Sign In to Follow Application
View All Documents & Correspondence

A Rt Triplex Pcr Primer Sets, Rapid Test Kitand Method For The Detection Of Sars Cov 2

Abstract: A RT TRIPLEX PCR PRIMER SETS, RAPID TEST KIT AND METHOD FOR THE DETECTION OF SARS-CoV-2 A RT triplex PCR primer sets, rapid test kit and method for the detection of SARS-CoV-2 is disclosed. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence comprises a sequence selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof. The developed kit can be used in any hospitals, clinical laboratory and port of entry, as it would be reliably diagnosing patients within 3 hours thereby, initiating highly effective response mechanism to check the spread of disease.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
22 August 2022
Publication Number
10/2024
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
Parent Application

Applicants

SHANKARANARAYANA LIFE SCIENCES LLP
10TH FLOOR, SOUTHWEST WING, NO144-C/1, SAI VISHRAM, KIRLOSKAR ROAD, HEBBAGODDI, BOMMASANDRA INDUSTRIAL AREA, BANGALORE-560099, KARNATAKA, INDIA

Inventors

1. PAVITRA CHETTRI
SHANKARANARAYANA LIFE SCIENCES LLP, 10TH FLOOR, SOUTHWEST WING, NO144 -C/1, SAI VISHRAM, KIRLOSKAR ROAD, HEBBAGODDI, BOMMASANDRA INDUSTRIAL AREA, BANGALORE-560099, KARNATAKA, INDIA
2. BHAWANA RAI
SHANKARANARAYANA LIFE SCIENCES LLP, 10TH FLOOR, SOUTHWEST WING, NO144 -C/1, SAI VISHRAM, KIRLOSKAR ROAD, HEBBAGODDI, BOMMASANDRA INDUSTRIAL AREA, BANGALORE-560099, KARNATAKA, INDIA
3. BHAIRAB MONDAL
SHANKARANARAYANA LIFE SCIENCES LLP, 10TH FLOOR, SOUTHWEST WING, NO144 -C/1, SAI VISHRAM, KIRLOSKAR ROAD, HEBBAGODDI, BOMMASANDRA INDUSTRIAL AREA, BANGALORE-560099, KARNATAKA, INDIA

Claims

1. A single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence, comprising: a sequence selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof.

2. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the primers target the specific regions of open reading frame 1ab (orf1ab) gene, spike glycoprotein (S gene) and membrane glycoprotein (M gene) of the SARS-CoV-2 RNA virus ensuring high specificity and high selectivity.

3. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the primers are short in length with bases varying between 16-18 to ensure rapid amplification, better specificity with minimal secondary structures and motifs.

4. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the IAC primers are incorporated with three sets of viral gene targeting primers with a common lower Tm range, to achieve annealing temperature between 54-56oC, wherein the difference of Tm range between the forward and backward primers in all the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) are kept within the range of 3oC.

5. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the primers are designed to achieve a minimum base pair difference of 59 bases among the selected amplicon sizes of the products.

6. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) are designed to ensure absence of sequence homology to avoid formation of a primer-dimer.

7. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the primers are designed with rich GC content to ensure a strong annealing to the template as well as an efficient and quick polymerization.

8. A kit for detecting SARS-CoV-2 in a test sample by areverse transcriptase (RT) triplex polymerase chain reaction (PCR) primers, wherein the kit comprises of: a primer set is selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof; and a RT triplex PCR reaction composition comprising of 2X master mix with enzymes, MgCl2, template DNA of sample, internal amplification control (IAC) template DNA and a nuclease free water.

9. The kit as claimed in claim 8, wherein the kit has additional flexibility to replace conventional Taq DNA polymerase in 2X master mix with enzymes with a Fast Taq DNA polymerase or a Gold Taq DNA Polymerase for ensuring faster polymerization to reduce the assay time.

