Abstract: The present invention provides a method for identifying a compound as selective inhibitor of PDE4 subtype employing luciferase based reporter gene assay. The method of the present invention provides a simple and sensitive assay for high throughput screening of compounds as selective inhibitor of PDE4 subtype for treatment of asthma and COPD, which could be extended to other chronic diseases caused by inflammation, such as Alzheimer"s and stroke.
2. A reporter gene assay method for screening of a compound as selective inhibitor of PDE4 subtype comprises the steps of: (a) transiently transfecting cells expressing high levels of PDE4 subtypes with a reporter construct; (b) incubating the transfected cells of step (a); (c) adding PDE 4 inhibitor to the incubated cells of step (b); (d) lysing the cells of step (c); (e) adding the substrate; (f) monitoring dose dependent change in reporter gene activity.
3. A reporter gene assay according to claim 2, is used to detect increase in reporter gene activity under control of cAMP regulatory element (CRE) in a cell expressing high levels of PDE 4 subtypes relative to cell that does not normally express or expresses at very low levels PDE 4 subtypes.
4. The method according to claim 2, wherein of PDE 4 subtypes can be selected from PDE4A4, PDE4B2 and PDE4D3
5. The method according to claim 2, wherein reporter construct may be pCRE-Luc plasmid vector and reporter assay gene may be luciferase gene.
6. The method according to claim 2, wherein transfection can be achieved by Lipofectamine.
7. The method according to claim 2, wherein PDE4 inhibitor to be tested is added in a concentration from InM to lOuM.
8. The method according to claim 2, wherein substrate added is firefly luciferin. 9.The method according to claim 2, wherein assay is used for high throughput screening of a compound as selective inhibitor of PDE4 subtype for treatment of asthma and COPD, which could be extended to other chronic diseases caused by inflammation, such as Alzheimer's and stroke.
Field of the Invention
The present invention provides a method for identifying a compound as selective inhibitor of PDE4 subtype employing luciferase based reporter gene assay. The method of the present invention provides a simple and sensitive assay for high throughput screening of compounds as selective inhibitor of PDE4 subtype for treatment of asthma and COPD, which could be extended to other chronic diseases caused by inflammation, such as Alzheimer's and stroke.
Background of the Inventions
The phosphodiesterases (PDEs) constitute a large superfamily of isoenzymes that play an important role in regulating intracellular levels of cAMP and cGMP by catalyzing the hydrolysis of cyclic 3', 5'-adenosine monophosphate and guanosine monophosphate to the corresponding nucleotide 5' monophosphates. cAMP and cGMP serve as second messengers in hormonal and photic transduction system and degradation of these cyclic nucleotides terminates their function that is mediated by the cyclic nucleotide- dependent protein kinases. Eleven PDE gene families have been identified and more than 50 splice variants have been detected in various human tissues (Beavo., Physiol. Rev.75 (1995) 725-748; Soderling et al., J. Biol. Chem. 273 (1998) 15553- 15558; Soderling et al., Proc.Natl. Acad. Sci.USA 96 (1999), 7071-7076; Fawcett et al., Proc. Natl. Acad. Sci. USA 97 (2000) 3702-3707). They all share a highly conserved catalytic domain of about 270 amino acids fused to additional N- and C- terminal sequences that contain distinct domains unique to the members of a PDE family. These isoforms are differentially expressed and regulated in different cell types under various physiological conditions (Houslay and Milligan, Trends Biochem. Sci. 22 (1997) 217-224; Beavo, Physiol. Rev.75 (1995) 725-748; Weishaar et al., J. Med. Chem. 28 (1985) 537-545). PDEs are therapeutic targets for a range of disorder such as retinal degeneration, congestive heart failure, depression, asthma, erectile dysfunction and inflammation (Conti et al., Endocr. Rev. 12 (1991) 218-234; Teixeira et al., Trends Pharmacol. Sci.18 (1997) 164-171).
