Sign In to Follow Application
View All Documents & Correspondence

"A Reporter Gene Assay For Identifying A Compound As Selective Inhibitor Of Pde7 Subtype"

Abstract: The present invention provides a method for identifying a compound as selective inhibitor of PDE7 subtype employing luciferase based reporter gene assay. The method of the present invention provide a novel, simple and sensitive assay for high throughput screening of compounds as selective inhibitor of PDE7 subtype for the treatment of T-cell mediated diseases.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
21 December 2006
Publication Number
31/2008
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

RANBAXY LABORATORIES LIMITED
12TH FLOOR,DEVIKA TOWER, 6,NEHRU PLACE,NEW DELHI-110019,INDIA.

Inventors

1. ROOP SINGH BORA
RANBAXY LABORATORIES LIMITED ,PLOT NO.20,SECTOR-18,UDYOG VIHAR INDUSTRIAL AREA,GURGAON-122001,HARYANA,INDIA.

Claims

1. A method for identifying a compound as selective inhibitor of PDE7 subtype, comprising steps of: (a) cloning of human PDE7 subtype into mammalian expression vector pcDNA3.1/Zeo; (b) generating recombinant stable cell line by transfecting HEK 293 cells with mammalian expression vector pcDNA3.1/Zeo harboring PDE7 subtype cDNA; (c) isolating zeocin resistant clones for PDE7 subtype; (d) performing a reporter gene assay; (e) selecting a stable recombinant cell line expressing high level of PDE7 subtype by a method of step (d); (f) assaying the activity of a PDE7 subtype in the absence of said compound by a method of step (d); (g) assaying the activity of a PDE7 subtype in the presence of said compound by a method of step (d); (h) comparing the results of step (f) with the results of step (g); (i) detecting a decrease in the level of activity of PDE7 subtype in the presence of said compound wherein a decrease in the level of activity of PDE7 subtype is detected by increase in level of expression of reporter gene relative to a level of expression in the absence of said compound; (j) analysing the dose-response data and calculating the ICso.

2. A reporter gene assay method for screening of a compound as selective inhibitor of PDE7 subtype comprising the steps of: (a) transiently transfecting cells expressing high levels of PDE7 subtype with a reporter construct; (b) incubating the transfected cells of step (a); (c) adding compound to be tested as inhibitor to the incubated cells of step (b); (d) lysing the cells of step (c); (e) adding the substrate; (f) monitoring dose dependent change in reporter gene activity.

3. A reporter gene assay according to claim 2, is used to detect increase in reporter gene activity under control of cAMP regulatory element (CRE) in a cell expressing high levels of PDE 7 subtype relative to cell that does not normally express or expresses at very low levels PDE 7 subtype.

4. The method according to claim 2, wherein of PDE 7 subtype can be selected from PDE7A1. 12

5. The method according to claim 2, wherein reporter construct may be pCRE-Luc plasmid vector and reporter assay gene may be luciferase gene.

6. The method according to claim 2, wherein transfection can be achieved by Lipofectamine.

7. The method according to claim 2, wherein compound to be tested as PDE7 inhibitor is added in a concentration from lOOnM to lOOpM.

8. The method according to claim 2, wherein substrate added is firefly luciferin.

9. The method according to claim 2, wherein assay is used for high throughput screening of a compound as selective inhibitor of PDE7 subtype for the treatment of T-cell mediated diseases. 13