10. A method for detecting SARS-CoV-2 in a test sample by a reverse transcriptase (RT) triplex polymerase chain reaction (PCR) primers, wherein the method comprises of: extracting a sample RNA sequence of SARS-CoV-2;and running a real-time RT triplex PCR for carrying out amplification and detection of extracted RNA sequence of SARS-CoV-2 using a reaction composition, wherein the reaction composition comprises of 2X master mix with enzymes, MgCl2, template DNA of sample, primer set, internal amplification control (IAC) template DNA and a nuclease free water, wherein primer set is selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof

11. The method as claimed in10, wherein the total reaction volume of the RT triplex PCR comprises of 12.5 µl of 2X master mix with enzymes, 0.5 µl of 25mM of MgCl2, 1 µl of 10 mM each primer, 4 µl template DNA of sample, 0.5 µl internal amplification control (IAC) template DNA, nuclease free water to make up the final reaction volume to 25 µl.

12. The method as claimed in10, wherein a procedure for the RT triplex PCR comprises of: initial denaturation for 1 cycle at 94oC for 4 minutes, denaturation for 30 cycles at 94oC for 45 seconds, primer annealing at 56oC for 35 seconds, extension at 72oC for 45 seconds and final extension for 1 cycle at 72oC for 5 minutes.

13. The method as claimed in 10, wherein the single RT triplex PCR reaction with three specific independent targets (ORF, S and M genes) ensure a high reliability and specificity.

14. The method as claimed in 10, wherein the RT triplex PCR reaction conditions are optimized to a common set of 2X master mix with enzymes and annealing temperature to ensure a good resolution of amplified product for each of the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) in use.

15. The method as claimed in 9, wherein an agarose gel electrophoresis with ethidium bromide (EtBr) or any other DNA inter chelating dye and UV transilluminator/ gel dock is provided for visualization of RT triplex PCR results. Dated this 22nd day of August 2022 Signature Jinsu Abraham Patent Agent (IN/PA-3267) Agent for the Applicant

Specification

Description:TECHNICAL FIELD
[001] The present subject matter generally relates to the technical field of molecular biological detection. More specifically, it relates to a reverse transcriptase triplex polymerase chain reaction (RT-PCR) primer sets, kit for Severe Acute Respiratory Syndrome Corona virus- 2 (SARS-COV-2) and method thereof. The multiplex PCR is a way of PCR amplification which uses multiple pairs of primers to amplify multiple target sequence simultaneously in a single reaction tube.
BACKGROUND OF THE INVENTION
[002] Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2), also known as COVID-19 is widely being compared to the influenza pandemic of 1918. SARS-CoV-2 was reportedly originated in the wet markets of Wuhan city, China in December 2019. Since then, it has spread to many countries impacting the economy, employment and the virus has brought the world to a standstill.
[003] The virus transmits in the human population by aerosol and fomites. Aerosol transmission from infected to susceptible individuals is the main cause for a rapid spread of the virus in the population. SARS-CoV-2 is a large positive-sense single-strand RNA having four structural proteins namely, nucleocapsid protein (N), spike protein (S), envelope protein (E) and membrane protein (M). The spike proteins on its surface recognize and bind to the angiotensin converting enzyme 2 (ACE2) receptors in the epithelial lining of the lungs. SARS-CoV-2 virus then enters the cells in the human lungs and starts multiplying using the replication mechanism of the human cells. Meanwhile, the viral infection triggers a cascade of events including inflammation. As a response to the infection, the infected person develops cough, high fever and difficulty in breathing. Sometimes, the infection is asymptomatic. It becomes very important to detect the viral infection in the human body at the earliest.
[004] US20210277489A1 discloses A method for specific detection of the presence or absence of a SARS-CoV-2 RNA in a sample, comprisingproviding a sample andsubjecting the sample to a reverse transcription reaction with a reverse primer to generate a cDNA copy of SARS-CoV-2 RNA in the sample, amplifying any resultant cDNA, and detecting any amplified product with a probe,wherein the reverse primer comprises the sequence 5'-CTGGTCAAGGTTAATATAGG-3' (SEQ ID NO: 5) or a variant thereof, and is from 17 to 23 bases in length; and/orwherein the forward primer comprises the sequence 5'-GGTAACTGGTATGATTTCG-3' (SEQ ID NO: 4), or a variant thereof, and is from 16 to 22 bases in length; and/orwherein the probe comprises the sequence 5'-TCATACAAACCACGCCAGG-3' (SEQ ID NO: 6), or a variant thereof, or the complement of either of these, and is from 16 to 22 bases in length.
[005] WO2022073141A1new primers and mixtures thereof for detecting the presence of the human coronavirus SARS-CoV-2 genome in nasopharyngeal or saliva samples, thus allowing detection thereof with high specificity, ease of handling, fast and easy reading, without needing to extract RNA from the samples. The present invention also includes a kit that uses RT-LAMP for a rapid test, thus obtaining a final reading indicated by a colorimetric change or fluorescence emission when the presence of genetic material from SARS-CoV-2 is detected.
[006] The currently available diagnosis depends on rapid diagnostic antigen test and reverse transcription real time polymerase chain reaction (RT-PCR). The two possible molecular approaches of detection of the pathogen are either by nucleotide or antigen based routes. Retrospectively, the viral infection can also be indirectly detected by identifying the IgG/IgM antibodies generated specific to the viral antigens.
[007] Therefore, it is desirable to have a Multiplex RT- PCR since it’s critical for accurate SARS- CoV-2 detection as it is possible to miss low viral load infections if only a single gene amplicon is used. Further, Multiplexing offers increased throughput of SARS-CoV-2 detection in terms of sensitivity and specificity.

