Sign In to Follow Application
View All Documents & Correspondence

A Simple Two Plasmid Mammalian Expression System For Production Of Recombinant Proteins And Viruses

Abstract: Reverse engineering has offered new ways of studying the pathobiology of RNA viral infections new more efficient means of synthesizing recombinant viruses and developing vaccines and also demonstrated the versatility and efficiency of RNA dependent RNA polymerase RDRP system as an expression system. However the currently used methods require a repertoire of complex difficult to use tools. Present invention describes a simpler plasmid based mammalian expression system that uses the RDRP enzyme activity for expression of recombinant proteins or RNA from viral minigenomes and rescue of recombinant viruses from cDNAs encoding entire genome(s) of negative stranded RNA viruses. This system will be useful for expression of recombinant proteins therapeutic RNA molecules including anti sense and/or selective interefering RNA and Ribozymes. This system can also be used for gene therapy and producing recombinant viruses for production of new vaccines.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
05 November 2013
Publication Number
24/2015
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2022-03-29
Renewal Date

Applicants

JOSHI Vishwas
204 2A Siddhachal PH VI Pokharan Road no.2 Thane Maharashtra 400610 India.

Inventors

1. JOSHI Vishwas
204 2A Siddhachal PH VI Pokharan Road no.2 Thane Maharashtra 400610

Specification

FORM 2
THE PATENTS ACT-1970
(39 of 1970) &
The Patent Rules, 2006
COMPLETE SPECIFICATION
(See Section 10 and Rule 13)
1. TITLE OF THE INVENTION
A simple two plasmid mammalian expression system for production of recombinant proteins and viruses
2. APPLICANT

a) Name Vishwas Dattatraya Joshi
b) Nationality Indian
c) Address 204, 2ASiddhachal, PH-VI, Pokharan Road No.2, Thane, 400610
3. PREAMBLE TO THE DESCRIPTION
The following specification particularly describes the invention and the manner
in which it is to be performed

Title:
A simple two plasmid mammalian expression system for production of recombinant proteins and viruses
Field of Invention:
The present invention relates to a two plasmid mammalian expression system. Moreover invention relates to production of recombinant proteins and viruses. Moreover the present invention relates to a mammalian expression system incorporating methodology for ^constitution of Ribonucleic acid (RNA) dependent RNA polymerase enzyme of negative stranded RNA viruses and its exploitation as a mammalian expression system for the production of proteins, RNA molecules and recombinant viruses.
Background of Invention:
Advances in molecular biology and genetic engineering led to the development of "Reverse Genetics", a process of generating recombinant viruses from a cloned complimentary DNA (cDNA) copy of a viral genome. It has helped understand the molecular determinants related to virus attenuation, tissue tropism virulence factors and in recent years, accelerated the development of virus vaccines by enabling easy modification of viral genomes through manipulation of its cDNA. Reverse genetics has made it possible to produce recombinant viruses with attenuating mutations or chimeric viruses . expressing heterologous genes for use as new viral vaccines or therapeutic agents.
Morbilli viruses (Measles Virus and Rinderpest Virus)
MV and RPV are members of the genus morbillivirus of family Paramyxoviridae. Their genetic information is encoded on a single stranded RNA genome of antisense polarity and comprises 15894 (MV) and 15882 (RPV) nucleotides respectively. Their genome has unique highly conserved 3' and 5' termini called leader and trailer respectively and encodes 6 genes - N (nucleocapsid protein), P (phosphoprotein), M (matrix protein), F (fusion protein), H (hemagglutinin) and L (large protein=polymerase) - separated by similarly conserved intergenic sequences. In infected cells, viral RNA dependent RNA polymerase (RDRP) initiates transcription of genomic RNA from its promoter present within the leader sequence and produces messenger ribonucleic acid (mRNA) molecules which are translated into corresponding proteins by the cellular ribosomes. At some point in the viral lifecycle and after adequate pools of viral proteins are synthesized, the RDRP enzyme switches mode and initiates replication from another promoter present within the leader sequence of the genomic RNA. Although the exact mechanism(s) regulating the initiation of transcription or replication of viral RNA and transcription start and stop at gene boundaries is poorly understood, the conserved sequences which serve as promoters for transcription and replication and sequences which dictate the transcription start and end at each gene boundary are clearly defined in case of most negative stranded RNA viruses in general and MV and RPV in particular. It is well established that addition of these sequences to any unrelated RNA molecule forms a "virus genome tike replicon" which can be transcribed and replicated by its cognate RDRP.
MV causes an acute febrile illness in infants and young children. Its prevalence can be controlled very effectively by vaccination. Most of the currently used live attenuated vaccines including the Schwartz, Moraten, and Edmonston-Zagreb strains are derived from the original Edmonston strain

(Enders and Peebles, 1954) by multiple passages in non human cells (Enders, 1962), However, according to the estimates of the World Health Organisation (WHO), one million young children die every year from measles mainly in developing countries. But in recent years developed countries such as the USA with incomplete adherence to vaccination have seen emergence of measles related deaths (Clements and Cutts, 1995). For a recent discussion of MV vaccinology including future trends see Norrby (1995). During the past 60 odd years, Measles vaccine has been administered in over 700 million children and has proved to be highly effective, usually providing life-long immunity against MV reinfection.
RPV causes cattle plague - an infectious viral disease of cattle, buffalo and other wild life species and is mainly India, Africa and other tropical countries. It is characterized by fever, oral erosions, diarrhea, lymphoid necrosis and high mortality. Two vaccines - Plowright (Plowright and Ferris, 1962) and Lapinized (Scot 1963) have been widely used to protect against rinderpest. The Plowright vaccine derived by attenuation of RBOK strain of RPV has proved to be most effective {Baron et al, 2005). Wide spread use of these vaccines helped irradicate RPV from several countries including India by 2000. However, its reemergence in 2003 has led to resumption of mass vaccinations of cattle and other susceptible animals (Kock et al, 2006).
The proven safety and efficacy of these vaccines, supports their use as an ideal vector for the expression of heterologous genes. Reverse genetics offers a powerful approach for developing recombinant MV or RPV useful as potential vaccines against unrelated diseases and/or therapeutic agents in man and animals-Reverse genetics was first used to generate RNA viruses by Racaniello and Baltimore in 1981 in case of Poliovirus. Subsequently, several other positive-sense RNA viruses were generated using synthetic RNA produced by T7 or T3 RNA polymerase (Racaniello, V. R. & Baltimore, D., 1981) from a cloned cDNA. Generation of negative stranded RNA viruses however, proved more difficult. Unlike positive stranded RNA viruses, the genome of negative sense viruses cannot be translated by host cells and is not infectious. It must be supplied in the form of ribonucleoprotein (RNP) complexes containing the nucleoprotein and the viral RDRP proteins to allow its transcription and replication and subsequent virus formation. Enami et al, (1990) developed the first reverse genetics system to produce influenza virus (which consists of 9 genomic RNA subunits). Its RNPs are small in size and can be assembled in vitro from RNA and required viral proteins - N and the polymerase components. Initially an artificial RNA carrying a reporter gene -* chloramphenicol acetyl transferase (CAT) sequence embedded in viral non-coding terminal sequences of the influenza virus genome subunit was used (Luytjes et al., 1989). Later, single authentic or altered genome subunit RNAs transcribed in vitro from cloned DNA were also used (Enami and Palese, 1991). The assembled RNPs replicated and transcribed upon transfection into influenza-infected celts, as monitored by CAT production and by rescue of a influenza virus, respectively. Purification of virus containing the introduced subunit from the vast excess of non-reassorted virus in some cases can be accomplished by selection, for example, using a specific neutralising antibody directed against the protein encoded by the cognate subunit of the helper virus.
The RNP s of nonsegmented negative-strand RNA viruses (Mononegavirales) contains in addition to N protein, the assembly and polymerase cofactor phosphoprotein (P) and the viral RNA polymerase (large protein L) and are more difficult to assemble in vitro from synthetic RNA and individual proteins. Therefore, many researchers preferred to use smaller subgenomic RNAs (viral minigenomes) containing the essential sequences of viral genome produced during virus lifecycle were used. They were then