Specification

Field of the Invention
The present invention provides a method for identifying a compound as selective inhibitor of PDE7 subtype employing luciferase based reporter gene assay. The method of the present invention provide a novel, simple and sensitive assay for high throughput screening of compounds as selective inhibitor of PDE7 subtype for the treatment of T-cell mediated diseases.
Background of the Inventions
Phosphodiesterases (PDEs) regulate the intracellular levels of cAMP and cGMP. These cyclic nucleotides play an important role as second messengers in diverse physiological functions including immune response, inflammation, vision, neuroplasticity, cardiac output, visceral motility and reproduction. PDEs comprise a large superfamily of enzymes subdivided into 11 major families (PDEs 1- 11) on the basis of substrate specificity, kinetic properties, inhibitor profiles and sequence homology (Physiol. Rev.75 (1995) 725-748; J. Biol. Chem. 273 (1998)15553- 15558; Proc. Natl. Acad. Sci. USA 96 (1999) 7071-7076; Proc. Natl. Acad. Sci. USA, 97(2000) 3702-3707). The PDE7 family of high-affinity cAMP-specific PDEs comprises of two members, PDE7A and PDE7B. PDE7A occurs as three alternative splice variants, PDE7A1, 7A2 and 7A3 (Proc.Natl. Acad. Sci. USA, 98 (2001) 6319-6324). PDE7A1 is primarily expressed in lymphoid organs such as thymus, lymph nodes, spleen and peripheral blood T cells and T cell lines (Proc. Natl. Acad. Sci. USA, 93 (1996) 14188- 14192; Biochem. Biophys. Res. Comm. 276 (2000) 1271- 1277; Proc. Natl. Acad.Sci. USA, 97 (2000) 472- 476). PDE7A2 is highly expressed in skeletal muscle and heart (J. Biol. Chem. 272 (1997) 16152-16157) while PDE7A3 is highly expressed in T lymphocytes. PDE7B is expressed in several tissues including brain, heart and muscles but significant expression is not observed in lymphoid organs (Proc. Natl. Acad.Sci. USA, 97 (2000) 472- 476).
Cyclic AMP is an important second messenger regulating immune and inflammatory responses. Drugs with the ability to elevate intracellular cAMP levels have been shown to possess immunosuppressive and anti inflammatory properties (J. Clin. Immunol. 3 (1983) 295-315; Clin. Exp. Immunol. 101 (1995) 387-389). These anti-inflammatory effects are caused due to inhibition of various T-cell functions including proliferation, cytokine production and expression of activation markers on cell surface (J. Immunol. 145 (1990) 449-455; J. Immunol. 135 (1985)1172-1179; J. Immunol. 139 (1987) 1179-1184; J. Immunol. 146 (1991) 2285-2296). One mechanism by which cAMP may be elevated within cells is by inhibition of PDEs. PDE4 which is predominantly expressed in proinflammatory and immune cells, is an important therapeutic target for the treatment of asthma and chronic obstructive pulmonary disease (Nature (Lond) 402 (1999) B31- B38; Respir. Med. 98 (2004) 495-503; Drugs 59 (2000) 193-212).

However, PDE4 is also one of the major PDEs expressed in the central nervous system, and its inhibition thereby results in the undesirable side effects of nausea and emesis (Drugs 59 (2000) 193-212). Hence, targeting other PDEs isoenzymes that are specifically expressed in proinflammatory and immune cells is an attractive approach to control inflammatory condition. PDE7A isoenzyme, which is mainly expressed in T-cells, could be a novel therapeutic target for treatment of inflammatory disorders.
Li et al. (Science 283 (1999) 848-851) have reported that cell proliferation and IL-2 production in human T-lymphocytes was inhibited by antisense oligonucleotide directed against PDE7A. Smith et al. (Mol. Pharmacol. 66 (2004) 1679-1689) have reported that the PDE7A inhibitor BRL 50481 enhanced the inhibitory effects of the PDE4 inhibitor on cell proliferation in human T-lymphocytes. Recently, Yamamoto et al. (Eur. J. Pharmacol. 541 (2006) 106-114) have reported that YM-393059, a novel PDE7A and PDE4 dual inhibitor, inhibited interleukins IL-2, IL-4 and interferon-y production in mouse splenocytes and it also inhibited lipopolysaccharide-induced tumor necrosis factor-a production in vivo. These studies clearly indicate that PDE7A inhibitors could be used for the treatment of a wide variety of T-cell mediated diseases.
We report here the generation of a recombinant stable cell line expressing high level of PDE7 subtype and the development of simple and novel luciferase based reporter gene assay for the high throughput screening of a compound as selective inhibitor of PDE7 subtype.
Summary of the invention
The present invention provides a method for identifying a compound as selective inhibitor of PDE7 subtype, comprising steps of:
(a) cloning of human PDE7 subtype into mammalian expression vector pcDNA3.1/Zeo;
(b) generating recombinant stable cell line by transfecting HEK 293 cell with
mammalian expression vector pcDNA3.1/Zeo harboring PDE7 subtype cDNA;
(c) isolating zeocin resistant clones for PDE7 subtype;
(d) performing a reporter gene assay ;
(e) selecting a stable recombinant cell line expressing high level of PDE7 subtype by a
method of step (d);
(f) assaying the activity of a PDE7 subtype in the absence of said compound by a
method of step (d);
(g) assaying the activity of a PDE7 subtype in the presence of said compound by a
method of step (d);
(h) comparing the results of step (f) with the results of step (g);