A high-affinity cAMP-specific isozyme known as PDE4, is predominantly found in immune and inflammatory cells and plays important roles in regulating intracellular levels of cAMP in these cell types (Teixeira et al., Trends Pharmacol. Sci.18 (1997) 164-171). PDE4 is encoded by four gene families (A, B, C and D), each of which generates multiple splice variants (Muller et al., Trends Pharmacol.Sci. 17 (1996) 294-298; Houslay et al., Adv. Pharmacol. 44 (1998) 225-341). In particular, PDE4A, 4B and 4D subtypes are predominantly expressed in eosinophils and neutrophils, whereas PDE4C is expressed in brain and has not been detected in any inflammatory cells. cDNA for all the four subtypes of the human PDE4 family have been cloned
( Livi et al., Mol. Cell Biol. 10 (1990) 2678-2686; McLaughlin et al., J. Biol. Chem. 268 (1993) 6470-6476; Engels et al., FEES Lett. 358 (1995) 305-310 ; Baecker et al., Gene 138 (1994) 253-256; Obernolte et al., Gene 129 (1993) 239-247; Bolger et al., Mol. Cell. Biol. 13 (1993) 6558-6571). All the four subtypes of PDE4 contain a highly conserved catalytic domain of about 450 amino acids with more than 80 % identity among the subtypes (Obernolte et al., Gene 129 (1993) 239-247). Other short regions of conserved amino acid sequences at the N-terminus of PDE4 proteins, designated as UCR1 and UCR2 for upstream conserved regions, have been identified. Analysis of various cDNA clones has shown that all of UCR1 and all or part of UCR2 can be removed in some splice variants, without losing the catalytic activity (Conti et al., Biochemistry 34 (1995) 7979-7987; Obernolte et al., Biochem. Biophys. Acta 1353 (1997) 287-297; Bolger et al., Gene 149 (1994) 237-244). The C- terminal regions of each of the four PDE4 subtypes are distinct. These region of homology and their evolutionary conserved nature suggest that each domain possesses important and unique functions. PDE4 inhibitors suppress various functions of the inflammatory cells. Inhibition of PDE4 results in increased levels of cAMP that leads to functional inhibition of eosinophils, macrophages, neutrophils, mast cells, basophils, monocytes, lymphocytes and release of inflammatory mediators. In vivo anti-inflammatory effects of PDE inhibitors have been widely demonstrated. Therefore, there is significant interest in the potential utility of PDE4 inhibitors in the therapy of asthma, allergy, chronic obstructive pulmonary diseases (COPD), cognitive disorders including Alzheimer's disease and stroke (Barnes, Nature(Lond.) 402 (1999) B31-B38; Gong et al., J. Clin. Invest. 114 (2004) 1624-1634; Gretarsdottir et al., Nat.Genet.35 (2003) 131-138; Vignola., Respir. Med. 98 (2004) 495-503).
Although PDE4 inhibitors have therapeutic potential for treatment of variety of inflammatory diseases, its clinical usefulness is limited by adverse effects, such as nausea and emesis, as observed in clinic, following administration of PDE4 inhibitors, including rolipram, tibenelast (Bertolino et al., Int. Clin. Psychopharmacol. 3 (1988) 245-253, Israel et al., Chest 94 (1988) S71). Thus a PDE4 inhibitor with a little or no emetogenicity will have better patient compliance. Moreover, nonspecific PDE inhibition with theophylline, commonly used to treat asthma and COPD, have demonstrated increased mortality due to cardiac arrhythmias (Barnes, Am. J. Respir. Crit. Care Med. 167 (2003) 813-818; Packer et al., N. Engl. J. Med. 325 (1991) 1468-1475). There is not much evidence to indicate if any of these side effects are associated with a particular PDE4 subtype. Robichaud et al. (J. Clin.Invest. 110 (2002) 1045-1052) have demonstrated that PDE4D subtype is mainly responsible for the emetic side effect associated with the PDE4 inhibitors and PDE4B inhibition does not cause emesis. Recently, Lehnart et al., (Cell 123 (2005) 25-35) also showed that PDE4D3 inhibition is associated with heart failure and lethal cardiac arrhythmias. Their data indicated that PDE4D3 subtype plays a protective role
in the heart against heart failure and arrhythmias. Hence non-specific inhibition of PDE4D subtypes could lead to increase in mortality due to cardiac arrhythmias. These studies clearly indicate that inhibition of PDE4D3 subtype could lead to adverse effects such as nausea, emesis, heart failure and cardiac arrhythmias. On the contrary, PDE4B was shown to be essential for LPS-activated TNF-a responses, since in PDE4B deficient mice, lipopolysaccharide (LPS) stimulation failed to induce TNF-a secretion (Jin and Conti, Proc. Natl. Acad. Sci. USA 99 (2002) 7628-7633), indicating that a PDE4B inhibitor would be an anti-inflammatory drug without emetic and other side effects. Although the role of PDE4A and PDE4C subtypes in emesis and cardiac arrhythmias is not yet clear, a PDE4B subtype selective inhibitor with several fold selectivity over PDE4D3 would be ideal to overcome the adverse effects associated with the currently available PDE4 inhibitors. Since the catalytic domain is highly conserved among all the four PDE4 subtypes, it would be ideal to design drugs that could interact with catalytic as well as C-terminal isoform specific domain that is quite distinct in all the subtypes, to develop a PDE4 subtype selective inhibitor Therefore, it is very important to develop a PDE4 subtype selective inhibitor (i.e PDE4B subtype selective inhibitors) to overcome these major side effects.
