randomly selected transformants from both libraries
revealed that nearly 97% of the clones were recombinants with nucleotide sequences
^ ^ aligning to the Mycobaterium tuberculosis genome (Table 2A and B, 1.1). However,
only 1% of the clones carried fragments in-frame with PelBss and glllP; these clones
were predicted to produce phages bearing trypsin-resistant glllP fusion protein upon
rescue (Table 2A and B, II. 1). Accordingly, both libraries were rescued using AGM13
to obtain phage titres of approximately 1 x lO'Vml, scored as the number of ampicillinresistant
(Amp^) transductants. The primary phage libraries of 100-300 bp and 300-800
bp were named MTBLIB25P01 and MTBLIB27P01, respectively (POl represents
primary unselected phage library; Figure 4). Screening of the clones from the libraries
revealed that almost 100% of the primary phage transductants were recombinants and
contained fragments aligning with the Mycobacterium tuberculosis genome (Table 2A
and B, 1.2). However, similarly to COl, only 2% of the clones contained inserts, which
| f t were in-frame with PelBss and glllP (Table 2A and B, II.2). Conceptually, only these
clones (2%) should display a fusion protein, expressing the insert in-frame with PelBss
and phagemid encoded trypsin-resistant glllP on the phage particle. To select clones
with in-frame inserts and eliminate clones with out-of-frame inserts, the purified POl
phages (-10 /ml) from each library were treated with different concentrations of
trypsin and used to infect E. coli TOPI OF' to obtain transductants (C02 represents cells
of ORF-selected clones).
[000105] 10" primary phages of (A) MTBLIB25 library (100-300 bp) and (B)
34
MTBLIB27 library (300-800 bp) were incubated with four different concentrations of
trypsin; 0,10,100 and 200 |ag/ml and then used to infect E. coli TOPI OF' cells to
determine the fall in titer. Randomly selected clones were analyzed by PCR and DNA
sequencing to estimate the percentage of ORF (genie and non-genic ORE) and non-ORF
clones. Treatment of POl phages with 10 |J.g/ml trypsin resulted in enrichment of ORFclones
by greater than 90% and no enhancement was observed with higher
concentrations of trypsin. Therefore, 10 ng/ml trypsin was used for the treatment of POl
phages to obtain C02 library. Table 3 shows the analysis of random clones after
treatment of primary phages (POl) with various trypsin concentrations.
Table 3; Analysis of random clones after treatment of primary phages (POl) with
^ y various trypsin concentrations
I \ \ \ \ I IV. ORF I I
III. V.
I. Fold in frame
Trypsin II. Clones Aligning Aligning to
S.No. reduction with
concentration Analyzed to M.tb M. tb
in titre PelBss
genome proteome
and glllp
A. MTBLIB25 Library (100-300 bp)
I Without \ \ \ \ I
1. - 32 32 - -
trypsin
2. 10 |.ig/ml 1x10^ 32 32 30 (93.7)' 12 (37.5)"
1 100 \iglm\ 4x10'' 32 32 31 (96.8)' 10(32.25)'
4. 200^g/ml 10^ 32 32 30(93.7)' 10(32.25)"
B. MTBLIB27 Library (300-800 bp)
I Without I \ I \ 1. - 47 47 - -
trypsin
2. 10|xg/ml 1.3 X 10^ 44 44 44(100)' 29 (65.9)"
I lOO^g/ml 1.7x10'' 44 44 41 (93.2)' 22 (53.4)"
4 200 |ag/ml 10^ 44 43 42 (95.4)' 24(57.1)"
35
^ Percentage of clones in frame with PelB signal sequence {PelBss) and glHP of
phagemid
'' Percentage of total in-frame clones as in IV that aligned with the M. tuberculosis
proteome (genie clones)
[000106] Analysis of C02 cells revealed that more than 90% of the clones (89.6% in
the 100-300 bp library and 95.5% in the 300-800 bp library) contained in-frame inserts,
and thereby carried ORF-selected DNA sequences (Table 2A and B, II.3). Of these,
50% clones contained sequences, which coded for proteins that aligned to the
Mycobacterium tuberculosis proteome (genie clones; Table 2A and B, III.3). This |
number was not surprising, as clones with in-frame non-genic inserts without stop
^ ^ codons would display a non-genic protein fused with trypsin-resistant glllP, even at the
POl stage. Phages derived from such clones would remain infectious upon trypsin
treatment, and hence would be a part of C02 preparation. The large fragment (300-800
bp) library contained more genie clones than the small fragment library (100-300 bp).