OBJECT OF THE INVENTION
[008] An object of the invention is to develop a reverse transcriptase polymerase chain reaction primer sets.

[009] An object of the invention is to develop a kit for the simultaneous detection of three specific regions of the SARS-CoV-2 genome (ORF, S and M genes).
[0010] Another object of the invention is to provide an internal amplification control (IAC) in the test.
[0011] Yet another object of the invention is to provide a method for detection of three specific regions of the SARS-CoV-2 genome (ORF, S and M genes) in a sample.
[0012] Yet another object of the present invention is to develop a rapid, economical and user-friendly kit and method to identity the persons infected with SARS-CoV-2 virus.

SUMMARY OF THE INVENTION

[0013] Inthe light of the disadvantages mentioned in the previous section, the following summary is provided to facilitate an understanding of some of the innovative features unique to the present invention and is not intended to be a full description. A full appreciation of the various aspects of the invention can be gained by taking the entire specification and drawings as a whole. Embodiments described herein discloses a RT triplex PCR primer sets, rapid test kit and a method for the detection of SARS-CoV-2.
[0014] In one embodiment, a single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence is disclosed. The primer sequence is selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof.
[0015] According to an embodiment of the present invention, the primers target the specific regions of open reading frame 1ab (orf1ab) gene, spike glycoprotein (S gene) and membrane glycoprotein (M gene) of the SARS-CoV-2 RNA virus ensuring high specificity and high selectivity.
[0016] According to an embodiment of the present invention, the primers are short in length with bases varying between 16-20 to ensure rapid amplification, better specificity with minimal secondary structures and motifs.
[0017] According to an embodiment of the present invention, the IAC primers are incorporated with three sets of viral gene targeting primers with a common lower Tm range, to achieve annealing temperature between 54-56oC, wherein the difference of Tm range between the forward and backward primers in all the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) are kept within the range of 3oC.
[0018] According to another embodiment of the present invention, the primers are designed to achieve a minimum base pair difference of 59 bases among the selected amplicon sizes of the products.
[0019] According to another embodiment of the present invention, the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) are designed to ensure absence of sequence homology to avoid formation of a primer-dimer.
[0020] According to another embodiment of the present invention, the primers are designed with rich GC content to ensure a strong annealing to the template as well as an efficient and quick polymerization.
[0021] In one embodiment of the present invention, a kit for detecting SARS-CoV-2 in a sample by a reverse transcriptase (RT) triplex polymerase chain reaction (PCR) primers are disclosed. The kit comprises of a primer set selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) prime (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof and a RT triplex PCR reaction composition comprising of 2X master mix with enzymes, MgCl2, template DNA of sample, internal amplification control (IAC) template DNA and a nuclease free water.
[0022] According to an embodiment of the present invention, the kit has additional flexibility to replace conventional Taq DNA polymerase in 2X master mix with enzymes with a Fast Taq DNA polymerase or a Gold Taq DNA Polymerase for ensuring faster polymerization to reduce the assay time.
[0023] In one embodiment of the present invention, a method for detecting SARS-CoV-2 in a test sample by a reverse transcriptase (RT) triplex polymerase chain reaction (PCR) primers are disclosed. The method comprises of extracting a sample RNA sequence of SARS-CoV-2 and running a real-time RT triplex PCR for carrying out amplification and detection of extracted RNA sequence of SARS-CoV-2 using a reaction composition, wherein the reaction composition comprises of 2X master mix with enzymes, MgCl2, template DNA of sample, primer set, internal amplification control (IAC) template DNA and a nuclease free water. The wherein primer set is selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof
[0024] According to an embodiment of the present invention, the total reaction volume of the RT triplex PCR comprises of 12.5 µl of 2X master mix with enzymes, 0.5 µl of 25mM of MgCl2, 1 µl of 10 mM each primer, 4 µl template DNA of sample, 0.5 µl internal amplification control (IAC) template DNA, nuclease free water to make up the final reaction volume to 25 µl.
[0025] According to an embodiment of the present invention, the initial denaturation for 1 cycle at 94oC for 4 minutes, denaturation for 30 cycles at 94oC for 45 seconds, primer annealing at 56oC for 35 seconds, extension at 72oC for 45 seconds and final extension for 1 cycle at 72oC for 5 minutes.