The present invention discloses the generation of recombinant stable cell lines, individually expressing high level of PDE4A4, PDE4B2 and PDE4D3 subtypes and development of simple and novel luciferase based reporter gene assay for the high throughput screening of a compound as selective inhibitor of PDE4 subtype with improved therapeutic index and without adverse effect such as emesis and cardiac arrhythmias.
Summary of the invention
The present invention provides a method for identifying a compound as selective inhibitor of PDE4 subtype, comprising steps of:
(a) cloning of human PDE4 subtypes into mammalian expression vector
pcDNA3.1/Zeo;
(b) generating recombinant stable cell line by transfecting HEK 293 cell with
mammalian expression vector pcDNA3.1/Zeo harboring PDE4 subtype cDNA;
(c) selecting the stable recombinant clones for resistance to zeocin;
(d) performing a reporter gene assay ;
(e) assaying the activity of a PDE4 subtype in the absence of said compound by a
method of step (d);
(f) assaying the activity of a PDE4 subtype in the presence of said compound by a
method of step (d);
(g) comparing the results of step (e) with the results of step (f);
(h) detecting a decrease in the level of activity of PDE4 subtype in the presence of said compound wherein a decrease in the level of activity of PDE4 subtype is detected by increase in level of expression of reporter gene relative to a level of expression in the absence of said compound;
(i) analysing the dose-response data and calculating the
In another embodiment, the present invention provides a reporter gene assay method for screening a compound as selective inhibitor of PDE4 subtype comprises the steps of:
(a) transiently transfecting cells expressing high levels of PDE4 subtypes with a reporter
construct;
(b) incubating the transfected cells of step (a);
(c) adding compound to be tested as inhibitor to the incubated cells of step (b);
(d) lysing the cells of step (c);
(e) adding the substrate;
(f) monitoring dose dependent change in reporter gene activity.
In another embodiment, the present invention provides a reporter gene assay that can be used
to detect increase in reporter gene activity under control of cAMP regulatory element (CRE)
in a cell expressing high levels of PDE 4 subtypes relative to cell that does not normally
express or expresses at very low levels PDE 4 subtypes.
The invention also provides use of reporter gene assay method for identifying a compound
as selective inhibitor of PDE4 subtype, wherein PDE 4 subtypes are selected from PDE4A4,
PDE4B2andPDE4D3.
The invention provides a reporter gene assay method wherein transfection can be achieved
by Lipofectamine.
The invention provides a reporter gene assay method wherein PDE4 inhibitor to be tested is
added in a concentration from InM to lOuM.
The invention provides a reporter gene assay method wherein substrate added is firefly
luciferin.
The invention provides a reporter gene assay method, wherein assay is used for high
throughput screening of a compound as selective inhibitor of PDE4 subtype for treatment of
asthma and COPD, which could be extended to other chronic diseases caused by
inflammation, such as Alzheimer's and stroke
Detailed description of the invention
The invention provides a method for identifying a compound as selective inhibitor of PDE4 subtype, involving, cloning of human PDE4 subtypes, generating stable recombinant HEK 293 cell lines expressing high levels of PDE4A4, PDE4B2 and PDE4D3 subtypes by transfecting HEK 293 cell with mammalian expression vector pcDNA3.1/Zeo harboring PDE4 subtype cDNA (i.e PDE4A4, 4B2 and 4D3), selecting the stable recombinant clones for resistance to zeocin, performing a reporter gene assay, wherein changes in cAMP concentrations are detected via changes in the expression level of a particular gene (the reporter), assaying the activity of a PDE4 subtype in the absence of said compound, assaying the activity of a PDE4 subtype in the presence of said compound, detecting a decrease in the level of activity of PDE4 subtype in the presence of said compound wherein a decrease in the level of activity of PDE4 subtype is detected by increase in level of expression of reporter gene relative to a level of expression in the absence of said compound, and analysing the dose-response data and calculating the ICso-In another aspect, for the purpose of cloning, total RNA was extracted from U937 (for isolation of human PDE4A4B, PDE4B2A and PDE4D3) cells. First strand cDNA was made using Superscript II reverse transcriptase (Invitrogen) with oligo dT/random primer. The full length coding region of each gene was amplified by PCR using gene specific primers. The full length coding region of PDE4A4B subtype was amplified and full length product was cloned into the Bam HI and Hind III sites of plasmid pcDNA3.1/Zeo(-).The full length coding region of PDE4B2A subtype was amplified and the full-length product was cloned into Kpn I and Xba I sites of plasmid pcDNA3.1/Zeo(+).The full length coding region of PDE4D3 subtype was amplified and the full-length product was cloned into Hind III and Xba I sites of plasmid pcDNA3.1/Zeo(+). Full-length cDNA of human PDE4A4B, PDE4B2A and PDE4D3 subtypes were confirmed by restriction mapping and DNA sequencing.