This is due to the fact that the likelihood of having a proper translatable frame without a
stop codon in an alternate non-ORF reading frame is lower for larger fragments. Upon
rescue with a helper phage, such as VCSM13 or even the modified helper phage
AGM13, each C02 clone was expected to produce phages carrying an in-frame insert,
and display the encoded peptide fused to glllP. The phages were rescued from 2.5 x 10^
C02 cells using the modified helper phage AGM13 to produce phage libraries named
MTBLIB25P02 and MTBLIB27P02 for the 100-300 bp and 300-800 bp inserts,
^ P respectively. Analysis of P02 phages showed concordant results with those of C02, as
more than 95% of the phages carried inserts in-frame with PelBss and glllP, and the
proportion of genie clones was between 55-60% (Table 2A and B, III.4).
[000107] Another important feature of this ORF selection protocol is that the
distribution of differently sized fragments was largely maintained (Figure 5A; Table
3.A and B) at every treatment and selection step, as more than 90% of the fragments in
the MTBLIB25 library were between 100-300 bp. Similarly, more than 90% of the
36
i
clones in the MTBLIB27 library carried inserts between 300-800 bp.
[000108] Furthermore, alignment of the nucleotide and peptide sequences at every
stage of the selection protocol (C01/P01/C02 or P02) showed that the clones in both
libraries were randomly distributed across the Mycobacterim tuberculosis genome, with
no overlapping clones (after analyzing 48-96 clones), proving that the entire process did
not introduce bias towards any particular region of the genome (Figure 5B).
[000109] ORF-selected phage librziries are expected to be several-fold more efficient
than ORF-unselected libraries (POl). This was demonstrated by carrying out panning of
these libraries on different monoclonal antibodies, MAb Ag8512, raised against
^ ^ mycobacterial antigens Ag85A or Ag85B, and MAb 1912, raised against 19 KDa
^ ^ protein. Due to high sequence similarity between Ag85A (Rv3804c) and Ag85B
(Rvl886c), nearly 90% at amino acid level, MAb Ag8512 binds to both the proteins.
Therefore, it was interesting to decipher if this MAb binds to the same sequence on
Ag85A and Ag85B or to a sequence that is almost similar but has a few differences
between Ag85A and Ag85B. Two rounds of panning with MTBLIB25 and MTBLIB27
were sufficient to select clones, which, upon DNA sequence analysis, aligned to a
region of Ag85A and Ag85B. Of these, ~ 78 % of the clones (35 out of 45 analyzed)
aligned to amino acid 224 - 325 of Ag85B (Table 4). A few clones carried inserts
belonging to Ag85A in the region 217 - 327 amino acid residues. The overlapping
sequenced region of various phage clones deduced that region between 279 - 288 amino
^^ acid residues (KFQDAYNAAG) (SEQ ID NO: 5) of Ag85B might constitute the
^ ^ epitope recognized by Ag8512. The corresponding sequence in Ag85A aligned to 282 -
303 amino acid residues (KFQDAYNAGGGHNGVFDFPDSG) (SEQ ID NO: 6)
(Figure 6) with a variation of only one residue (shown in bold). Since, these residues A
or G have no side chains, their contribution in antibody binding might be minimal.
[000110] MTBLIB25 library failed to identify epitope recognized by MAb 1912 which
binds to 19 KDa antigen (Rv3763) and is indicated to have an epitope comprising ~ 100
amino acid residues that might be conformational in nature. Further, 19 KDa antigen
37
used for producing MAb 1912 consists of 136 amino acids with two cysteine residues at
44"^ and 135"^ position of its protein sequence. This failure was attributed to the
composition of this library as it contains none or a very few clones harboring inserts
greater than 100 amino acid residues (~ 300 bp). Therefore, epitope mapping of MAb
1912 was attempted using MTBL1B27 library that carries fragments of 300 - 800 bp
encoding for more than 100 amino acids with maxima around 150 - 175 amino acids.