(i) detecting a decrease in the level of activity of PDE7 subtype in the presence of said compound wherein a decrease in the level of activity of PDE7 subtype is detected by increase in level of expression of reporter gene relative to a level of expression in the absence of said compound;
(j) analysing the dose-response data and calculating the
In another embodiment, the present invention provides a reporter gene assay method for screening a compound as selective inhibitor of PDE7 subtype comprising the steps of:
(a) transiently transfecting cells expressing high levels of PDE7 subtype with a reporter
construct;
(b) incubating the transfected cells of step (a);
(c) adding compound to be tested as inhibitor to the incubated cells of step (b);
(d) lysing the cells of step (c);
(e) adding the substrate;
(f) monitoring dose dependent change in reporter gene activity.
In another embodiment, the present invention provides a reporter gene assay that can be used
to detect increase in reporter gene activity under control of cAMP regulatory element (CRE)
in a cell expressing high levels of PDE 7 subtype relative to cell that does not normally
express or expresses at very low levels PDE 7 subtype.
The invention also provides use of reporter gene assay method for identifying a compound
as selective inhibitor of PDE7 subtype, wherein PDE 7 subtype is PDE7A1.
The invention provides a reporter gene assay method wherein transfection can be achieved
by Lipofectamine.
The invention provides a reporter gene assay method wherein compound to be tested as
PDE7 inhibitor is added in a concentration from lOOnM to lOOuM.
The invention provides a reporter gene assay method wherein substrate added is firefly
luciferin.
The invention provides a reporter gene assay method, wherein assay is used for high
throughput screening of a compound as selective inhibitor of PDE7 subtype for the
treatment of T-cell mediated diseases.
Detailed description of the invention
The invention provides a method for identifying a compound as selective inhibitor of PDE7 subtype, involving, cloning of human PDE7 subtype, generating stable recombinant HEK 293 cell lines expressing high levels of PDE7 subtype by transfecting HEK 293 cell with mammalian