Recombinant stable cell lines were obtained by transfection of expression vector pcDNA3.1/Zeo containing the cDNA constructs of each of the human PDE4 subtypes (i.e PDE4A4, 4B2 and 4D3) into HEK-293 cells. Stable clones were selected for resistance to Zeocin and were screened by Western blot analysis using PDE4 subtype selective antibodies. These subtype selective antibodies recognize an epitope in the C-terminal region of a PDE4 subtype that is not common with the other three PDE4 subtypes i.e PDE4A selective antibody would react with all the splice variants of PDE4A, but it would not cross react with PDE4B, PDE4C and PDE4D3. Carboxy terminal region also designated as an isoform specific domain exhibit high amino acid homology in this region (79-95%) between rat and human isoform whereas the comparison between isoforms (e.g., A vs B, C vs D) from same species shows no homology (Obernolte et al., Gene 129 (1993) 239-247; Saldou et al., Cell. Signal. 10 (1998) 427-440). Hence, these subtype
selective antibodies recognizing an epitope in the C-terminal region of a PDE4 subtype, are important tool to detect the expression of a particular PDE4 subtype in an over-expressing recombinant cell line. Specific protein bands of 98 kDa, 63 kDa and 74 kDa for PDE4A4, PDE4B2 and PDE4D3, respectively were detected in the immunoblot as shown in Fig.l (A, B and C). Recombinant clones with maximum expression levels for each PDE4 subtype were isolated and termed as HEK-PDE4A4, HEK-PDE4B2 and HEK-PDE4D3. All the three subtypes showed expected protein sizes with the subtype specific antibodies without any cross reactivity. No signal was detected in control HEK293 cells.
Cellular localization of PDE4A4, PDE4B2 and PDE4D3 was analysed by immunocytochemical analysis using PDE4 subtype-selective antibodies. Expression of PDE4A4, PDE4B2 and PDE4D3 was mainly localized in cytoplasm as shown in Fig.2, Panel B, D and F, respectively. No signal was detected in the control cells (Fig. 2, Panel A, C and E). For screening of a compound as selective inhibitor of PDE4 subtype, a reporter gene assay can be employed comprising the steps of:
(a) transiently transfecting cells expressing high levels of PDE4 subtypes with a reporter
construct;
(b) incubating the transfected cells of step (a);
(c) adding compound to be tested as inhibitor to the incubated cells of step (b);
(d) lysing the cells of step (c);
(e) adding the substrate;
(f) monitoring dose dependent change in reporter gene activity.
A reporter construct can be pCRE-Luc plasmid which is designed to detect the activation of cAMP response element binding protein (CREB) and cAMP-mediated signal transduction pathways. Several signal transduction pathways are associated with the cAMP response element (CRE) and induction of these pathways enables endogenous transcription factor, CREB, to bind CRE and initiate the transcription of the downstream target genes (Himmler et al., J. Recept. Res. 13 (1993) 79-94). pCRE-Luc plasmid vector contains the firefly luciferase gene under the control of CRE-binding sequences fused to a TATA-like promoter region from the Herpes simplex virus thymidine kinase promoter. Elevation of intracellular cAMP levels activates CREB to bind CRE, thus initiating transcription of the luciferase reporter gene. Any gene encoding a detectable protein may in principle be utilized for this purpose, for instance, P-galactosidase, alkaline phosphatase, p-lactamase, green fluorescent protein (GFP) but luciferase enzymes have shorter half-lives than p-galactosidase and GFP, providing some advantage and making them a popular choice in screening campaigns.