[0026] According to an embodiment of the present invention, the single RT triplex PCR reaction with three specific independent targets (ORF, S and M genes) ensure a high reliability and specificity.
[0027] According to an embodiment of the present invention, the RT triplex PCR reaction conditions are optimized to a common set of 2X master mix with enzymes and annealing temperature to ensure a good resolution of amplified product for each of the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) in use.
[0028] According to an embodiment of the present invention, the wherein an agarose gel electrophoresis with ethidium bromide (EtBr) or any other DNA inter chelating dye and UV transilluminator is provided for visualization of RT triplex PCR results.
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
[0029] The detailed description is provided with reference to the accompanying figures. These and other features and advantages of the present invention will be readily appreciated, as the same becomes better understood by reference to the following detailed description when considered in connection with the accompanying drawings wherein:
[0030] Fig. 1 illustrates Image representing the amplified products of positive samples in 2% agarose gel in accordance with an embodiment of the present invention;
[0031] Fig. 2 illustrates an image representing the amplified products of positive and negative in 2% agarose gel in accordance with an embodiment of the present invention;
DETAILED DESCRIPTION
[0032] For the purpose of promoting an understanding of the principles of the disclosure, reference will now be made to the embodiment illustrated in the figures and specific language will be used to describe them. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended. Such alterations and further modifications in the illustrated system, and such further applications of the principles of the disclosure as would normally occur to those skilled in the art are to be construed as being within the scope of the present disclosure.
[0033] The terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process or method that comprises a list of steps does not include only those steps but may include other steps not expressly listed or inherent to such a process or method. Similarly, one or more devices or sub-systems or elements or structures or components preceded by "comprises... a" does not, without more constraints, preclude the existence of other devices, sub-systems, elements, structures, components, additional devices, additional sub-systems, additional elements, additional structures, or additional components. Appearances of the phrase "in an embodiment", "in another embodiment" and similar language throughout this specification may, but not necessarily do, all refer to the same embodiment.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. The system, methods, and examples provided herein are only illustrative and not intended to be limiting.
[0035] In the following specification and the claims, reference will be made to a number of terms, which shall be defined to have the following meanings. The singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise.
[0036] Embodiments described herein discloses a RT triplex PCR primer sets, rapid test kit and a method for the detection of SARS-CoV-2.
[0037] According to an embodiment of the present invention, a single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence is disclosed. The primer sequence is selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof.
[0038] According to an embodiment of the present invention, the primers target the specific regions of open reading frame 1ab (orf1ab) gene, spike glycoprotein (S gene) and membrane glycoprotein (M gene) of the SARS-CoV-2 RNA virus ensuring high specificity and high selectivity.
[0039] According to an embodiment of the present invention, the primers are short in length with bases varying between 16-18 to ensure rapid amplification, better specificity with minimal secondary structures and motifs.
[0040] According to an embodiment of the present invention, the IAC primers are incorporated with three sets of viral gene targeting primers with a common lower Tm range, to achieve annealing temperature between 54-56oC, wherein the difference of Tm range between the forward and backward primers in all the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) are kept within the range of 3oC.
[0041] According to another embodiment of the present invention, the primers are designed to achieve a minimum base pair difference of 59 bases among the selected amplicon sizes of the products.
[0042] According to another embodiment, the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) are designed to ensure absence of sequence homology to avoid formation of a primer-dimer.
[0043] According to another embodiment of the present invention, the primers are designed with rich GC content to ensure a strong annealing to the template as well as an efficient and quick polymerization.
[0044] In one embodiment of the present invention, a kit for detecting SARS-CoV-2 in a sample by a reverse transcriptase (RT) triplex polymerase chain reaction (PCR) primers are disclosed. The kit comprises of a primer set selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) prime (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof and a RT triplex PCR reaction composition comprising of 2X master mix with enzymes, MgCl2, template DNA of sample, internal amplification control (IAC) template DNA and a nuclease free water.