expression vector pcDNA3.1/Zeo harboring PDE7 subtype cDNA (i.e PDE7A1), isolating zeocin resistant clones for PDE7 subtype, performing a reporter gene assay, wherein changes in cAMP concentrations are detected via changes in the expression level of a particular gene (the reporter), selecting a stable recombinant cell line expressing high level of PDE7 subtype by reporter gene assay, assaying the activity of a PDE7 subtype in the absence of said compound, assaying the activity of a PDE7 subtype in the presence of said compound, detecting a decrease in the level of activity of PDE7 subtype in the presence of said compound wherein a decrease in the level of activity of PDE7 subtype is detected by increase in level of expression of reporter gene relative to a level of expression in the absence of said compound, and analysing the dose-response data and calculating the ICso.
In one aspect, for the purpose of cloning, Universal Human Reference RNA (Stratagene, CA) that comprised of RNA pooled from ten human cell lines including T-lymphoblast and B-lymphocyte was used for isolating PDE7A1 cDNA. First strand cDNA was made using Superscript II reverse transcriptase (Invitrogen) with oligo dT/random primer. The full length coding region of PDE7A1 cDNA was amplified by PCR using gene specific primers. The coding region of PDE7A1 subtype was amplified and full length PCR fragment (1448 bp) was cloned in to the Bam HI and Xba I sites of plasmid pcDNA3.1/Zeo. Full-length cDNA of human PDE7A1 subtype were confirmed by restriction mapping and DNA sequencing. DNA sequence of PDE7A1 was found to be same as per the published reports (J. Biol. Chem. 272 (1997) 16152-16157; Proc. Natl. Acad. Sci. USA 93 (1996) 14188-14192). Recombinant stable cell lines were obtained by transfection of expression vector pcDNA3.1/Zeo containing the cDNA constructs of the human PDE7 subtype (i.e PDE 7A1) into HEK-293 cells. Stable clones were isolated for resistance to Zeocin.
For screening of a Zeocin resistant clones for PDE7A expression, a reporter gene assay can be employed comprising the steps of:
(a) transiently transfecting Zeocin resistant clones of PDE7 subtype with a reporter
construct;
(b) incubating the transfected cells of step (a);
(c) adding PDE7 inhibitor to the incubated cells of step (b);
(d) lysing the cells of step (c);
(e) adding the substrate;
(f) monitoring dose dependent change in reporter gene activity.
A reporter construct can be pCRE-Luc plasmid which is designed to detect the activation of cAMP response element binding protein (CREB) and cAMP-mediated signal transduction pathways. Several signal transduction pathways are associated with the cAMP response element

(CRE) and induction of these pathways enables endogenous transcription factor, CREB, to bind CRE and initiate the transcription of the downstream target genes (J. Recept. Res. 13 (1993) 79-94). pCRE-Luc plasmid vector contains the firefly luciferase gene under the control of CRE-binding sequences fused to a TATA-like promoter region from the Herpes simplex virus thymidine kinase promoter. Elevation of intracellular cAMP levels activates CREB to bind CRE, thus initiating transcription of the luciferase reporter gene. Any gene encoding a detectable protein may in principle be utilized for this purpose, for instance, P-galactosidase, alkaline phosphatase, p-lactamase, green fluorescent protein (GFP) but luciferase enzymes have shorter half-lives than P-galactosidase and GFP, providing some advantage and making them a popular choice in screening campaigns.
The plasmid construct can be transfected into Zeocin resistant clones expressing PDE7A1. Transfection may be accomplished by several different protocols e.g., by treatment with calcium phosphate, with liposomes, Lipofectamine 2000 or with electroporation etc. After transfection, cells were incubated and then plated into multi-well plates, commonly 48 or 96 well plate. PDE7 inhibitor at a particular concentration was applied to the wells and cells were again incubated for a defined period. Thereafter cells were centrifuged and lysed with steady-Glo lysis buffer. Luciferein substrate was added into each well and the reaction mixture was tranferred to a 96-well white bottom plate. Luminescence was measured in the luminometer and plotted using GraphPad Prism 4.0 (GraphPad Software, Inc., CA).
Zeocin resistant clones were transiently transfected with pCRE-Luc plasmid and treated with 10 uM PDE7 inhibitor Dipyridamole. Two clones, designated as HEK-PDE7A1- 1 and HEK-PDE7A1-20 showed higher luciferase activity as compared to other clones and untransfected HEK 293 cells (Fig.l). In the control HEK 293 cells, there was very minimal luciferase activity even in the presence of 10 uM of Dipyridamole (Fig.l), showing that there is very low endogenous PDE7 activity in these cells and thus it is an ideal cell line for over-expressing PDE7 subtypes as there will be very low background while performing reporter gene assay. In this assay, luciferase activity is directly correlated to high expression of PDE7A. Expression of PDE7A in recombinant cells leads to hydrolysis of cAMP and decrease in its intracellular level, but the treatment of cells with PDE7A inhibitor causes a dramatic increase in cAMP levels and thus resulting in increase of luciferase activity. This assay can be exploited very efficiently for selecting a stable recombinant cell line expressing high level of PDE7 isoenzyme. Expression of PDE7A in HEK293 was analysed by Western blotting using PDE7A specific antibodies. Specific protein band of 53 kDa for PDE7A1 was detected in the immunoblot as shown in Fig.2. Western blot analysis showed expected protein size with the PDE7A specific antibodies without any cross reactivity. No signal was detected in control HEK293 cells.