The plasmid construct can be transfected into mammaliam cell type, for example U937 cells expressing endogenous PDE 4 isoenzymes, stable recombinant HEK cell lines individually expressing high levels of PDE4A4, 4B2 and 4D3 subtypes etc. Transfection may be accomplished by several different protocols e.g., by treatment with calcium phosphate, with liposomes, Lipofectamine 2000 or with electroporation etc. After transfection, cells can be incubated and then plated into multi-well plates, commonly 96 well plate. PDE4 inhibitors at various concentration were applied to the wells and cells were again incubated for a defined period. Thereafter cells were centrifuged and lysed. Luciferein substrate was added into each well and the reaction mixture was tranferred to a 96-well white bottom plate. Luminescence was measured in the luminometer. Analysis of inhibitor dose-response data and calculation of ICso values can be performed by using GraphPad Prism (GraphPad Software, Inc., CA). Reporter gene assay was carried out using U937 monocytic cells. U937 cells have been shown to express PDE4A4, PDE4B2, PDE4D3 and PDE4D5 isoenzymes (Mackenzie and Houslay, Biochem. J. 347 (2000) 571-578). Expression of PDE4D3 in U937 cells is highest followed by PDE4B2 and PDE4A4. These enzymes contribute a major fraction of cAMP specific PDE activity in U937 cells. pCRE-Luc plasmid was transfected into U937 cells and cells were treated with various doses of PDE4 inhibitor, roflumilast, for varying time points. Transient transfection of pCRE-Luc plasmid into U937 cells followed by treatment with roflumilast, resulted in a dose and time dependent increase in luciferase activity as shown in Fig.3. Maximum luciferase activity was observed at 24 h of drug treatment. In the absence of PDE4 inhibitor, there was very minimal basal level activity, indicating that increase in luciferase activity is only due to inhibition of PDE4 isoenzymes endogenously expressed in U937 with subsequent increase in inhibitor concentrations. Similar dose response and time kinetics were observed with PDE4 inhibitor rolipram. The ICso for roflumilast was found to be 2.5 nM and for rolipram the IC$o value was 500 nM as determined by Reporter gene assay using U937 cells expressing endogenous PDE 4 isoenzymes. For screening PDE4 subtype selective inhibitors, stable recombinant cell lines HEK-PDE4A4, HEK-PDE4B2 and HEK-PDE4D3, individually over-expressing PDE4A4, 4B2 and 4D3 subtypes, respectively were generated as mentioned above. PDE4 activity in these stable cell lines was confirmed using HitHunter cAMP assay kit. Rolipram inhibited PDE4A4, 4B2 and 4D3 activity with IC50 value of 32 nM, 54 nM and 69 nM respectively. Reporter gene assay was developed using these stable recombinant cell lines, individually expressing a particular PDE4 subtypes. HEK-PDE4A4, HEK-PDE4B2 and HEK-PDE4D3 cell lines were transiently transfected with pCRE-Luc plasmid and cells were treated with various doses of PDE4 inhibitor rolipram. Transient transfection of pCRE-Luc plasmid into stable cell lines expressing a particular PDE4 subtype,
followed by treatment with rolipram, resulted in a dose dependent increase in luciferase activity as shown in Fig 4. (Panel A, B and C). In the control HEK 293 cells, there was very minimal luciferase activity even in presence of 10 uM of rolipram (Fig 4A, B and C), suggesting that there is very low endogenous PDE4 activity in these cells and thus it is an ideal cell line for over-expressing PDE4 subtypes as there will be very low background while performing Reporter gene assay. Moreover, in absence of drug (i.e 0.1% DMSO), there was relatively low activity indicating that increase in the luciferase activity is only due to inhibition of PDE4 isoenzymes over- expressed in the stable cell lines with subsequent increase in rolipram concentrations. Rolipram is a PDE4 selective inhibitor and all the four subtypes of PDE4 are non-selectively inhibited by it.
Expression of reporter gene can be measured in the presence of a compound. A change in the level of expression of a reporter gene in the presence of a compound is compared with that affected with known selective inhibitor. In this way active compound are identified and their relative potency in this assay is determined.
However, this reporter gene assay using stable cell lines, individually over-expressing a particular PDE4 subtype will be extremely useful to identify a compound that can inhibit a particular PDE4 subtype more potently as compared to other PDE4 subtypes.
Brief Description of the Figures
Fig 1. Western blot analysis of PDE4 subtypes expressed in HEK 293 cells. Cell lysate from the cells expressing each subtype were run on SDS-PAGE, transferred to nitrocellulose membranes and Western blotted with rabbit polyclonal anti PDE4A IgG (A) or PDE4B IgG (B) or PDE4D IgG (C). Signals were detected using chemiluminiscence kit. Arrows indicate apparent monomers of each subtype.
Fig. 2. Cellular localization of PDE4 subtypes in HEK293 cells. HEK293 cells, stably transfected with either pcDNA3.1/ Zeo vector (A, C and E) or PDE4A4 (B) or PDE4B2(D) or PDE4D3 (F) cDNAs, were analyzed by immunoflourescence. Immunostaining was done with rabbit polyclonal anti PDE4A IgG (A, B) or PDE4B IgG ( C, D) or PDE4D IgG (E, F). Staining of the cells was done as described under "Materials and methods". (Scale bar: 10 um).