[0045] According to an embodiment of the present invention, the kit has additional flexibility to replace conventional Taq DNA polymerase in 2X master mix with enzymes with a Fast Taq DNA polymerase or a Gold Taq DNA Polymerase for ensuring faster polymerization to reduce the assay time.
[0046] In one embodiment of the present invention, a method for detecting SARS-CoV-2 in a test sample by a reverse transcriptase (RT) triplex polymerase chain reaction (PCR) primers are disclosed. The method comprises of extracting a sample RNA sequence of SARS-CoV-2 and running a real-time RT triplex PCR for carrying out amplification and detection of extracted RNA sequence of SARS-CoV-2 using a reaction composition, wherein the reaction composition comprises of 2X master mix with enzymes, MgCl2, template DNA of sample, primer set, internal amplification control (IAC) template DNA and a nuclease free water. The primer set is selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof.
[0047] According to an embodiment of the present invention, the total reaction volume of the RT triplex PCR comprises of 12.5 µl of 2X master mix with enzymes, 0.5 µl of 25mM of MgCl2, 1 µl of 10 mM each primer, 4 µl template DNA of sample, 0.5 µl internal amplification control (IAC) template DNA, nuclease free water to make up the final reaction volume to 25 µl.
[0048] According to an embodiment of the present invention, the initial denaturation for 1 cycle at 94oC for 4 minutes, denaturation for 30 cycles at 94oC for 45 seconds, primer annealing at 56oC for 35 seconds, extension at 72oC for 45 seconds and final extension for 1 cycle at 72oC for 5 minutes.
[0049] According to an embodiment of the present invention, the single RT triplex PCR reaction with three specific independent targets (ORF, S and M genes) ensure a high reliability and specificity.
[0050] According to an embodiment of the present invention, the RT triplex PCR reaction conditions are optimized to a common set of 2X master mix with enzymes and annealing temperature to ensure a good resolution of amplified product for each of the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) in use.
[0051] According to an embodiment of the present invention, the wherein an agarose gel electrophoresis with ethidium bromide (EtBr) or any other DNA inter chelating dye and UV transilluminator is provided for visualization of RT triplex PCR results.
[0052] The kit is based upon the conventional gel PCR employing routinely used thermal cycler. The technical advancement in the process of present invention involves selection of COVID-19 virus specific regions in three different genes, designing of highly optimal primers for their amplification and incorporation of an internal amplification control (IAC) to rule out false negative results. The specific regions selected for primer annealing and amplification are kept of desired amplification product size assuring a minimum difference of 59 base pairs among them for easy readability of result. All the three sets of primers are specifically designed with guanidine and cytosine (GC) rich content and ensure a near common melting temperature (Tm) value and are made to work on a common annealing temperature and other optimized common PCR conditions.
[0053] Primer Designing
[0054] Primer refers to an oligonucleotide that hybridizes to a target sequence, typically to prime the nucleic acid in the amplification process. The unique sets of primers are selected from the COVID-19 GenBank announced sequences (Accession No: NC_045512)
and analyzed using CUSTAL W and DNAstar 5.0 software. The analytical results showed that between 12859 nucleotide (nt) to 13005 nt region of open reading frame 1ab (orf1ab) gene, 1221nt to 1427nt region of spike protein (S) and 253 nt to 569 nt region of membrane protein (M) sequence there are extremely less chances of mutation among the COVID-19 strains and thereby these selected regions appear to be highly conserved for SARS-CoV-2 virus. At the same time, the selected lengths of sequences are also highly optimum for application in various nucleic acid amplification-based assays or methods. The primers are designed for these regions and the sequences are compared using BLAST analysis to further confirm the specificity of SARS-CoV-2 in relation to other closely related viruses. These regions proved to be highly specific only to SARS-CoV-2 virus strains. For the internal amplification control (IAC), the primers were designed from PUC 19 vector. The sequences of these novel set of primers used in this invention are given in table no 1.
Table no 1: The sequences of the novel sets of primers
SEQ. ID No. Primer Sequence (5’ to 3’) Bases
1 Forward 147 (ORF) GGGGGACAACCAATCAC 17
2 Reverse 147 (ORF) ATCTATGTGGCAACGGC 17
3 Forward 206 (S) CAGACAAATCGCTCCAG 17
4 Reverse 206 (S) CCGGCCTGATAGATTTC 17
5 Forward 317 (M) GCTTGTCTTGTAGGCTTG 18
6 Reverse 317 (M) TCACCTGCTACACGCTG 17
7 Forward (IAC 660) CAATTCCACACAACATACGA 20
8 Reverse (IAC 660) CGGATAAGGCGCAGCG 16