After two rounds of panning on MAb 1912, 4 out of 32 screened clones aligned to the
19 KDa sequence with further enrichment up to 68 % in third round of panning wherein
majority of the clones (22 out of 32 screened) aligned to the 19 KDa sequence (Table
4). The alignment of different sequences obtained from the positive clones recognized a
^ ^ common sequence encompassing amino acid residues 42 - 136 of 19 KDa including two
cysteine residues (Figure 6).
[000111] A remarkable observation was that the library contained a large number of
clones, which end at 136' residue of 19 KDa antigen but have variable residues at the
N-termini. It is very unlikely that the primary library (MTBLIB27P01) did not have
clones with longer sequences beyond 136' residue but such clones may have been
eliminated due to stop codon after 136' residue, last residue of 19 KDa, during the
process of ORF selection. Therefore, the results described here clearly demonstrate that
the technology illustrated here allows, construction of large gene fragment libraries of
varying sizes with selection of ORF that can be efficiently employed for different
applications.
£ I
^ [000112] The experiments provided in this disclosure are conducted with Ml3
filamentous phage and trypsin, however, a person skilled in the art can perform these
experiments with any other filamentous phage and any protease.
Example 2
Functional antibody cloning
[000113] The modified helper phage AGM13 as described in the present disclosure can
be used for selecting functional antibody fragments (in-frame) in the presence of
38
hybridoma derived out-of-frame aberrant kappa light chain. This unique application is
based on the premise that a single chain Fv ("scFv") comprising of functional variable
domains of the light chain (VL) and heavy chain (VH) from a hybridoma would be inframe
with the glll of a phagemid display vector, whereas a "scFv" comprising of
functional VH, but the VL derived from an hybridoma-generated aberrant kappa light
chain transcript would be out of frame due to the deletion of 4 bases in CDR3 region
that resuhs in frame shift and a termination codon (TAA) at position 105 of VL
(according to kabat numbering system). Therefore, PCR amplification of VL and VR
from hybridoma-derived RNA (cDNA), and their cloning to assemble "scFv" in a
trypsin-resistant glllP-based phagemid display vector would generate two types of
^ ^ clones, one carrying functional "scFv" (in-frame clone) and the other carrying nonfunctional
"scFv" containing the aberrant chain (out-of-frame clone). The trypsin
treatment of AGM13-rescued phages from such a library will render phages displaying
non-functional aberrant VL containing "scFv" non-infectious, while those displaying
functional "scFv" will remain infectious and be selected by infecting E. coli cells. This
concept was tested for rapid cloning of the functional "scFv" from hybridoma that
showed the presence of aberrant chain (as tested by aberrant chain-specific primers,
abVKl and abVK2 based on CDRl and CDR3 of kappa aberrant chain, respectively, to
produce a 206 bp product (Duan et al.. Nucleic Acids Research, 1994, 22(24): 5433-
5438).
[000114] For cloning of "scFv", VL and VH domains were amplified using two sets of
^ P conserved primers similar to those described earlier (Krebber et al., 1997, Journal Of
Immunololgical Methods. 201(1): 35-55), and spliced together through a 45 base
sequence coding for glycine-serine rich linker to produce "scFv", and cloned in between
the signal sequence and full-length trypsin-resistant glllP in a phagemid vector similar
to pVCEPI23964. The phages rescued with AGM 13 (equivalent to POl) were incubated
without or with trypsin and used for infecting E.coli Topi OF' cells to score as Amp^
transductants (equal to C02). The phage titre without trypsin treatment was
approximately 10"/ml but dropped to 10^/ml after trypsin treatment. The transductants
1
I
39
were analyzed for "scFv" using colony PCR with primers flanking the cloning sites, and
also with abVKl and abVK2 that would amplify only the aberrant kappa VL. For
"scFv" from many hybridoma, all the transductants (96/96) obtained from phages
without trypsin treatment contained the aberrant chain along with the VH indicating the
presence of high amount of cDNA of aberrant kappa light chain in the original template
used for the amplification of VL and VH- However, 50% of the transductants obtained
after trypsin treatment of the modified helper phage AGM13 rescued phages contained
no aberrant chain and DNA sequencing confirmed the presence of functional VL and
VH. Further, phages produced by these transductants showed antigen binding in phage
ELISA. Thus, the modified helper phage AGM13 was useful in enriching the clones
^ ^ having functional "scFv" (in-frame clone).