Fig. 3. PDE4 Reporter gene assay using U937 cells, expressing PDE4 subtypes endogenously. U937 cells were transiently transfected with pCRE-Luc plasmid and treated with Roflumilast at
InM, 10 nM, 100 nM and 1 uM concentrations for 2h, 4h, 6h and 24h as described in Materials and Methods. The luciferase activity was measured and plotted using Graph Pad Prism 4.0.
Fig. 4. PDE4 Reporter gene assay using recombinant stable cell lines expressing individual PDE4 subtype. HEK-PDE4A4 (A), HEK-PDE4B2 (B) and HEK-PDE4D3(C) were transiently transfected with pCRE-Luc plasmid and treated with Rolipram at InM, 10 nM, 100 nM, 1 ^M and 10 uM concentrations as described in Materials and Methods. The luciferase activity was measured and plotted using Graph Pad Prism 4.0. The error bars indicate mean ± S.E.M of atleast three experiments performed in triplicate.
The invention will now be described by way of experimental, which are included of illustrative purposes only, and are not to be seen as limiting in any respect.
Materials and method
Materials
HEK-293 and U937 cells (American Type Culture Collection, Manassas, VA);
Dulbecco's modified Eagle's medium (DMEM), RPMI medium 1640, Dulbecco's phosphate buffer saline (DPBS), fetal bovine serum (FBS), [Hyclone, Logan, UT]; Penicillin, Streptomycin, Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, CA); rabbit polyclonal PDE4A IgG, rabbit polyclonal PDE4B IgG , rabbit polyclonal PDE4D3 IgG, (FabGennix Inc TX) donkey anti-rabbit polyclonal IgG HRP conjugated (Santa Cruz Biotechnology, Inc, Santacruz, CA); Alexa-conjugated secondary antibody (Molecular Probes, Eugene, Oregon); Chemiluminiscence assay kit (Amersham Biosciences, Inc., Chicago, IL); Zeocin (Invitrogen Corporation, Carlsbad, CA); nitrocellulose membrane, electrophoresis reagents (Bio-Rad Laboratories, Hercules, CA); pcDNA3.1/Zeo expression vector (Invitrogen Corporation, Carlsbad, CA). pCRE-Luc vector ( BD Biosciences Clontech, CA); rolipram (Sigma, St Louis, MO); roflumilast was synthesized by the Department of Medicinal Chemistry, Ranbaxy Research Laboratories (Gurgaon, India); HitHunter cAMP assay kit ( DiscoveRx Corp, CA); Steady-Glo Luciferase Assay system (Promega, Medison, WI). Cloning of human PDE4 subtypes
RNA isolation and PCR
Total RNA was extracted from U937 (for isolation of human PDE4A4B, PDE4B2A and PDE4D3) cells using Trizol (Invitrogen). First strand cDNA was made using Superscript II
reverse transcriptase (Invitrogen) with oligo dT/random primer. The full length coding region of each gene was amplified by PCR using gene specific primers.
The full length coding region of PDE4A4B subtype was amplified using forward primer:
CGGGATCCATGGAACCCCCGACCGTCCCCTC and reverse primer:
GCAAGCTTTCAGGTAGGGTCTCCACCTGACCCCCCG. The full length product was cloned in to the Bam HI and Hind III sites of plasmid pcDNA3.1/Zeo(-). The full length coding region of PDE4B2A subtype was amplified using forward primer: GGGGTACCATGAAGGAGCACGGGGG and reverse primer CCATCTAGATTAT GTATCCACGGGGGACTTG. The full-length product was cloned into Kpn I and Xba I sites of plasmid pcDNA3.1/Zeo(+). The full length coding region of PDE4D3 subtype was amplified using forward primer: CCCAAGCTTATGATGCACGTGAATA ATTTTCC and reverse primer CTAGTCTAGATTACGTGTCAGGAGAACGATC. The full-length product was cloned into Hindlll and Xba I sites of plasmid pcDNA3.1/Zeo(+). Full-length cDNA of human PDE4A4B, PDE4B2A and PDE4D3 subtypes were confirmed by restriction mapping and DNA sequencing.
Cell culture and transfections
U937 cells were propagated in RPMI medium 1640 supplemented with 10% FBS, 100 u£/ml streptomycin and 100 U/ml penicillin in a humidified atmosphere with 5% CC»2. HEK-293 cells were propagated in Dulbecco's modified Eagle's Medium supplemented with 10% FBS, 100 jag/ml streptomycin and 100 U/ml penicillin in a humidified atmosphere with 5% CC>2. Stable cell lines were obtained by transfection of expression vector pcDNA3.1/Zeo containing the cDNA constructs of each of the human PDE4 subtypes into HEK-293 cells using Lipofectamine 2000 reagent according to the manufacturer's instructions (Invitrogen Corporation, Carlsbad, CA). Stable clones were selected for resistance to Zeocin (Img/ml). Cells were harvested and lysate preparations were analyzed by Western blotting.