substituted by artificially transcribed RNA molecules from DNA constructs containing reporter genes and viral essential non-coding sequences (replicons). Replication of such replicons carrying the CAT coding sequence and viral noncoding terminal sequences was achieved for Sendai virus (Park et al., 1991), Sendai virus (SeV), respiratory syncytial virus {Collins et a!., 1993; Collins et al., 1991), human parainfluenza virus 3 [Dimock and Collins, 1993), rabies virus (RV) [Conzelmann and Schnell, 1994) and MV {Sidhu et al., 1995).
A similar system was used to rescue vesicular stomatitis virus (VSV) (Lawson et al., 1995; Schnell, et al, 1994) and rabies virus (RV) entirety from a full length cDNA clone of viral genome under the control 17 RNA polymerase promoter. The components of the viral polymerase complex including the nucleoprotein (NP) were provided from protein expression plasmids that were controlled by T7 RNA polymerase promoter. Soon other researchers also reported generation of non-segmented negative-sense RNA viruses from cloned genomic cDNA for vesicular stomatitis virus (Whelan, et al, 1995}, measles virus (Radecke et al, 1995), respiratory syncytial virus (Collins, et al, 1995), sendai virus (Garcin, et al, 1995; Kato et at, 1996), rinderpest virus (Baron & Barrett 1997), human parainfluenza virus (Hoffman et al, 1997; Durbin et al, 1997), simian virus (He et al, 1997), newcastle disease virus (Peeters, et al, 1999) and human severe acute respiratory syndrome corona virus (Yount, et al, 2003).
These demonstrations and other studies of reconstitution of RNA dependent RNA polymerase (RDRP) enzyme activity and its ability to rescue corresponding RNA viruses or non-viral reporter proteins from minireplicons have establish the RDRP enzyme as a powerful versatile system for expression of recombinant proteins either atone or as integral parts of rescued viruses.
The most common methodology used for this purpose, uses transfection of multiple plasmids -one expressing the substrate RNA (a cDNA encoding viral genome or an artificial replicon) and others expressing the viral RDRP complex proteins - viz. the nucleocapsid (N or NP protein), the phosphoprotein (P) and the large polymerase (L) protein and an external T7 RNA polymerase (T7RNAP) to allow expression from these plasmids. The T7 RNAP is used for multiple reasons - (1) its high efficiency, (2) its ability to synthesize RNA with correct 5' terminus identical to viral genome and (3) its ability to transcribe DNA molecules within the cytoplasm thus eliminating modifications of vRNA by RNA splicing, polyadenylation or other mechanisms.
T7RNAP is not a mammalian enzyme. Therefore Pattnaik et al, (1990) used a recombinant attenuated vaccinia virus (W) (e.g. MVA/T7). It was used for recovery of VSV (Lawson et al, 1995) and rabies virus (Conzelman, US Pat. No. 6,033,886), RSV (Collins et al, 1995), the SV5 (He et al, 1997), HPIV-3 (Durbin et al, 1997), rinderpest virus (Barn and Barrett 1997) and measles virus (Schneider et al, 1997), mumps virus (Clarke et al, 2000), CDV (Gassen et al, 2000), HP1V-2 (Kawano et al, 2001) and BPIV-3 (Schmidt et al, 2000). Similarly, a recombinant fowlpox virus expressing T7RNAP has also been used to supply T7RNAP for recovery of newcastle virus (NDV) (Peeters et al. 1999) and of a chimeric rinderpest virus (Das et a!. 2000).
The recombinant viruses produced using this approach are mixed with vaccinia virus and are difficult to purify which can be a major problem - especially if the recombinant viruses are required for preparing immunogenic compositions or gene therapy vectors. Moreover, this helper vaccinia virus kills the host cells limiting the efficiency of recombinant virus production. Therefore, it would be desirable to eliminate the use of helper virus supplying T7 RNA polymerase. Three different approaches have been used to eliminate the use of externally supplied T7RNAP altogether.

Radecke et al, (1995) produced a helper cell line constitutive^ expressing'T7RNAP and Measles virus (MV) N and P proteins (WO 97/06270} and introduction of a pfcsmid encoding the entire (+) strand sequence of MV genome linked to T7RNAP promoter and another piasmid encoding MV L protein alone is sufficient to rescue recombinant MV. However, the efficiency of tP's helper cell line is usually limited and requires to be enhanced by giving a heat shock (Parks et al, 19^9)- Als0* this cell line is only useful for rescue of MV. In contrast, the helper BHK-21 cell line (BSR T7/5) 5tab|y expresses only the T7RNAP and can be used for rescue of different viruses as shown in case of BRSV (Buchholz et al. 2000), rabies virus (Finke and Conzelmann 1999), VSV {Harty et al. 2001), NDV (F*omer-Oberdorfer et al. 1999), and Ebola virus (Volchkov et al. 2001). It can be used to reconstitute RpRP of any virus by co-transfecting with plasmids encoding appropriate N, P and L proteins.
Second approach involves the use of RNA polymerase I (RlJAPI). RNAPI is usually involved in transcription of ribosomal genes in mammalian cells. The RNAs synthesized by RNAPI do not contain the 5' methyl cap structure and.3' poly-A tail. The transcription initiatior1 and termination signals for RNAPI are precisely defined and RNA molecules produced by inserting viral genomic or genome like cDNA molecules in between rRNA promoter and terminator signals possess authentic viral 5' and 3' ends, does not require further processing and can be used as a substrate direct 1/ bY viral RDRP if expressed. (Zobel
Therefore, RNAPI transcription has been used to synthesize viral genomic or genomic like cDNA from plasmids and used for rescue of viruses in case of Influenza virus (Neumann et al, 1999), Borna disease virus and MV (Martin et al, 2006, J Virol. 80:5708-5715).
More recently, Martin et al, (2006) have used a third strategy to express viral genomic RNA from transcripts produced by RNA polymerase II (RNAP II). They P,aced a hammerhead ribozyme immediately upstream of and a genomic hepatitis delta virus ribozyr06 immediately downstream of the virus genomic sequence. These ribozymes cleaved a genomic RNA wth authentic 3' and 5' ends from the RNA transcribed by RNAP II.
Such strategies eliminate the need for helper virus but stil1 require separate helper plasmids expressing the viral N, P and L proteins. Transfection of so many plasmids simultaneously in a cell and ensuring useful levels of expression of the desired proteins for effi<;ient reconstitution of RDRP can be difficult. Availability of a single helper piasmid expressing all de*ired genes will help increase the efficiency of virus rescue by ensuring that all transfected cells will receive the entire complement of helper proteins necessary for reconstitution of RDRP enzyme activity.
This requirement for multiple plasmids has also restricted lne use of RDRP based systems to virus rescue, where as studies with artificial replicons encoding reporter proteins has shown that RDRP mediated expression systems can allow high levels expression of rec;ombinant"proteins. Availability of a single helper piasmid / reagent to supply the required N, P and L proteins will help expand the scope of using RDRP enzyme for large scale expression of recombinant proteir>s- Therefore, there exists a need in the art for new simpler methods and reagents which will allow efficient reconstitution of RDRP activity and its exploitation for expression of recombinant proteins, f*NA molecules and/or rescue of recombinant viruses.
Here, we describe the preparation and use of simple easilY manipulatable piasmid vector systems which can be used for reconstitution of RDRP enzyme activity and its rescue for expression of recombinant proteins, RNA molecules and rescue of recombinant viruses. For this purpose, we have