Cellular localization of PDE7A1 was analysed by immunocytochemical analysis using PDE7 specific antibody. Expression of PDE7A1 was mainly localized in cytoplasm as shown in Fig.3, Panel B. No signal was detected in the control cells (Fig. 3, Panel A). For screening of a compound as selective inhibitor of PDE7 subtype, a reporter gene assay can be employed comprising the steps of:
(a) transiently transfecting cells expressing high levels of PDE7 subtype with a reporter
construct;
(b) incubating the transfected cells of step (a);
(c) adding compound to be tested as inhibitor to the incubated cells of step (b);
(d) lysing the cells of step (c);
(e) adding the substrate;
(f) monitoring dose dependent change in reporter gene activity.
For screening of a compound as PDE7 subtype selective inhibitor, stable recombinant cell line HEK-PDE7A1-1, overexpressing PDE7A1 were generated as mentioned above. PDE7A activity in these stable cell lines was confirmed using HitHunter cAMP assay kit. Dipyridamole inhibited PDE7A1 activity with ICso value of 17 |JM , which is comparable to the reported IC50 value ( Proc. Natl. Acad. Sci. USA 97 (2000) 472-476). HEK-PDE7A1-1 cell line was transiently transfected with pCRE-Luc plasmid and cells were treated with various doses of PDE7 inhibitor Dipyridamole. Transient transfection of pCRE-Luc plasmid into stable cell lines expressing a PDE7A1, followed by treatment with Dipyridamole, resulted in a dose dependent increase in luciferase activity as shown in Fig 4. In the control HEK 293 cells, there was very minimal luciferase activity even in the presence of 100 |^M of Dipyridamole (Fig. 4), suggesting that there is very low endogenous PDE7 activity in this cell line. Moreover, in the absence of drug (i.e 0.1% DMSO), there was relatively low activity indicating that increase in the luciferase activity is only due to inhibition of PDE7 isoenzyme over- expressed in the stable cell lines with subsequent increase in inhibitor concentrations. Dipyridamole is a semiselective PDE inhibitor and is known to inhibit PDE5, PDE6, PDE7, PDE8 and PDEIO. Expression of reporter gene can be measured in the presence of a compound. A change in the level of expression of a reporter gene in the presence of a compound is compared with that affected with known selective inhibitor. In this way active compound are identified and their relative potency in this assay is determined. It is always desirable to identify a very selective PDE inhibitor in order to minimize the adverse side effects. This reporter gene assay using stable cell line, over-expressing PDE7A isoenzyme will be extremely useful to identify a PDE7 selective inhibitor with several fold selectivity over other PDE enzymes.