Working Example
[0055] Preparation of Sample - RNA Extraction
[0056] The RNA of SARS-CoV-2 was extracted as per commercially available kit or SN Robotic Biomolecule and Cell Separator machine with RNA magnetic bead based extraction kit as per the manufacturer’s protocol.
[0057] Standardization of PCR Conditions
[0058] The standardization of the PCR reaction was carried out by selecting various cycle temperatures and conducted the PCR in combination with different MgCl2 concentrations. In the present invention the total reaction volume of the PCR product was 25 µl containing 12.5 µl of 2X master mix with enzymes, 0.5 µl of 25mM of MgCl2, 1 µl of 10 mM each primer, 4 µl template DNA of sample, 0.5 µl internal amplification control (IAC) template DNA, nuclease free water to make up the final volume of 25 µl. PCR was performed using Applied Biosystems Veriti Thermal Cycler Applied Biosystem(Model No: 9902)with the following standard conditions of 94°C for 4 minutes of initial denaturation for 1 cycle followed by 30 cycles of denaturation at 94°C for 45 seconds, primer annealing at 56ºC for 35 seconds and extension at 72°C for 45 seconds. It was then followed by 1 cycle of the final extension at 72°C for 5 minutes.
[0059] Results
[0060] Result was interpreted in ethidium bromide (EtBr) stain or green dye stain on 2% agarose gel with 0.5x Tris-borate-EDTA (TBE) buffer. The electric pressure was set at 90V and electrophoresis time as 40 minutes then loaded in the gel. The experimental results are shown in figure 1 and 2.
[0061] The Figure 1 illustrates the image representing the amplified products of positive samples in 2% agarose gel in accordance with an embodiment of the present invention. It can be observed that lane 1 shows monoplex amplified at 147bp, lane2 shows monoplex amplified at 206bp, lane monoplex amplified at 317bp, duplex amplified at 147 and 206bp, triplex amplified at 147, 206, 317bp and triplex amplified at 147, 206, 317bp with internal amplification control (IAC) at 660bp and lane 7 shows 100 bp with DNA ladder.
[0062] The Figure 2 illustrates the image representing the amplified products of positive and negative in 2% agarose gel in accordance with an embodiment of the present invention. It can be observed that lane 1 shows amplification of positive samples with internal amplification control (IAC), lanes 2 to 6 shows amplification of negative samples and lane 7 shows 100 bp DNA ladder.
[0063] Overall, the presence of four amplification bands (147 bp, 206 bp, 317 bp and 660bp) indicates a positive result and the presence of single band that is of IAC (660 bp) indicates negative result. Triplex PCR kit specificity and sensitivity was evaluated directly on suspected COVID-19 clinical samples in relation to WHO approved reverse transcriptase Real Time PCR. The sensitivity was also analyzed with various concentration of RNA copy numbers.
[0064] The kit is specifically able to amplify SARS-COV-2specific regions in selected three genes (ORF, S and M genes) and no amplification is observed for the genetic content of other viruses or bacteria.
CLINICAL SAMPLE SAMPLE NO RESULTS SOURCE
Confirm Positive RNA samples 20 All detected SLS diagnostic
Confirm Negative RNA samples 10 Not detected, only IAC was amplified. SLS diagnostic