used the RDRP system of 2 viruses - Measles virus (MV) and Rinderpest virus (RPV) as models. These plasmids can be easily modified to express either non-viral proteins, RNA molecules or the entire viral genomes. This vector system will be useful in development of applications related to protein expression and/or generation of recombinant modified viruses (virus rescue) expressing additional proteins and/or RNA molecules useful for vaccination or other therapeutic purposes.
4. Object of the Invention:
The main object of the present invention is to provide two piasmid mammalian expression . system for production of recombinant proteins and viruses
Another object is to provide a method for reconstitution of RNA dependent RNA polymerase and its exploitation as a mammalian expression system.
A further, object of the inventions is to provide a mammalian expression system for the expression of recombinant proteins, nucleic acid, viruses, RNA molecules.
Still further object of the invention is to provide a mammalian expression system for the intracellular expression of RNA molecules like aptamers, antisense RNA, miRNA, siRNA, ribozymes etc
Yet another object of the invention is to provide reagents for production of recombinant viruses useful as vaccines or therapeutic agents.
Another object of the invention is to describe the process of the preparation of such a mammalian expression system.
5. Summary
The present invention features the use of RNA dependent RNA polymerase enzyme of morbilliviruses for expression of proteins, RNA molecules and production of recombinant viruses in mammalian cells. In one aspect this provides a piasmid DNA molecules which expresse the N, P and L proteins of MV. In another aspect of this invention, it provides another piasmid which expresses easily manipulatable RNA substrate of RDRP which can be used for production of any protein, RNA or modified virus. These plasmids may be used as a reagent kit for expression of proteins or RNA molecules or production of recombinant viruses or combination thereof. Further this invention provides a method for using these plasmids for intracellular expression of RNA molecules which may be useful for modulation of cellular gene expression. These plasmids may be used in the form of cloning kits.
The following terms/abbreviations used in the specification have meanings attributed to them as mentioned hereinbelow.
MV: Measles Virus, RPV: Rinder Pest Virus, RNA: Ribonucleic acid, DNA: Deoxyribonucleic acid, RDRP: RNA Dependent RNA Polymerase, cDNA: Complimentary DNA, -VRNA: Negative sense Viral RNA, RNP: Ribonucleoprotein, P: Phospho Proteins, L: Large Polymerase Proteins, N: Nucleocapsid, CMV:Cytomegalovirus, IRES: Internal Ribosomal Entry Site, CHO Cell Line: Chinese Hamster Ovary Cell Line, RNA Pol I- RNA Polymerase I, MOl: Multiplicity of Infection, siRNA: selective interfering RNA, miRNA: micro RNA, 6FP : green fluorescent protein, HGH:.human growth hormone

Brief description of the drawing
Fig 1: Schematic diagram of the cloning plasmids encoding the Measles Minireplicon encoding 2 reporter
genes.
A. Basic replicon Design
B. Construct 1: HH-replicon-HDV
C. Construct 2: PIP-replicon-PIT
Fig 2: Schematic representation of the Cloning Plasmids created.
Cloning Plasmid 1: Vector pUC57 was used to clone PlPJteplicon_PlT construct. Cloning plasmid 2: Vector pIRES was used to prepare plRES_PlP_Replicon_PlT construct. Cloning plasmid 3: Vector pIRES was used to prepare plRES_HH_Replicon_HDV.
Fig 3: Synthesis of cDNA of entire MV-E genome
Fig 3a: Generation of cDNA encoding the entire antigenome of MV-E; Viral RNA was purified using Genejet RNA purification kit (Fermentas) and reverse transcribed using Superscript II and random hexamer primers. This was used to amplify seven overlapping fragments with Superscript III and specific primers and cloned into pCDNA3.1 in which the multiple cloning site was replaced with a Nhe i_Not l_Pac l_Pme I linker.
Fig 3b: Plasmid encoding cDNA of MV-E genome: cDNA encoding entire antigenome of MV-E was synthesized by assembling seven overlapping PCR amplified fragments and cloned in Not I and Pme I sites of pCDNA 3.1(-)
Fig 4: Schematic representation of the two variants of Helper plasmid created.
Helper Plasmid 1: Vector pBiCMV-1 was used to prepare pBiCMV_MV-N_MV-P_IRES_MV-L Helper plasmid 2: Vector pIRES was used to prepare plRESJv1V-N_p2A_MV-P_MV-L
Fig 5: Vero cells were co-transfected with Cloning plasmid encoding eGFP and HGH and HPV1 or HPV 2, incubated for 48 hrs at 37°C and observed for fluorescence and HGH. A: pUC 18 alone; B: pGFP (positive control); C: pUC_PlP-replicon-PlT alone; D: pUC-PlP-replicon-PlTand Helper HPV; E: pIRES-HH-replicon-HDV alone; F: pIRES-HH-replicon-HDV and HPV. Note: Helper plasmids 1 and 2 both were able to supply the N, P and L proteins. Representative pictures of HPV1 alone are shown as they were similar.
Fig 6: Rescue of segmented MV: Equal quantities of plasmids pCDNA_MVgenome, Cloning plasmid 1 (plRES_HH-replicon-HOV) and HPV 1 were.cotransfected into Vero ceils using Xfect, incubated at 37°C and observed daily for formation of syncytia. MV-E was harvested from the culture supernatant after syncytia formation covered > 80% - 90% and titrated using TCID50. Cells were observed simultaneously for expression of EGFP plasmid.
A: Vero cells transfected with pUC-PlP-rep-PIT, pCDNA-MVgenome & Helper plasmid variant 1; B: Vero cells transfected with pIRES-HH-rep-HDV, pCDNA-MVgenome & Helper plasmid variant 1.
Detailed description and examples
The present invention relates to expression system that can be easily used for cellular reconstruction of the RDRP enzyme activity for the expression of recombinant proteins or virus rescue. It comprises of two plasmids -1. helper plasmid which expresses N, P and L proteins of MV virus and 2. a Cloning Plasmid which expresses easily manipulatable viral RNA or viral like RNA molecule