Brief Description of the Figures
Fig.l. Reporter gene assay for screening of stable clones expressing high level of PDE7A. Zeocin resistant stable clones were transiently transfected with pCRE-Luc plasmid and treated with Dipyridamole at 10 uM concentration for 18 h as described in Materials and Methods. The luciferase activity was measured and plotted using Graph Pad Prism 4.0. The error bars indicate mean ± S.E.M of atleast three experiments performed in triplicate.
Fig 2. Western blot analysis of PDE7A1 subtype expressed in HEK 293 cells. Cell lysate from the cells expressing PDE7A1 was run on SDS-PAGE, transferred to nitrocellulose membranes and Western blotted with rabbit polyclonal anti PDE7A IgG. Signals were detected using chemiluminiscence kit. Arrows indicate apparent monomer.
Fig. 3. Cellular localization of PDE7A1 subtype in HEK293 cells. HEK293 cells, stably transfected with either pcDNA3.1/ Zeo vector (Panel A) or PDE7A1 cDNA (Panel B), were analyzed by immunofluorescence. Immunostaining was done with rabbit polyclonal anti PDE7A IgG. Staining of the cells was done as described under "Materials and methods". (Scale bar: 10 Urn).
Fig. 4. PDE7 reporter gene assay using recombinant stable cell line expressing PDE7A1. HEK-PDE7A1 was transiently transfected with pCRE-Luc plasmid and treated with Dipyridamole at 100 nM, 1 uM, 10 uM and 100 uM concentrations as described in Materials and Methods. The luciferase activity was measured and plotted using Graph Pad Prism 4.0. The error bars indicate mean ± S.E.M of atleast three experiments performed in triplicate.
Materials and method
HEK-293 (American Type Culture Collection, Manassas, VA); Dulbecco's modified Eagle's medium (DMEM) with or without phenol red, Dulbecco's phosphate buffer saline (DPBS), fetal bovine serum (FBS), [Hyclone, Logan, UT]; Penicillin, Streptomycin, Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, CA); Universal Human Reference RNA (Stratagene, CA); rabbit polyclonal PDE7A IgG, donkey anti-rabbit polyclonal IgG HRP

conjugated (Santa Cruz Biotechnology, Inc, Santacruz, CA); Alexa-conjugated secondary antibody (Molecular Probes, Eugene, Oregon); Chemiluminiscence assay kit (Amersham Biosciences, Inc., Chicago, IL); Zeocin (Invitrogen Corporation, Carlsbad, CA); nitrocellulose membrane, electrophoresis reagents (Bio-Rad Laboratories, Hercules, CA); pcDNA3.1/Zeo expression vector (Invitrogen Corporation, Carlsbad, CA). pCRE-Luc vector (BD Biosciences Clontech, CA); Dipyridamole (Sigma, St Louis, MO); HitHunter cAMP assay kit ( DiscoveRx Corp, CA); Steady-Glo Luciferase Assay system (Promega, Medison, WI).
Cloning of human PDE7A1
Universal Human Reference RNA (Stratagene, CA) was used for isolating PDE7A1 cDNA. First strand cDNA was made using Superscript II reverse transcriptase (Invitrogen) with oligo dT/random primer. The full length coding region of PDE7A1 cDNA was amplified by PCR using gene specific primers. The coding region of PDE7A1 subtype was amplified using forward primer:- CGGGATCCATGGAAG TGTGTTACCAGC and reverse primer: GCTCTAGATTATGATAACCGATTTTCC TGAGG. The full length PCR fragment was cloned in to the Bam HI and Xba I sites of plasmid pcDNA3.1/Zeo. Full-length cDNA of human PDE7A1 subtype were confirmed by restriction mapping and DNA sequencing.
Cell culture and transfections
HEK-293 cells were propagated in Dulbecco's modified Eagle's Medium supplemented with 10% FBS, 100 jag/ml streptomycin and 100 U/ml penicillin in a humidified atmosphere with 5% CO2. Stable cell lines were obtained by transfection of expression vector pcDNA3.1/Zeo containing the cDNA constructs of the human PDE7A1 subtype into HEK-293 cells using Lipofectamine 2000 reagent according to the manufacturer's instructions. Stable clones were selected for resistance to Zeocin (Img/ml). Stable clones were further screened using Reporter gene assay.
Western Blotting
The cell pellets were resuspended in lysis buffer (50mM Tris pH 7.7, 0.2mM EGTA, lOmM MgCb, 0.5 % Triton XI00, protease inhibitor cocktail) and homogenized. The homogenate was centrifuged at ISOOOXg for 20 min at 4°C and cell lysate was assayed immediately for Western blotting and PDE assays or stored at -20°C after addition of glycerol to 30% final concentration. The protein samples were separated on 7.5 % SDS PAGE. The separated proteins were transferred to nitrocellulose membranes. The membranes were