[000115] In another experiment of functional antibody selection, the modified helper
phage AGM13 was used to rescue an anti-human red blood cell (anti-RBC) antibody
phage display library. A mutant library ("scFv") of 10 clones (produced by
mutagenesis using spiked oligonucleotides) for an anti-RBC antibody was constructed
for the selection of improved binders, and the library was rescued using the modified
helper phage AGM13. Phages produced from this unselected library (equivalent to POl)
were screened for RBC binding using an agglutination assay (Gupta et al., MAbs, 2009,
1, 268-280). Only 30% of the clones in the unselected library led to agglutination,
indicating that only 30% of the clones expressed a fiinctional "scFv". Treatment of the
' primary library with trypsin led to complete elimination of the phagemid particles,
^ P which did not display full-length "scFv"-gIIIP fusion protein, to obtain a final enriched
library wherein 100% of the clones produced phages that showed agglutination activity.
[000116] The data as provided in Table 4 indicates that following trypsin treatment,
only 3.9-4.9% phages remained infectious, suggesting that this fraction of phages
carried at least one copy of the antibody fusion protein fused to wild type trypsin
resistant-glllP with other glllP molecules on these phages as well as on other nondisplaying
phages being derived from the modified helper phage AGM13.
40
[000117] The experiments provided in this disclosure are conducted with Ml3
filamentous phage and trypsin, however, a person skilled in the art can perform the
experiments with any other filamentous phage and any protease.
SEQ ID NO: 1- Amino acid sequence that provides a trypsin cleavage site into both LI
and L2 linkers in the modified helper phage AGM13
KDIR
SEQ ID NO: 2- Oligonucleotide sequence used to insert the codons for the amino acid
sequence as set forth in SEQ ID NO: 1 (KDIR) within the two linker regions of glllP
W AGCCACCACCCTCAGAGCCGCCACCACGAATATCTTTAGAGCCGCCGCCGG
CATTGACAGG
SEQ ID NO: 3-5'primer Ml3R
AGCGGATAACAATTTCACACAGGA
SEQ ID NO: 4- 3' primer U251
AGTTTTGTCGTCTTTCCAGACGT
SEQ ID NO: 5- Region between 279 - 288 amino acid residues of Ag85B
KFQDAYNAAG
SEQ ID NO: 6- Region between 282 - 303 amino acid residues in Ag85A
^ KFQDAYNAGGGHNGVFDFPDSG
41
_2 o o
JT; o X X r^
^ U ^ ^ ^
B ^ ^ •§
I—I 03 .,_, +-•
Z 13 -S
—. .So
^ J: o o <^ s
s S ^ - P^ H I
cd M f _>
^ ^ ^ a>
o g o o c3 S«
>, -g ^ ^ O JJ
S r < j q o x x "8"
g 5; s ^ ^ g -s
.a c " g a
^ S ^ ^ S ^ 8
y ^ _; D c«
O _ '^ o > ^
o c o o j^f-ojaS
c o x x ^ ^ 8 - 2 ^
o ^ ^ - S^ i c § 2
I - I x x -SSJS
St = S ' 0 - 0 £ I l ia
i i S § b S x X K t ^ ^ t i i^
o ^ 6 H ^ § 1
S < U c - — i ^ t — i ? -C
s 11 I g t i I 1 -= t 1 5 -^ I
H | S < | c t ^ | u | 1^ |o t 2 ^ 3 § o * ^ *

lAVe Claim:
1. An improved process of producing an open reading frame (ORF) enriched phage
display library comprising:
a. providing a population of recombinant phagemids comprising at least
one heterologous polynucleotide inserted upstream of
polynucleotide encoding pro tease-resistant glll protein;
b. introducing the population of recombinant phagemids into host cells
to obtain transformants;
c. infecting the transformants with a modified helper phage to obtain a
^ P population of recombinant phages displaying heterologous protein
and displaying no heterologous protein; wherein the modified helper
phage comprises at least one protease cleavage site in polynucleotide
encoding glll protein;
d. treating the population of recombinant phages with a protease
wherein the protease can cleave the protease site in the modified
recombinant phage glllp to obtain treated recombinant phages;
e. infecting host cells with the treated recombinant phages from step (d)
to obtain recombinant transformants;
f rescuing the recombinant transformants from step (e) with a helper
^ P phage to obtain a phage display library enriched for heterologous inframe
protein-encoding DNA fragments (ORFs), wherein display of
the heterologous protein is indicative of in-frame protein-encoding
DNA fragments.