(minireplicon). The cloning plasmid contains multiple cloning sites (MCS) for easy insertion of DNA encoding target niolecule to be expressed. Here MV and RPV are used as model system.
EXAMPLES
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
1. Cells and Viruses
Vero (African green monkey kidney) cells were grown as monolayers in Dulbecco\'s modified Eagle\'s medium (DMEM) supplemented with 5% fetal calf serum (FCS). MRC5 cells were grown as monolayers in DMEM supplemented with 10% FCS. Measles virus (Edmonston) {MV-E) strain was purchased from Serum Institute of India (MVAC, 103 TCID50/vial). To prepare a seed stock, Vero or MRC5 cells were seeded in 25 sq. cm flasks at 105 cells/flask and incubated for 36 hrs. Cells were then washed with HBSS and seeded with MV-E at a MOI of 0.1 and supplemented with serum free DMEM. Virus was harvested at 24 hr intervals. Virus collected over 72 hrs was pooled together, quantitated and used as seed stock.
2. Plasmid Constructions
2.1 Cloning Plasmid
2.1.1 Designing thereplicon construct
The MV leader (ntds 1 to 107), MV trailer (ntds 15786 to 15894) and the intergenic region between the protein coding regions for MV-N and MV-P proteins (ntd. No 1686 to 1806) were selected from the AY 486084.1 sequence from Genbank {Baricevic et al, 2005). Coding regions for the green fluorescence protein (eGFP) and human growth hormone (HGH) to be used as reporter proteins were isolated from U55762.1 and NM-000515.3 respectively. All these sequences were assembled in silico into a MV-E genome like replicon containing 2 gene cassettes. Nucleotide sequences corresponding to recognition sites for Afe I, Age I, Asc I, Mlu I, Nru I, Per 1, Sac II, Xho I, Eco Rl, Pac I, Pme I, Pml I, Sbf I and Xba I were arranged into 2 oligonucleotides to synthesize 2 multiple cloning sites {MCS1 and MCS 2) and inserted in the replicon around the EGFP and HGH genes. As a result, the EGFP protein appeared to have been cloned within the MCS1 region at Asc I site and HGH protein within MCS 2 at Pac I site (Fig 1A). The sequence of the replicon without the reporter genes is given in Seq ID No. 1. The sequence corresponding to a 5' hammer head ribozyme was reconstructed from Combredet et al,
(2003) and attached at the 5' end of the replicon. Similarly, sequence for 3' hepatitis delta virus
ribozyme was adopted from Walker et al, (2003) and appended at the 3' end of replicon to generate a
HH-replicon-HDV construct (Fig IB; Seq ID No. 2)
Sequences encoding the promoter for Chinese hamster RNA polymerase I (PIP) was selected from Tower et al, (1989) and a terminator sequence for murine RNA polymerase I terminator (PIT) was selected on basis sequences described by Grummt et al, (1985,1986). The PIP sequence was added at immediately upstream of the 5' terminus (immediately upstream) and PIT sequence was appended immediately downstream of the 3' terminus of replicon to create PIP-replicon-PIT construct (Fig 1C; Seq ID No. 3).
2.1.2 Synthesis of Cloning Piasmids
Sequences corresponding to the HH-replicon-HDV (between Eco Rl & Hind 111 sites) and PIP-replicon-PIT (between Sac I and Hind 111 sites) were synthesized using the gene synthesis method of Young and Dong
(2004) and cloned into pUC57 to create pUC_HH-replicon-HDV and pUC_PlP-replicon-PlT respectively.

They were then subcloned in between Nhe I and Not I sites of plRES vector from Clonetech to generate plRES_HH-replicon-HDV and plRES_PlP-replicon-PlT plasmids. These plasmids were used for testing the RNA dependent RNA polymerase (RDRP) mediated expression of GFP and HGH proteins in mammalian cells.
After confirming that these plasmids expressed GFP and HGH under the control of RDRP, the genes for EGFP and HGH were removed by sequential digestion and ligation with Asc I and Pac I to create 3 variants of cloning plasmids - Cloning Plasmid variant 1 (HH-replicon-HDV) and Cloning plasmid variant 2 (PIP-replicon-PIT) and Cloning Plasmid Variant 3 (pUCJ>lP-replicon-PlT). The different plasmids created are listed in Table 1.
No Name Description Sequence No
! 1 Cloning plasmid 1 Replicon under the control of CHO cellular RNA Seq ID No. 6
i {pUC-PlP-Rep-PIT) polymerase I promoter and murine RNA
| polymerase I terminator in pUC57 without
i
1 reporter genes
2 pUC-HH-Rep-HDV Replicon flanked by Hammerhead and Hepatitis Seq ID No. 7
Delta virus ribozymes at the 5' and 3' termini and
cloned in pUC57 vector without reporter genes
. 3 Cloning plasmid 2 Replicon under the control of CHO cellular RNA Seq ID No. 5 j
(pIRES-PlP-Rep-PlT) polymerase I promoter and murine RNA |
i polymerase I terminator subcloned into the Nhe I i
i
, and Not I sites of plRES vector from Clonetech
i
\ without reporter genes
4 Cloning plasmid 3 Replicon flanked by Hammerhead and Hepatitis Seq ID No. 4
(pIRES-HH-Rep-HDV) Delta virus ribozymes at the 5' and 3' termini
subcloned into the Nhe I and Not I sites of plRES '
vector from Clonetech without reporter genes
\ 5 Cloning Plasmid 1 with Replicon containing reporter genes eGFP and
! reporter genes HGH under the control of CHO cellular RNA
i Polymerase I promoter and murine RNA j
I polymerase 1 terminator cloned in pUC57 I
6 Cloning Plasmid 2 with Replicon containing reporter genes eGFP and Seq No F
reporter genes HGH under the control of CHO cellular RNA
Polymerase I promoter and murine RNA
polymerase I terminator subcloned into Nhe I and
Not I sites of plRES vector from Clonetech.
'■ 7 Cloning Plasmid 3 with Replicon containing reporter genes eGFP and Seq No. G j
j reporter genes HGH flanked by Hammerhead and Hepatitis Delta !
j virus ribozymes at the 5' and 3' termini subcloned
into the Nhe I and Not I sites of plRES vector from
I . i
I Clonetech I
Table 1: Different Mini re pi icon plasmids created.

2.1.3 Synthesis ofcDNA of entire MV-E genome
The MV-E cDNA was cloned from viral particles purified from a batch of MV-E vaccirepurchased from the Serum Institute of India, Pune, India. Viral RNA was extracted from 10s lysed virus particles using GeneJet RNA purification kit (Fermentas) according to the manufacturer's RNA purification kit according to the manufacturer's protocol. The viral RNA was reverse transcribed into cDNA using random hexamers and Superscript II DNA polymerase. As Seven overlapping cDNA fragments covering the entire viral genome (as shown in Fig 3a) were generated by PCR using PfuTurbo DNA polymerase and the following primers
fl) 5'-GCGGCCGCACCAAAC-3'; (2) 5'-CCTGACCGCGGATGC-3'; {3} 5'-ACCTCGCATCCGCGG-3';
(4) 5'-CCTCCAGAGTAATCGATTAAGG-3'; (5) 5'-AATCGATTACTCTGGAGGAGCAG-3';
(6) 5'-CTTGCACCaAAGTTTTAATTAACTAC-3'; (7) 5'-GAACAATATCGGTAGTTAATTAAAAC-3';
(8) 5'-TGAGGGACTCGAGCATACTC-3'; (9} S'-ATAAGATAGTAGCCATCCTGGAGTAT-3';
(10) 5'-GTAGGGCCATGTGCTGGG-3'; (11) 5'-CATAGCCGTAACAAAAAGGGTAC-3';
(12) 5'-GAGCATCAAGTGAAGGACCATG-3'; (13) 5'-GCATTGTGGTATTATAGAGCCTATC-3';
(14) 5'-CGGTTTAAACCAGACAAAGCTG-3'
The multiple cloning site from the plasmid pCDNA3.1(-) was removed by digestion with Nhe I and Pme I and replaced it with a linker containing Nhe I- Not l-Pac l-Pme I sites pCDNA-Not_Pac_Pme. The fragments generated by using different primer pairs 7, 8 (Pac I, Xho i), 9,10 {Xho I, Kpn I), 11,12 (Kpn I, Nco I) and 13, 14 (Nco I, Pme I) and ligated into a Pac I - Pme I digested pCDNA-Not_Pac_Pme to generate a plasmid with the nucleotides from Pac I to the 3' end of the MV-E antigenome called pCDNA_Not_Pac_MVg_Pme. The fragments generated by other three pairs -1,2 (Not I, Sac II), 3, 4 (Sac II, Cla I), 5, 6 (Cla I, Pac I) were ligated into the Not I - Pac I digested pCDNA_Not_Pac_MVg_Pme plasmid to create pCDNAJvlVgenome (Fig 3b). 2.2 Helper plasmid
RNA was prepared from the purified MV-E virus purchased from Serum Institute of India, Pune, India using the GeneJet RNA purification kit (Fermentas) according to the manufacturer's protocol. 1 ug RNA was reverse transcribed using random hexamers and amplified using primers specific for the N (F: 5-GCTAGCATGGCCACACTTTTAAGG-3' and R 5l-GCGGCCGCCTAGTCTAGAAGATT-31 P (F 5-GCTAGCATGGCAGAAGAGCAGG-3',R 5'- GCGGCCGCaACTTCATTATTATC-31) and L (F 5-GCTAGCATGGACTCGCTATCTGTCAAC-3, R 5- GCGGCCGCTTAGTCCTTAATCAG -3) protein coding regions using Superscript III (Invitrogen) as described by Martin et al, (2006) and Combredet et al (2003) using standard molecular cloning techniques. Amplified cDNAs were cloned in between the Nhe I and Not I sites of pIRES vector (Clonetech) to generate plRES_N, plRES_P and plRES_L plasmids. 2.2.1 Synthesis of Helper plasmid variant 1
N protein gene was amplified from plRES_N and subcloned into Eco Rl and Pst I sites of pBiCMVl to generate pBiCMV_N plasmid. The P protein sequence was then amplified and cloned in Nhe 1 and Eag I sites to create the pBiCMV_ NP construct. The L protein sequence was then subcloned in the Eag I and Sal I sites of pBiCMV_ NP plasmid to generate pBiCMV_NPL plasmid. This plasmid contains a bidirectional CMV promoter and can express the N and P proteins. However, the L sequence will be