incubated with rabbit polyclonal PDE7A IgG at 1:1000 dilution followed by incubation with secondary donkey anti rabbit polyclonal IgG HRP conjugated at 1: 2000 dilution. PDE7A subtype specific protein was detected using chemiluminiscence kit.
Immunocytochemistry
Stable HEK-293 cell line expressing PDE7A1 subtype was grown in four well Lab-Tek chamber slides for 24 h at 37°C. The cells were fixed with 2% paraformaldehyde/0.1% Triton X-100 for 20 min at room temperature. The cells were blocked in 10% FBS for 20 min at room temperature. The cells were incubated with 1:100 dilution of PDE7A specific primary antibody followed by incubation with 1:500 diluted Alexa- conjugated secondary antibody. Cells were analyzed under a fluorescent microscope TE 2000-E (Nikon Instech CO. LTD., Japan).
PDE assays
Transfected cells from culture flasks were detached in to 5 ml of DPBS pH 7.4 containing 5mM EDTA. Cells were pelleted down by centrifugation at 2000 rpm for 5 minutes and re-suspended in 4 ml of homogenizing buffer (50mM Tris pH 7.7, 0.2mM EGTA, 10mM MgCl2; 0.5 % Triton XI00) supplemented with protease inhibitors and homogenized for 30 sec with a polytron homogenizer PT 1300D (Kinematica AG, Switzerland) at 14000 to 20000 rpm. The homogenate was centrifuged at 30000 rpm for 30 min at 4°C and soluble fraction was collected. The protein estimation was done using a protein assay kit from Bio-Rad. PDE7 activity was measured using HitHunter cAMP assay kit ( DiscoveRx Corp, CA). Briefly 10 ug of cell lysate, luM cAMP, lOul PDE7 inhibitor Dipyridamole ( 1 mM) and 70 ul of Assay buffer were added in 96-well plate and incubated for 1 h at 30°C with shaking at 120-140 rpm. Around 15 ul of above reaction mixture was added to lOul of lysis buffer in a 96-well black bottom plate and incubated at room temperature for 1 h in dark. All other steps were performed according to the manufacturer's instructions. The fluorescence was measured in Polar Star ( Excitation at 530nm and emission at 610 nm).
Dipyridamole inhibited PDE7A1 activity with ICso value of 17 uM , which is comparable to the reported IC50 value ( Proc. Natl. Acad. Sci. USA 97 (2000) 472-476).
Reporter gene assay for screening of stable clones expressing high level of PDE7A
Zeocin resistant stable clones were screened for PDE7A expression using reporter gene assay. Cells were seeded (1 x 105 cells per well) in 48-well plate containing DMEM and 10% FBS. Cells were incubated at 37°C and 5% C02 incubator for 24 h. pCRE-Luc plasmid DNA (0.25ug per well) was transfected using Lipofectamine 2000 (0.75 ul per well) according to

the manufacturer's instructions. Cells were incubated at 37°C in 5% CO2 incubator for 18h. Cells were washed and fresh DMEM medium without phenol red, containing PDE7 inhibitor Dipyridamole, at 10 µM concentration, was added and cells were incubated for 18 h at 37°C and 5% CO2. Cells were lysed with 50µl of steady- Glo lysis buffer in each well. For each well, 50 ul of luciferin substrate (Steady-Glo Kit) was added and reaction mixture was transferred to 96-well white bottom plate. Luminescence was measured in the luminometer.
Reporter gene assay for screening of PDE7A selective inhibitors
Recombinant stable cell line expressing PDE7A subtype was seeded (1 x 105) in 48-well plate containing DMEM and 10% FBS. Cells were incubated at 37°C and 5% CO2 incubator for 24 h. pCRE-Luc plasmid DNA (0.25µg/ well) was transfected using Lipofectamine 2000 according to the manufacturer's instructions. Cells were incubated at 37°C in 5% CO incubator for 18h. Cells were washed and fresh DMEM medium without phenol red, containing PDE7 inhibitor Dipyridamole, at 100 nM, lµM, 10 uM and 100 uM concentration, was added and cells were incubated for 18 h at 37°C and 5% CO2. Cells were lysed with 50µl of steady- Glo lysis buffer in each well. For each well, 50 ul of luciferin substrate (Steady-Glo Kit) was added and reaction mixture was transferred to 96-well white bottom plate. Luminescen2ce was measured in the luminometer.
The PDE7A activity was inhibited by Dipyridamole with IC50 value of 15 uM in HEK-PDE7A1-1 cell line. The IC50 values for Dipyridamole, obtained using this reporter gene assay was comparable to the reported value ( Proc. Natl. Acad. Sci. USA 97 (2000) 472-476). It is to be understood that, while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention. Other aspects, advantages and modifications of the invention are within the scope of the claims set forth below.