2. A process of selection of in-frame antibody fragments comprising:
a. amplification of VL and VH domains and splicing together with a
linker to produce "scFv" fragment; wherein the VH and V^ domains
are amplified selected from group a consisting of cloned DNA using
43
I
two sets of conserved primers and synthetic DNA encoding VL and
VH domains;
b. cloning the "scFv" fragment upstream of polynucleotide encoding
protease-resistant glllP phagemids to produce a population of
recombinant phagemids;
c. introducing the population of recombinant phagemids into host cells
to obtain transformants;
d. infecting the transformants with a modified helper phage to obtain a
population of recombinant phages displaying functional "scFv" and
other phages displaying non-functional "scFv" containing aberrant
^ ^ chain; wherein the modified helper phage comprises at least one
protease cleavage site in polynucleotide encoding glll protein;
e. treating the population of recombinant phages with a protease;
wherein the protease can cleave the protease site in the modified
i helper phage to obtain treated recombinant phages;
f infecting host cells with the treated recombinant phages from step
(e) to obtain recombinant transformants;
g. obtaining the recombinant transformants from step (f) with a helper
phage to obtain phages displaying in-frame functional "scFv"
fragments that remain infectitious and the recombinant phages
displaying non-functional "scFv" containing aberrant chain are not
U^ infectitious; wherein display of the functional "scFv" fragments is
indicative of in-frame functional antibody fragments.
3. The process as claimed in claim 1, wherein the process further comprises
multiplying the recombinant phages having in-frame protein-encoding DNA
fragments from step f
44
4. The process as claimed in claim 1 or 2, wherein the recombinant phagemids
optionally comprises a protease cleavage site between the heterologous
polynucleotide and the polynucleotide encoding protease resistant glll protein.
5. The process as claimed in claim 1 or 2, wherein the phage is a filamentous
phage.
6. The process as claimed in claim 5, wherein the filamentous phage is selected
from the group consisting of M13, Fl and Fd.
7. The process as claimed in claim 1 or 2, wherein the protease cleavage site is
present in the linker regions between Nl, N2 and N2, CT domains of the
^ ^ polynucleotide encoding glll protein.
8. The process as claimed in claim 1 or 2, wherein the helper phage comprises at
least one trypsin cleavage site in the polynucleotide encoding glll protein.
9. The process as claimed in claim 8, wherein the helper phage is AGMl3.
10. The process as claimed in claim 1 or 2, wherein the protease is selected from the
^ group consisting of trypsin, collagenase and TEV protease.
11. The process as claimed in claim 1 or 2, wherein the protease cleavage site is
provided by an amino acid sequence as set forth in SEQ ID NO: 1.
12. The process as claimed in claim 1, wherein the heterologous polynucleotides is
selected from the group consisting of genomic DNA and cDNA obtained from
^ ^ different organisms.
13. The process as claimed in claim 12, wherein the organism is selected from the
group consisfing of bacteria, virus, animal and plant.
14. The process as claimed in claim 1, wherein the heterologous polynucleotides is
i selected from the group consisting of cDNA, amplified DNA fragments, DNA
encoding antibodies, gene sequences, random sequences and synthetic DNA.
45
15. The process as claimed in claim 1 or claim 2, wherein the host cell is a bacterial
cell, preferably E. coli.
16. A kit for cloning DNA fragments and selecting for heterologous in-frame
protein-encoding DNA fragments comprising; a phagemid vector with protease -
resistant glll protein, modified helper phage having at least one protease
cleavage in the polynucleotide encoding glll protein of the phage, bacterial
strains, and protease.
17. A kit for cloning DNA fragments and selecting for heterologous in-frame
protein-encoding DNA fragments as claimed in claim 15, wherein the protease
cleavage site in the helper phage is present in the linker regions between Nl, N2
^ P and N2, CT domains of the polynucleotide encoding glll protein.