transcribed as a bicistronic RNA with P and will not be translated. Therefore, a mammalian beta globin IRES element (ires) described first by Chappell et al, (2000) and later on confirmed by Touzfet et al, (2008) to promote efficient translation was inserted immediately upstream of L coding region. An oligonucleotide encoding a pentameric IRES element flanked by a site for Eag 1 at 5' end and the first 10 nucleotides of L protein at 3' end (5' GGCCGTTCTG ACATCCGGCG GGTTTCT6AC ATCCGGCGGG TTTCTGACAT CCGGCGGGTT TCTGACATCC GGCGGGTTTC TGACATCCGG CGGGTGACTC ACAACGGATC CAACAGACAT ATGGACTCGC 3') was synthesized and inserted by site directed mutagenesis into pBiCMVJMPL to generate create pBiCMV_NPiresL plasmid which will also be called Helper Plasmid Variantl(HPVl)(SeqlDNo.8). 2.2.2 Synthesis of Helper plasmid variant 2
N protein sequence was amplified and subcloned in between the Nhe I and Xho I sites to obtain plRES_ N. P protein sequence was then amplified from plRES_P and cloned into the Eco Rt and Mlu I sites to create plRES_NP. Finally, the L sequence was amplified from pIRESJ. and cloned into plRES_NP between the Sal I and Not I sites to obtain plRESJJPL. In this form, this plasmid will express N and L proteins but not P. Therefore, a strategy based on the recently described 2A peptide vectors was used to promote the expression of P protein (szymczak and Vignali (2005)). The N and P open reading frames from plHESJiPL were fused by inserting the oligonucleotide ( 5' ATCTTCTAGA CGGCTCCGGA GCCACGAACT TCTCTCTGTT'AAAGCAAGCA GGAGACGTGG AAGAAAACCC CGGTCCCATG GCAGAAGAGC A 3') which encodes the porcine teschovirus 2Apeptide described by Szymczak et al (2007) flanked on the 5' end by the codons immediately before stop codon of MV N protein and on the 3' end by the first few codons of MV P protein by site directed mutagenesis to fuse the N and P protein regions into a single N2AP fusion protein and obtain p!RES_N2aPL plasmid which will also be called Helper Plasmid Variant 2 (HPV2) (Seq ID No. 9).
The plasmids HPV1 (pBiCMV_NPiresL) and HPV2(plRES_N2aPL) are represented schematically in Fig 4. 2.23 Synthesis of equivalent helper plasmids encoding N, P and L proteins of other negative stranded RNA viruses
The cloning strategy used for generation of these helper plasmids was then tested for its applicability to other negative stranded RNA viruses - mainly MV, Rinderpest (RPV); peste des pettts ruminants (PPRV) canine distemper (CDV), newcastle disease (NDV) and sendai viruses (SeV). Coding regions of the nucleocapsid, phosphoprotein and large proteins were analysed for the presence of restriction enzymes Eco Rl, Pst I, Nhe I, Eag l,.Sa! 1, Xho I, Mlu I and Not I.
Sites for Eco Rl and Pst I were absent in the nucleocapsid proteins of MV and CDV. Similarly, sites for Nhe I and Xho I were absent in the nucleocapsid proteins of MV and SeV. However, variable number of sites for enzymes Eco Rl, Pst I, Nhe I and Xho I were detected in the nucleocapsid of other viruses (Table 2).

Virus Gen bank No EcoRI PstI Nhel Xhol
1 MV AY 486084.1 RPV AB 547190.1 „ ° _ ° ° ° J "l 3 "~l"~" ~ "~0
, PPRV HQ197753.1 *„-Jv "A"B 687721.2 0 2.0 1 j 0 12 0
| NDV HQ008337.1 0 0 '"l 2 j

Sendai NC_001552.1 0 1 0 0
Table 2: Presence of sites for Eco Rl, Pst 1, Nhe 1 and Xho 1 protein of various negative stranded RNA viruses in the N
Sites for enzymes Eag I, Sal I and Not I were absent from the L proteins of MV, PPRV, CDV and NDV. RPV and SeV contained 1 site for Sal I in their L proteins (Table 3).

Virus Gen bank No Eagl Sail Notl
MV AY 486084.1 RPV AB 547190.1 0 0 0 1 ..... °. .
1
PPRV HQ197753.1 CDV AB 687721.2 0 0 0 0 0
NOV HQ0O8337.1 Sendai NC_0015S2.1 0 0 ~ 0 "l 1
Table 3: Presence of sites for Eag 1, Sal 1 and Not 1 in the L proteins of various negative stranded RNA viruses
However, the genes for both these proteins encode a single protein each. Therefore, it would be easily possible to make synonymous mutations in their protein coding regions and eliminate the sites for these restriction enzymes. Therefore, the same cloning strategy can be easily used to clone the nucleocapsid and Large protein coding regions in a helper plasmid construct similar to either helper plasmid variant 1 or helper plasmid variant 2.
Similar to the above results, analysis of the phosphoprotein coding regions of these viruses revealed the presence of a variable number of sites for enzymes Nhe I, Eagl, Eco Rl and Mlu I (Table 4). Sites for these enzymes were absent from the phosphoprotein coding regions of MV, CDV and NDV.

Virus Gen bank No Nhe 1 Eag 1 Eco Rl Mlul
| MV RPV AY 486084.1 AB 547190.1 0 1 ■ 0 0 o oj
3 0
] RPV Z30697.2 HQ197753.1 0 . 0 0 0
PPRV
0 0 1 0
!CDV AB 687721.2
~ HQ008337.i_" 0 0 0 0 0]
NOV