WE CLAIM:
1. A method for identifying a compound as selective inhibitor of PDE7 subtype, comprising
steps of:
(a) cloning of human PDE7 subtype into mammalian expression vector pcDNA3.1/Zeo;
(b) generating recombinant stable cell line by transfecting HEK 293 cells with
mammalian expression vector pcDNA3.1/Zeo harboring PDE7 subtype cDNA;
(c) isolating zeocin resistant clones for PDE7 subtype;
(d) performing a reporter gene assay;
(e) selecting a stable recombinant cell line expressing high level of PDE7 subtype by a
method of step (d);
(f) assaying the activity of a PDE7 subtype in the absence of said compound by a
method of step (d);
(g) assaying the activity of a PDE7 subtype in the presence of said compound by a
method of step (d);
(h) comparing the results of step (f) with the results of step (g);
(i) detecting a decrease in the level of activity of PDE7 subtype in the presence of said compound wherein a decrease in the level of activity of PDE7 subtype is detected by increase in level of expression of reporter gene relative to a level of expression in the absence of said compound;
(j) analysing the dose-response data and calculating the ICso.
2. A reporter gene assay method for screening of a compound as selective inhibitor of PDE7
subtype comprising the steps of:
(a) transiently transfecting cells expressing high levels of PDE7 subtype with a reporter
construct;
(b) incubating the transfected cells of step (a);
(c) adding compound to be tested as inhibitor to the incubated cells of step (b);
(d) lysing the cells of step (c);
(e) adding the substrate;
(f) monitoring dose dependent change in reporter gene activity.

3. A reporter gene assay according to claim 2, is used to detect increase in reporter gene
activity under control of cAMP regulatory element (CRE) in a cell expressing high levels of
PDE 7 subtype relative to cell that does not normally express or expresses at very low levels
PDE 7 subtype.
4. The method according to claim 2, wherein of PDE 7 subtype can be selected from
PDE7A1.
12

5. The method according to claim 2, wherein reporter construct may be pCRE-Luc plasmid
vector and reporter assay gene may be luciferase gene.
6. The method according to claim 2, wherein transfection can be achieved by Lipofectamine.
7. The method according to claim 2, wherein compound to be tested as PDE7 inhibitor is
added in a concentration from lOOnM to lOOpM.
8. The method according to claim 2, wherein substrate added is firefly luciferin.
9. The method according to claim 2, wherein assay is used for high throughput screening of
a compound as selective inhibitor of PDE7 subtype for the treatment of T-cell mediated
diseases.
13

Documents

Application Documents

# Name Date
1 2755-del-2006-form-2.pdf 2011-08-21
2 2755-del-2006-form-1.pdf 2011-08-21
3 2755-del-2006-drawings.pdf 2011-08-21
4 2755-DEL-2006-Description (Provisional).pdf 2011-08-21
5 2755-del-2006-correspondence-others.pdf 2011-08-21
6 2755-del-2006-claims.pdf 2011-08-21
7 2755-del-2006-abstract.pdf 2011-08-21