[0065] The practical applicability of the kit is validated using 30 COVID-19 clinical samples and plausible result are obtained. The developed kit can be provided to any hospitals, clinical laboratory and port of entry, it would be reliably diagnosing patients within 3 hours thereby, initiating highly effective response mechanism to check the spread of disease. , Claims:1. A single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence, comprising:
a sequence selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof.

2. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the primers target the specific regions of open reading frame 1ab (orf1ab) gene, spike glycoprotein (S gene) and membrane glycoprotein (M gene) of the SARS-CoV-2 RNA virus ensuring high specificity and high selectivity.

3. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the primers are short in length with bases varying between 16-18 to ensure rapid amplification, better specificity with minimal secondary structures and motifs.

4. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the IAC primers are incorporated with three sets of viral gene targeting primers with a common lower Tm range, to achieve annealing temperature between 54-56oC, wherein the difference of Tm range between the forward and backward primers in all the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) are kept within the range of 3oC.

5. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the primers are designed to achieve a minimum base pair difference of 59 bases among the selected amplicon sizes of the products.

6. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) are designed to ensure absence of sequence homology to avoid formation of a primer-dimer.

7. The single stranded oligonucleotide DNA primer sets for the amplification of SARS-CoV-2 sequence as claimed in claim 1, wherein the primers are designed with rich GC content to ensure a strong annealing to the template as well as an efficient and quick polymerization.

8. A kit for detecting SARS-CoV-2 in a test sample by areverse transcriptase (RT) triplex polymerase chain reaction (PCR) primers, wherein the kit comprises of:
a primer set is selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof; and
a RT triplex PCR reaction composition comprising of 2X master mix with enzymes, MgCl2, template DNA of sample, internal amplification control (IAC) template DNA and a nuclease free water.

9. The kit as claimed in claim 8, wherein the kit has additional flexibility to replace conventional Taq DNA polymerase in 2X master mix with enzymes with a Fast Taq DNA polymerase or a Gold Taq DNA Polymerase for ensuring faster polymerization to reduce the assay time.