0 0 0
i Sendai Table! various NC_001552.1 0 0 1 0 j Presence of sites for Nhe 1, Eag 1, Eco Rl and Mlu 1 in the P of negative stranded RNA viruses
Although the P protein of RPV (AB547190) sequence is digested by Nhe I and Eco Rl the regions corresponding to the recognition sites of these enzymes varies across different strains of RPV (e.g. Z30697.2 in Genbank). On the other hand, the Eco Rl site in the P protein of PPRV appears to be highly conserved across most PPRV strains. However, this region of the P protein coding sequence does not overlap with the coding regions of C and V proteins which are also coded by the P gene transcript. Thus,

it would be possible to introduce synonymous mutations in the P proteins of RPV and PPRV to enable the use of our proposed strategy for preparing the helper plasmids for MV, CDV, RPV, PPRV and NDV. Therefore, the same restriction enzymes may be used to synthesize helper plasmid constructs equivalent to those described as Helper Plasmid Variant 1 and Helper Plasmid Variant 2 from the nucleocapsid (N or NP), phosphoprotein (P) and large (L) proteins of other negative stranded RNA viruses. Such variants will be useful as helper plasmids for reconstitution of corresponding viral RNA dependent RNA polymerase enzyme and its exploitation for protein or RNA expression and also generation of recombinant viruses as novel vaccines and/or therapeutic agents.
3. Expression of recombinant proteins by plasmid encoded RDRP
First the capacity of cloning plasmids to express RNA molecules which can serve as substrate for MV RNA dependent RNA polymerase (RDRP) was evaluated using a system similar to the one described by Martin et al, (2006). Briefly, Vero cells were transfected with Cloning plasmid, and individual plasmids expressing the N, P and L proteins of MV-E at a ratio of 1:1:1:0.5 in lipofectamine (Invitrogen) according to the manufacturer's protocol. Cells were incubated at 37°C in 5% C02 for 48 hrs and evaluated for expression of green fluorescent protein (eGFP) by microscopy and fluorescence measurement using microplate reader.
In a subsequent experiment, Vero cells were transfected with equal proportions of one cloning plasmid (pUC-PlP-replicon-PIT or pIRES-HH-replicon-HDV or pIRES-PlP-replicon-PIT) and one helper, plasmid (Helper variant 1 or Helper variant 2) in lipofectamine (Invitrogen) or xfect (Clonetech) and incubated at 37°C in 5% C02 for 48 hrs and evaluated for the expression of green fluorescent protein (eGFP) by microscopy and fluorescence.
4. Rescue of MV-E
The capacity of the helper plasmids to rescue MV-E from cDNA was tested. Plasmid pCDNA_MVgenome was cotransfected with Helper plasmid variant 1 or Helper plasmid variant 2 in Vero cells using Xfect and incubated overnight at 37°C Transfection medium was replaced by fresh medium and cells were incubated further for two days. When syncytia involved 80% to 90% of cell layer, virus was harvested by scraping infected cells, freeze-thawing of cells and medium and centrifugation to remove cellular debris. Collected virus was titrated using the TCID50 titration method. Briefly, Vero cells were seeded into 96 well plate (7500 cells/well) and infected by serial 1:10 dilutions of virus sample in DMEM containing 5% DCS. After incubation at 37°C for 7 days, cells were stained with crystal violet and virus dilution that resulted in infection of 50% of test unit was determined. The 50% end point described as tissue culture infectious dose (TCID50) was calculated by the Kaber method. Virus rescued from the pCDNA_MVgenome + Helper plasmid had titers of 106 to 107 TCID50/mL.
5. Rescue of segmented MV-E using plasmid encoded RDRP
The capacity of the helper plasmids to rescue recombinant segmented MV-E from cDNA was tested. Vero cells were cotransfected with pCDNAJvlVgenome, Cloning plasmid encoding eGFP and either HPV 1 or HPV 2 in equal proportions using Xfect and incubated overnight at 37°C. Transfection medium was replaced by fresh medium and continued to incubate with daily observation for syncytia formation.. When syncytia involved 80% to 90% of cell layer, virus was harvested by scraping infected cells, freeze-thawing of cells and medium and centrifugation to remove cellular debris. Collected virus containing was titrated using the TCID50 titration method. Briefly, Vero cells were seeded into 96 well plate (7500 cells/well) and infected by serial 1:10 dilutions of virus sample in DMEM containing 5% DCS. After

incubation at 37C for 7 days, cells were stained with crystal violet and virus dilution that resulted in infection of 50% of test unit was determined. The 50% end point described as tissue culture infectious dose (TCID50} was calculated by the Kaber method. Virus rescued from the originally transfected cells had titers of 106 to 107 TClD50/mL Cells infected with the virus harvested from the originally transfected vero cells also expressed eGFP indicating successful packaging eGFp encoding minireplicon along with MV-£ genome into virions and its transfer to fresh ce))s.

Bibligraphy
Clements, C. J. and Cutts, F. T. (1995} The epidemiology of measles: thirty years of vaccination. In ter Meulen, V. and Billeter, M. A. (eds,), Measles Virus. Springer GmbH & Co., Berlin, Curr. Topics in Microbiol, and Immunol. Vol 191, pp. 13-33; Enders, J. F. and Peebles, T. C. (1954} Proc. Soc. Exp. Biol. Med. 86, 277-286; Enders, J. F. (1962} Am. J. Dis. Child, 103, 282-287; Norrby, E. (1995) The paradigms of measles vaccinology. In ter Meulen, V. and Billeter, M A., (eds.), Measles virus. Springer GmbH & Co,, Berlin, Current Topics in Microbiol, and Immunol. Vol 191, pp. 167-180; Kock et al, 2006, Preventive and Veterinery Medicine 75: p63-80; Plowright and Ferris, 1962, Res Vet Sci, 3: 172-182; Scot 1963, J. Hyg. Comb 61:193-203; Baron et al, 2005, J. Gen. Virol. 86: 1093-1101; Racaniello, V. R. & Baltimore, D. (1981) Science 214, 916-919; Enami, M., Lutyjes, W., Krystal, M. & Palese, P. (1990) Proc. Natl. Acad. Sci. USA 87, 3802-3805; Luytjes, W., Krystal, M., Enami, M., Parvin J. D. and Palese, P. (1989) Cell, 59, 1107-1113; Enami, M. and Palese, P. (1991) J. Virol., 65, 2711-2713; Park, K. H., Huang, T., Correia, F. F. and Krystal, M. (1991) Proc. Natl. Acad. Sci., USA, 88, 5537-5541; Collins, P. L, Mink, M. A., Hill, M. G., Camargo, E., Grosfeld, H. and Stec, D. S. (1993) Virology, 195, 252-256; Collins, P. L, Mink, M. A. and Stec, D. S. (1991) Proc. Natl. Acad. Sci. USA, 88, 9663-9667; Dimock, K. and Collins, P. L (1993) J. Virol., 67, 2772-2778; Sidhu, M. S., Chan, J., Kaelin, K., Spielhofer, P., Radecke, F., Schneider, H., Masurekar, M., Dowling, P. C, Billeter, M. A. and Udem, S. A. {1995} Virology, 208, 795-799; Lawson, N., Stillman, E. A., Whitt, M. A. and Rose, J. K. (1995) Proc. Natl. Acad. Sci, USA, 92, 4477-4481; Schnell, M. J., Mebatsion, T. and Conzelmann, K. K. (1994) EMBO J., 13, 4195-4203; Whelan, S. P., L. A. Ball, J. N. Barr, and G. T. Wertz. 1995, Proc Natl Acad Sci USA 92:8388-92; Whelan, S., LeGrone, A. and Ball, L. A. (1994) Proc. Natl. Acad. Sci. USA, 91, 8587-8591; Radecke, F. and Billeter, M. A. (1995) Appendix: measles virus antigenome and protein consensus sequences. In ter Meulen, V. and Billeter, M. A. (eds.), Measles Virus. Springer GmbH & Co., Berlin, Current Topics in Microbiology and Immunology Vol. 191, pp. 181-192; Garcin, D., Pelet, T., Calain, P., Roux, L, Curran, J. & Kolakofsky, D. (1995) EMBO J. 14, 6087-6094; Garcin, D., P. Latorre, and D. Kolakofsky. 1999. J Virol 73:6559-65; Kato, A., Y. Sakai, T. Shioda, T. Kondo, M. Nakanishi, and Y. Nagai. 1996. Genes Cells 1:569-79; Baron, M. D. & Barrett, T. (1997). J. Virol. 71, 1265-1271; Hoffman, M. A. & Banerjee, A. K. (1997). ;. Wro/.71, 4272-4277; Durbin, A. P., Hall, S. L, Siew, J. W., Whitehead, S. S., Collins, P. L & Murphy, B. R. (1997) Virology 235, 323-332) He, B., Paterson, R. G., Ward, C. D. & Lamb, R. A. (1997) Virology 237, 249-260; Peeters, B. P. H., de Leeuw, O. S., Koch, G. & Gielkens, A. L J. (1999) J. Virol. 73, 5001-5009; Yount, B., K. M. Curtis, E. A. Fritz, L. E. Hensley, P. B. Jahrling, E. Prentice, M. R. Denison, T. W. Geisbert, and R. S. Baric. (2003) Proc. Natl. Acad.Sci. USA 100:12995-13000; Pattnaik, A. K. and Wertz, G. W. (1990) J. Virol., 64, 2948-2957; Lawson, N., Stillman, E. A., Whitt, M. A. and Rose, J. K. (1995), Proc. Natl. Acad. Sci, USA, 92, 4477-4481; Collins, P. L, M. G. Hill, E. Camargo, H. Grosfeld, R. M. Chanock, and B. R. Murphy. 1995, Proc Natl Acad Sci USA 92:11563-7; He, B., R. G. Paterson, C. D. Ward, and R. A. Lamb. 1997, Virology 237:249-60; Durbin, A. P., S. L. Hall, J. W. Siew, S. S. Whitehead, P. L. Collins, and B. R. Murphy. 1997. Recovery of infectious human parainfluenza virus type 3 from cDNA. Virology 235:323-32; Schneider, H., P. Spielhofer, K. Kaelin, C. Dotsch, F. Radecke, G. Sutter, and M. A. Billeter. 1997, J Virol Methods 64:57-64; Clarke, D. K., M. S. Sidhu, J. E. Johnson, and S. A. Udem. 2000, J Virol 74:4831-8; Kawano, M., M. Kaito, Y. Kozuka, H. Komada, N. Noda, K. Nanba, M. Tsurudome, M. Ito, M. Nishio, and Y. Ito. 2001, Virology 284:99-112; Peeters, B. P., O. S. de Leeuw, G. Koch, and A. L Gielkens. 1999, J Virol 73:5001-9; Das, S. C, M. D.