Western Blotting
The cell pellets were resuspended in lysis buffer (50mM Tris pH 7.7, 0.2mM EGTA, lOmM MgCb, 0.5 % Triton XI00, protease inhibitor cocktail) and homogenized. The homogenate was centrifuged at ISOOOXg for 20 min at 4°C and cell lysate was assayed immediately for Western blotting and PDE assays or stored at -20°C after addition of glycerol to 30% final concentration. The protein samples were separated on 7.5 % SDS PAGE. The separated proteins were transferred to nitrocellulose membranes. The membranes were incubated with rabbit polyclonal PDE4A IgG or PDE4B IgG or PDE4D3 IgG at 1:1000 dilution followed by incubation with secondary donkey anti rabbit polyclonal IgG HRP
conjugated at 1: 2000 dilution. PDE4 subtype specific proteins were detected using chemiluminiscence kit.
Immunocytochemistry
Stable HEK-293 cell lines expressing PDE4 subtypes were grown in four well Lab-Tek chamber slides for 24 h at 37°C. The cells were fixed with 2% paraformaldehyde/0.1% Triton X-100 for 20 min at room temperature. The cells were blocked in 10% FBS for 20 min at room temperature. The cells were incubated with 1:100 dilution of appropriate primary antibody followed by incubation with 1:500 diluted Alexa- conjugated secondary antibody. Cells were analyzed under a fluorescent microscope TE 2000-E (Nikon Instech CO. LTD., Japan).
PDE assays
Stable recombinant cells from culture flasks were detached in to 5 ml of DPBS pH 7.4 containing 5mM EDTA. Cells were pelleted down by centrifugation at 2000 rpm for 5 minutes and re-suspended in 4 ml of homogenizing buffer (50 mM Tris pH 7.7, 0.2 mM EGTA, 10 mM MgCh, 0.5 % Triton XI00) supplemented with protease inhibitors and homogenized for 30 sec with a polytron homogenizer PT 1300D (Kinematica AG, Switzerland) at 14000 to 20000 rpm. The homogenate was centrifuged at ISOOOXg for 30 min at 4°C and soluble fraction was collected. The protein estimation was done using a protein assay kit from Bio-Rad. PDE4 activity was measured using HitHunter cAMP assay kit (DiscoveRx Corp, CA). Briefly 10 ng of cell lysate, 1 uM cAMP, 10 ul PDE4 inhibitor (1 mM) and 70 ul of Assay buffer were added in 96-well plate and incubated for 1 h at 30 °C with shaking at 120-140 rpm. Around 15 ul of above reaction mixture was added to lOul of lysis buffer in a 96-well black bottom plate and incubated at room temperature for 1 h in dark. All other steps were performed according to the manufacturer's instructions. The fluorescence was measured in Polar Star (Excitation at 530 nm and emission at 610 nm).
PDE4 Reporter gene assay
U937 suspension cells-Endogenous activity
U937 cells were seeded in a 6- well culture plate (1 x 106 cells per well) in 2 ml RPMI medium containing 10% FBS and 2 mM L-Glutamine and incubated at 37° C and 5% CO2 for 24 h. pCRE-Luc plasmid DNA( 2ug) was transiently transfected into the cells using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen Corporation, Carlsbad, CA). Cells were incubated at 37° C and 5% CO2 for 18-20 h. Cells were centrifuged at 1200 rpm/5 min. and resuspended in fresh RPMI medium containing FBS and 2mM L-Glutamine. Cells were distributed (200ul; 3 x 105 cells) in each well of 96-well plate.
PDE4 inhibitor at various concentration was added in each well and cells were incubated at 37°C and 5% CO2 for 2 to 24 h. Cells were centrifuged at 1200 rpm for 5 min and lysed with 50(0.1 of steady- Glo lysis buffer. For each well, 50 ul of luciferin substrate (Steady-Glo Kit) was added and reaction mixture was transferred to a 96-well white bottom plate. Luminescence was measured in the luminometer. Analysis of inhibitor dose-response data and calculation of ICso values were performed by using GraphPad Prism (GraphPad Software, Inc., CA).