10. A method for detecting SARS-CoV-2 in a test sample by a reverse transcriptase (RT) triplex polymerase chain reaction (PCR) primers, wherein the method comprises of:
extracting a sample RNA sequence of SARS-CoV-2;and
running a real-time RT triplex PCR for carrying out amplification and detection of extracted RNA sequence of SARS-CoV-2 using a reaction composition, wherein the reaction composition comprises of 2X master mix with enzymes, MgCl2, template DNA of sample, primer set, internal amplification control (IAC) template DNA and a nuclease free water,
wherein primer set is selected from a group comprising of forward 147bp (ORF gene) primer (SEQ ID No: 1), reverse 147bp (ORF gene) primer (SEQ ID No: 2), forward 206bp (S gene) primer (SEQ ID No: 3), reverse 206bp (S gene) primer (SEQ ID No: 4), forward 317bp (M gene) primer (SEQ ID No: 5), reverse 317bp (M gene) primer (SEQ ID No: 6), forward 660bp (IAC) primer (SEQ ID No: 6), reverse 660bp (IAC) primer (SEQ ID No. 8) and combination thereof
11. The method as claimed in10, wherein the total reaction volume of the RT triplex PCR comprises of 12.5 µl of 2X master mix with enzymes, 0.5 µl of 25mM of MgCl2, 1 µl of 10 mM each primer, 4 µl template DNA of sample, 0.5 µl internal amplification control (IAC) template DNA, nuclease free water to make up the final reaction volume to 25 µl.

12. The method as claimed in10, wherein a procedure for the RT triplex PCR comprises of:
initial denaturation for 1 cycle at 94oC for 4 minutes, denaturation for 30 cycles at 94oC for 45 seconds, primer annealing at 56oC for 35 seconds, extension at 72oC for 45 seconds and final extension for 1 cycle at 72oC for 5 minutes.

13. The method as claimed in 10, wherein the single RT triplex PCR reaction with three specific independent targets (ORF, S and M genes) ensure a high reliability and specificity.

14. The method as claimed in 10, wherein the RT triplex PCR reaction conditions are optimized to a common set of 2X master mix with enzymes and annealing temperature to ensure a good resolution of amplified product for each of the four sets of primers (SEQ ID Nos: 1, 2, 3 and 4) in use.

15. The method as claimed in 9, wherein an agarose gel electrophoresis with ethidium bromide (EtBr) or any other DNA inter chelating dye and UV transilluminator/ gel dock is provided for visualization of RT triplex PCR results.

Dated this 22nd day of August 2022

Signature

Jinsu Abraham
Patent Agent (IN/PA-3267)
Agent for the Applicant

Documents

Application Documents

# Name Date
1 202241047792-STATEMENT OF UNDERTAKING (FORM 3) [22-08-2022(online)].pdf 2022-08-22
4 202241047792-Sequence Listing in PDF [22-08-2022(online)].pdf 2022-08-22
5 202241047792-PROOF OF RIGHT [22-08-2022(online)].pdf 2022-08-22
6 202241047792-POWER OF AUTHORITY [22-08-2022(online)].pdf 2022-08-22
7 202241047792-FORM FOR STARTUP [22-08-2022(online)].pdf 2022-08-22
8 202241047792-FORM FOR SMALL ENTITY(FORM-28) [22-08-2022(online)].pdf 2022-08-22
9 202241047792-FORM 1 [22-08-2022(online)].pdf 2022-08-22
10 202241047792-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [22-08-2022(online)].pdf 2022-08-22
11 202241047792-EVIDENCE FOR REGISTRATION UNDER SSI [22-08-2022(online)].pdf 2022-08-22
12 202241047792-DRAWINGS [22-08-2022(online)].pdf 2022-08-22
13 202241047792-DECLARATION OF INVENTORSHIP (FORM 5) [22-08-2022(online)].pdf 2022-08-22
14 202241047792-COMPLETE SPECIFICATION [22-08-2022(online)].pdf 2022-08-22
15 202241047792-FORM-26 [15-09-2022(online)].pdf 2022-09-15
16 202241047792-FORM-8 [08-04-2025(online)].pdf 2025-04-08