Baron, and T. Barrett. 2000, J Virol 74:9039-47; Radecke, F., P. Spielhofer, H. Schneider, K. Kaelin, M. Huber, C. Dotsch, G, Christiansen, and M. A. Billeter. 1995, Embo J 14:5773-84; Parks, C. L, R. A. Lerch, P. Walpita, M. S. Sidhu, and S. A. Udem. 1999, J Virol 73:3560-6; Buchholz, U. J., H. Granzow, K. Schuldt, 5. S. Whitehead, B. R. Murphy, and P. L. Collins. 2000, J Virol 74:1187-99; Finke, S., and K. K. Conzelmann. 1999, J Virol 73:3818-25; Harty, R. N., M. E. Brown, F. P. Hayes, N. T. Wright, and M. J. Schnell. 2001, J Mol Microbiol Biotechnol 3:513-7; Romer-Oberdorfer, A., E. Mundt, T. Mebatsion, U. J. Buchholz, and T. C. Mettenleiter. 1999, J Gen Virol 80 (Pt ll):2987-95; Volchkov, V. E., V. A. Volchkova, E. Muhlberger, L V. Kolesnikova, M. Weik, O. Dolnik, and H. D. Klenk. 2001, Science 291:1965-9; Zobel et al, 1993, Nucleic acids research, 21:3607-3612; Flick and Petterson, 2001, J. Virol. 75: 1643-1655; Neumann et al, 1999, Proc. Natl. Acad. Sci 96: 9345-9350; deWit et al, 2007, J.Gen Virol. 88:1281-1287; Wang and Duke, 2007 Virology journal 4:102-114; Martin et al, 2006, J Virol. 80:5708-5715; Tower et al, 1989, Mol. Cell. Biol 9: 1513-1525; Combredet et al, 2003, J. Virol. 2003, 77(21): 11546 - 11554; Walker SC, Avis JM, Conn GL, 2003, Nucleic acids research 31(15): e82; Martin et al, 2006, J. Virol. 80(12): 5708-5715.

Claims
1. Two plasmid system for producing recombinant proteins using RNA Dependent RNA Polymerase
of non-segmented negative strand RNA viruses comprising
a. One cloning plasmid comprising an easily manipulatable replicon at two multiple cloning
sites for insertion of expressible DNA fragment
b. One helper plasmid comprising N, P, L genes expressing N, P, L proteins respectively;
without the help of a replicating helper vaccinia virus or exogenous RNA polymerase
2. Two plasmid system of claim 1 wherein the easily manipulatable replicon comprises atleast one multiple cloning site (MCS) for insertion of expressible DNA fragments flanked at 5' end by viral leader sequence and at 3' end by viral trailer sequence, more preferably two or more MCSs separated by viral intergenic sequences operatively linked to RNA Polymerase (RNAP) I regulatory sequences to allow synthesis of antisense RNA transcripts bearing authentic 3' and 5' viral genome termini.
3. Two plasmid system of claim 1 wherein the easily manipulatable replicon comprises atleast one multiple cloning site (MCS) for insertion of expressible DNA fragments flanked at 5' end by viral' leader sequence and at 3' end by viral trailer sequence, more preferably two or more MCSs separated by viral intergenic sequences operatively linked to RNAP II regulatory sequences and ribozymes to allow synthesis of antisense RNA transcripts bearing authentic 3' and 5' viral genome termini.
4. Two plasmid system for producing infectious non-segmented negative strand RNA viruses using RNA Dependent RNA Polymerase of non-segmented negative strand RNA viruses comprising,
a. One virus cloning plasmid comprising a cDNA encoding entire viral genomic RNA for
insertion of expressible DNA fragment
b. One helper plasmid comprising N, P, L genes expressing N, P, L proteins respectively;
without the help of a replicating helper vaccinia virus or exogenous RNA polymerase
5. Two plasmid system of claim 4 wherein the the cDNA encoding viral genomic RNA is operatively linked to RNA Polymerase (RNAP) I regulatory sequences to allow synthesis of antisense RNA transcripts bearing authentic 3' and 5' viral genome termini.
6. Two plasmid system of claim 4 wherein the cDNA encoding viral genomic RNA is operatively linked to RNAP II regulatory sequences and ribozymes to allow synthesis of antisense RNA transcripts bearing authentic 3' and 5' viral genome termini.
7. Two plasmid system of claim 1 and claim 4 wherein the expressible DNA fragment codes for a RNA molecule or a protein or atleast one immunogenic epitope or combination of herein.

8. Helper plasmid as claimed in claim 1 and 4 where in the N gene and a bicistronic cassette encoding P and L genes separated by an IRES element are cloned under the control of a bidirectional RNAP II promoter
9. Helper plasmid as claimed in claim 1 and 4 wherein the N, P and L genes are cloned into a single bi-cistronic DNA cassette containing a gene encoding fusion protein of N and P separated by a 2A peptide sequence and a gene encoding L protein separated by IRES element under the control of a RNAP I! promoter.