The ICso for roflumilast was found to be 2.5 nM and for rolipram the ICso value was 500 nM as determined by Reporter gene assay using U937 cells expressing endogenous PDE 4 isoenzymes
Reporter Gene Assay using recombinant cell line expressing PDE4 subtypes:
Recombinant stable cell line expressing PDE4 subtypes individually were seeded (1 x 107) in 10 cm2 dish containing 10 ml DMEM and 10% FBS. Cells were incubated at 37°C and 5% CO2 incubator for 24 h. pCRE-Luc plasmid DNA (10 ^g) was transfected using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen Corporation, Carlsbad, CA). Cells were incubated at 37° C in 5% COi incubator for 18-20 h. Cells were detached and resuspend in 20 ml DMEM medium containing 10% FBS. 200 (4,1 cells (3 x 105 cells) were added in each well of 96 well plate and the drug Rolipram at 1 nM, 10 nM, 100 nM, 1 uM and 10 uM concentration, was added and cells were incubated for 18-20 h at 37° C and 5% CC>2. Cells were lysed with 50 ul of steady-Glo lysis buffer in each well. For each well, 50 \il of luciferin substrate (Steady-Glo Kit) was added and reaction mixture was transferred to a 96-well white bottom plate. Luminescence was measured in the luminometer. Analysis of inhibitor dose-response data and calculation of ICso values were performed by using GraphPad Prism (GraphPad Software, Inc., CA).
The PDE4A4 activity was inhibited by rolipram with IC50 value of 39 nM in HEK- PDE4A4 cell line. PDE4B2 activity was inhibited by rolipram with ICso value of 32 nM in HEK-PDE4B2 cell line. Similarly, PDE4D3 activity is inhibited by rolipram with ICso value of 3 nM in HEK-PDE4D3 cell line. The ICso values for rolipram were comparable to the reported values (Mackenzie and Houslay, Biochem. J. 347 (2000) 571-578).
It is to be understood that, while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention. Other aspects, advantages and modifications of the invention are within the scope of the claims set forth below.
WE CLAIM:
1 . A method for identifying a compound as selective inhibitor of PDE4 subtype, comprising steps of:
(a) cloning of human PDE4 subtypes into mammalian expression vector
pcDNA3.1/Zeo;
(b) generating recombinant stable cell line by transfecting HEK 293 cells with
mammalian expression vector pcDNA3.1/Zeo harboring PDE4 subtype cDNA;
(c) selecting the stable recombinant clones for resistance to zeocin;
(d) performing a reporter gene assay;
(e) assaying the activity of a PDE4 subtype in the absence of said compound by a
method of step (d);
(f) assaying the activity of a PDE4 subtype in the presence of said compound by a
method of step (d);
(g) comparing the results of step (e) with the results of step (f);
(h) detecting a decrease in the level of activity of PDE4 subtype in the presence of said compound wherein a decrease in the level of activity of PDE4 subtype is detected by increase in level of expression of reporter gene relative to a level of expression in the absence of said compound;
(i) analysing the dose-response data and calculating the
2. A reporter gene assay method for screening of a compound as selective inhibitor of PDE4
subtype comprises the steps of:
(a) transiently transfecting cells expressing high levels of PDE4 subtypes with a reporter
construct;
(b) incubating the transfected cells of step (a);
(c) adding PDE 4 inhibitor to the incubated cells of step (b);
(d) lysing the cells of step (c);
(e) adding the substrate;
(f) monitoring dose dependent change in reporter gene activity.
3. A reporter gene assay according to claim 2, is used to detect increase in reporter gene
activity under control of cAMP regulatory element (CRE) in a cell expressing high levels of
PDE 4 subtypes relative to cell that does not normally express or expresses at very low
levels PDE 4 subtypes.
4. The method according to claim 2, wherein of PDE 4 subtypes can be selected from
PDE4A4, PDE4B2 and PDE4D3
5. The method according to claim 2, wherein reporter construct may be pCRE-Luc plasmid
vector and reporter assay gene may be luciferase gene.
6. The method according to claim 2, wherein transfection can be achieved by Lipofectamine.
7. The method according to claim 2, wherein PDE4 inhibitor to be tested is added in a
concentration from InM to lOuM.
8. The method according to claim 2, wherein substrate added is firefly luciferin.
9.The method according to claim 2, wherein assay is used for high throughput screening of a compound as selective inhibitor of PDE4 subtype for treatment of asthma and COPD, which could be extended to other chronic diseases caused by inflammation, such as Alzheimer's and stroke.
| # | Name | Date |
|---|---|---|
| 1 | 2547-del-2006-form-2.pdf | 2011-08-21 |
| 2 | 2547-del-2006-form-1.pdf | 2011-08-21 |
| 3 | 2547-del-2006-drawings.pdf | 2011-08-21 |
| 4 | 2547-del-2006-description (complete).pdf | 2011-08-21 |
| 5 | 2547-del-2006-correspondence-others.pdf | 2011-08-21 |
| 6 | 2547-del-2006-claims.pdf | 2011-08-21 |
| 7 | 2547-del-2006-abstract.pdf | 2011-08-21 |