10. Helper plasmid as claimed in claim 1 and 4 wherein the N, P and L genes are cloned as 3 . separate genes each under the different control of RNA polymerase II promoters.
11. Two plasmid system for producing recombinant proteins using Measles virus RNA Dependent RNA Polymerase of non-segmented negative strand RNA viruses comprising
a. One cloning plasmid comprising an easily manipulatable measles virus replicon at two
multiple cloning sites for insertion of expressible DNA fragment
b. One helper plasmid comprising measles virus N, P, 1 genes expressing measles virus N,
P, L proteins respectively;
without the help of a replicating helper vaccinia virus or exogenous RNA polymerase
12. Two plasmid system for producing infectious measles virus comprising,
a. One virus cloning plasmid comprising a cDNA encoding entire measles virus genomic
RNA for insertion of expressible DNA fragment
b. One helper plasmid comprising measles virus N, P, L genes expressing measles virus N,
P, L proteins respectively;
without the help of a replicating helper vaccinia virus or exogenous RNA polymerase
13. A method of producing recombinant proteins, RNA molecules or infectious non-segmented negative strand RNA viruses using the two plasmid system as claimed in claim 1 and claim 4 comprising, introducing cloning and helper plasmids into host cell and producing recombinant proteins, RNA molecules or infectious non-segmented negative strand RNA viruses without the help of a replicating helper vaccinia virus or exogenous RNA polymerase
14. A method of producing recombinant measles viruses comprising introducing (a) Virus cloning plasmid of claim 4 into host cell, (b) cloning plasmid of claim 1 into host cells and (c) helper plasmid of claim 1 or claim 4 into host cells and producing recombinant measles viruses without the help of replicating helper vaccinia virus or exogenous RNA polymerase
15. Two plasmid system as claimed in claim 1 wherein the sequence of easily manipulatable replicon is Seq ID No. 1.
16. Two plasmid system as claimed in claim 1 wherein the sequence of the easily manipulatable replicon flanked by ribozymes is as per Seq ID No. 2
17. Two plasmid system as claimed in Claim 1 wherein the sequence of the easily manipulatable replicon flanked by RNA polymerase I promoter and RNA polymerase I terminator is as per Seq ID No. 3
18. Two plasmid system as claimed in claim 1 and claim 4 wherein the cloning plasmid is as per Seq ID No 4, or Seq ID No 5 or Seq ID No 6 or Seq ID'No 7
19. Two plasmid system as claimed in claim 1 and claim 4 wherein the helper plasmid is as per seq ID No 8 or Seq ID No 9

Documents

Application Documents

# Name Date
1 Other Document [29-09-2016(online)].pdf 2016-09-29
2 Form 13 [29-09-2016(online)].pdf 2016-09-29
3 2050-MUMNP-2013-Annexure [27-06-2018(online)].pdf 2018-06-27
4 2050-MUMNP-2013.pdf 2018-08-11
5 2050-MUMNP-2013-SEQUENCE LISTING.pdf 2018-08-11
6 2050-MUMNP-2013-FORM PCT-ISA-210.pdf 2018-08-11
7 2050-MUMNP-2013-FORM 6(4-6-2014).pdf 2018-08-11
8 2050-MUMNP-2013-FORM 5.pdf 2018-08-11
9 2050-MUMNP-2013-FORM 3.pdf 2018-08-11
10 2050-MUMNP-2013-FORM 2.pdf 2018-08-11
11 2050-MUMNP-2013-FORM 2(TITLE PAGE).pdf 2018-08-11
12 2050-MUMNP-2013-FORM 18.pdf 2018-08-11
13 2050-MUMNP-2013-FORM 1.pdf 2018-08-11
14 2050-MUMNP-2013-FER.pdf 2018-08-11
15 2050-MUMNP-2013-DRAWING.pdf 2018-08-11
16 2050-MUMNP-2013-DESCRIPTION(COMPLETE).pdf 2018-08-11
17 2050-MUMNP-2013-CORRESPONDENCE.pdf 2018-08-11
18 2050-MUMNP-2013-CORRESPONDENCE(4-6-2014).pdf 2018-08-11
19 2050-MUMNP-2013-CLAIMS.pdf 2018-08-11
20 2050-MUMNP-2013-ASSIGNMENT(4-6-2014).pdf 2018-08-11
21 2050-MUMNP-2013-ABSTRACT.pdf 2018-08-11
22 2050-MUMNP-2013-FORM FOR STARTUP [28-01-2019(online)].pdf 2019-01-28
23 2050-MUMNP-2013-FORM 4(ii) [31-01-2019(online)].pdf 2019-01-31
24 2050-MUMNP-2013-FORM-26 [07-02-2019(online)].pdf 2019-02-07
25 2050-MUMNP-2013-PETITION UNDER RULE 137 [26-04-2019(online)].pdf 2019-04-26
26 2050-MUMNP-2013-PETITION UNDER RULE 137 [26-04-2019(online)]-1.pdf 2019-04-26
27 2050-MUMNP-2013-Information under section 8(2) (MANDATORY) [26-04-2019(online)].pdf 2019-04-26
28 2050-MUMNP-2013-FORM 3 [26-04-2019(online)].pdf 2019-04-26
29 2050-MUMNP-2013-OTHERS [29-04-2019(online)].pdf 2019-04-29
30 2050-MUMNP-2013-FER_SER_REPLY [29-04-2019(online)].pdf 2019-04-29
31 2050-MUMNP-2013-CLAIMS [29-04-2019(online)].pdf 2019-04-29
32 2050-MUMNP-2013-ABSTRACT [29-04-2019(online)].pdf 2019-04-29
33 2050-MUMNP-2013-ORIGINAL UR 6(1A) FORM 26-130219.pdf 2019-11-30
34 2050-MUMNP-2013-FORM 3 [27-05-2020(online)].pdf 2020-05-27
35 2050-MUMNP-2013-US(14)-HearingNotice-(HearingDate-10-03-2022).pdf 2022-02-09
36 2050-MUMNP-2013-Correspondence to notify the Controller [03-03-2022(online)].pdf 2022-03-03
37 2050-MUMNP-2013-MARKED COPIES OF AMENDEMENTS [14-03-2022(online)].pdf 2022-03-14
38 2050-MUMNP-2013-FORM 13 [14-03-2022(online)].pdf 2022-03-14
39 2050-MUMNP-2013-AMMENDED DOCUMENTS [14-03-2022(online)].pdf 2022-03-14
40 2050-MUMNP-2013-Written submissions and relevant documents [24-03-2022(online)].pdf 2022-03-24
41 2050-MUMNP-2013-Response to office action [28-03-2022(online)].pdf 2022-03-28
42 2050-MUMNP-2013-FORM FOR SMALL ENTITY [17-06-2022(online)].pdf 2022-06-17
42 2050-MUMNP-2013-PatentCertificate29-03-2022.pdf 2022-03-29
43 2050-MUMNP-2013-IntimationOfGrant29-03-2022.pdf 2022-03-29
43 2050-MUMNP-2013-RELEVANT DOCUMENTS [23-05-2023(online)].pdf 2023-05-23
44 2050-MUMNP-2013-FORM FOR SMALL ENTITY [17-06-2022(online)].pdf 2022-06-17
45 2050-MUMNP-2013-RELEVANT DOCUMENTS [23-05-2023(online)].pdf 2023-05-23

Search Strategy

1 searchstrategy(1)_23-05-2018.pdf
2 BlankStrategy_30-11-2017.pdf

ERegister / Renewals

3rd: 20 Jun 2022

From 08/06/2014 - To 08/06/2015

4th: 20 Jun 2022

From 08/06/2015 - To 08/06/2016

5th: 20 Jun 2022

From 08/06/2016 - To 08/06/2017

6th: 20 Jun 2022

From 08/06/2017 - To 08/06/2018

7th: 20 Jun 2022

From 08/06/2018 - To 08/06/2019

8th: 20 Jun 2022

From 08/06/2019 - To 08/06/2020

9th: 20 Jun 2022

From 08/06/2020 - To 08/06/2021

10th: 20 Jun 2022

From 08/06/2021 - To 08/06/2022

11th: 20 Jun 2022

From 08/06/2022 - To 08/06/2023

12th: 11 May 2023

From 08/06/2023 - To 08/06/2024

13th: 21 May 2024

From 08/06/2024 - To 08/06/2025

14th: 29 May 2025

From 08/06/2025 - To 08/06/2026