Sign In to Follow Application
View All Documents & Correspondence

A Small Synthetic Rna, A Method Of Preparing The Same And Uses Thereof

Translation of the hepatitis C virus (HCV) RNA is mediated by the interaction of ribosomes and cellular proteins with an internal ribosome entry site (IRES) located within the 5'untranslated region (5'UTR). We have investigated whether small RNA molecules corresponding to the different stem-loop (SL) domains of the HCV IRES, when introduced in tram, can bind to the cellular proteins and antagonize their binding to the viral IRES, thereby inhibiting HCV IRES-mediated translation. We have found that an RNA molecule corresponding to SL III of the HCV IRES could efficiently inhibit HCV IRES-mediated translation in a dose-dependent manner without affecting cap-dependent translation. The SL III RNA was also found to bind efficiently to most of the cellular proteins which interacted with the HCV 5'UTR. A smaller RNA corresponding to SL e+f of domain III also strongly and selectively inhibited HCV IRES-mediated translation. This RNA molecule showed strong interaction with the ribosomal S5 protein and prevented the recruitment of the 40S ribosomal subunit by the HCV IRES. In conclusion our results demonstrate a novel approach to selectively block HCV RNA translation using a small RNA molecules mimicking the structure of the stem-loop IIIe+f subdomain of the HCV-IRES. The discovery provides a basis for developing a potent antiviral therapy targeting the interaction between the ribosome and the HCV-IRES RNA.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
12 March 2004
Publication Number
02/2006
Publication Type
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2008-10-24
Renewal Date

Applicants

INDIAN INSTITUTE OF SCIENCE
BANGALORE - 560 012,

Inventors

1. PARTHO SAROTHI RAY
DEPT OF MICROBIOLOGY AND CELL BIOLOGY, SIR C.V. RAMAN AVENUE, INDIAN INSTITUTE OF SCIENCE, BANGALORE 560 012,
2. DR. SAUMITRA DAS
DEPT OF MICROBIOLOGY AND CELL BIOLOGY, SIR C.V. RAMAN AVENUE, INDIAN INSTITUTE OF SCIENCE, BANGALORE 560 012,

Specification

This invention relates to a small synthetic ribonucleic acid (RNA) sequence and to method of preparing the same and use of the said sequence as a therapeutic molecule against hepatitis C induced liver cirrhosis and hepato cellular carcinoma.
Prior art:
HCV (Hepatitis C virus) is a major human pathogen with an estimated 170 million chronic carriers throughout the world, many of whom are at a significant risk for developing liver cirrhosis and hepatocellular carcinoma (1). Current therapeutic strategies using Interferon-a, either alone or in combination with ribavirin, have poor efficacy (2). Moreover, an important lesson obtained from the therapy of other viral infections is that multiple drug targets are required to prevent the emergence of drug-resistant varieties of the virus (3).
HCV is a positive stranded RNA virus and the translation of the viral genomic RNA is an early obligatory step of the infection process. The translation initiation of the uncapped viral RNA takes place through the IRES (internal ribosome entry site) located in the 5'UTR (5'-untranslated region) (4). Translation initiation from the IRES is mediated by a number of cellular trans-acting factors like the La autoantigen (5) and polypyrimidine tract-binding protein (PTB) (6) together with some canonical elFs (eukaryotic Initiation Factors) like eIF3 (7), eIF2 and eIF2B (8). It has been suggested that the IRES acts as a structural scaffold with specifically placed recognition sites for recruiting the translation machinery (9). As this mechanism of translation initiation is distinct from the cellular cap-dependent mechanism, it is an attractive target for antiviral therapeutics with high target specificity and low host cytotoxicity (10).
The concept of using RNA molecules as therapeutic agents has aroused increasing interest in the past decade. Antisense RNAs and trans-cleaving ribozymes have been studied as potential inhibitors of HCV translation (11, 12). Recently, RNA interference using small interfering RNAs has proved to be highly efficient in inhibiting the replication of a number of viruses including HCV (3).

Another strategy of blocking the replication of RNA viruses has been to express small and structured viral RNA elements in target cells. These RNAs bind to viral regulatory proteins and prevent their binding to corresponding sequences in the viral RNA thus inhibiting viral gene expression. Overexpression of Human Immunodeficiency Virus (HIV) trans-activation response region and Rev response element RNAs in CD4+ T cells prevented the binding of viral Tat and Rev proteins to the viral RNA and made the cells resistant to HIV replication (13, 14). Also, a 60 nt RNA termed IRNA, isolated from Saccharomyces cerevisae, has been shown to block IRES-mediated translation of poliovirus and HCV by sequestering cellular trans-acting factors which interact with the viral IRESs (15, 16). La and PTB-specific SELEX RNA have also been shown to inhibit HCV IRES-mediated translation (17,18).
The limitations of the above -referred known procedures to inhibit the HCV translation/replication is the non-specificity of the procedures and also the possibility of the generation of escape mutants of the virus. Any sequence based approach like RNA interference or antisense has the possibility of generating resistant varieties of the virus because of increased selection pressure. Also, there is a possibility of the function of certain cellular genes being affected.
Herein, a novel approach to inhibit HCV IRES-mediated translation using small RNA molecules rnimicking the structure of the defined SL (stem-loop) domains of the HCV IRES is being demonstrated.. It has been shown that a small RNA molecule corresponding to domain HI of the HCV IRES and a smaller molecule corresponding to the SL HI e+f subdomain binds to specific cellular proteins interacting with the HCV IRES and strongly inhibit HCV IRES-mediated translation without inhibiting cap-dependent translation.
Therefore, the specific inhibition of HCV IRES-mediated mechanism by the SL HI e+f RNA of the HCV 5*UTR has a potential to be used as a therapeutic strategy with a number of associated advantages. Firstly, as the RNA-protein interactions between host cellular proteins and a highly conserved region of the viral RNA are targeted, the chance of generation of viral escape mutants is very low. Any sequence-specific antiviral

molecule would exert a selection pressure for the generation of escape variants. On the other hand, a strategy targeting the interaction between host proteins and the viral RNA would not exert a strong selection pressure on the viral genome as the rate of mutation of cellular proteins is entirely independent of viral replication. Moreover, the activity of the HCV IRES being highly structure dependent, only mutational events which can alter the structure in such a way as to enable it to interact with a different protein with the same function or which increases the affinity to an existing interacting partner would allow the virus to circumvent inhibition mediated by this approach. Secondly, the RNA molecule being a part of the viral genome, if administered prophylactically to patients already harbouring the viral RNA, it is not expected to give rise to non-specific immune responses as seen in the case of antisense RNAs (Dove, 2002). Thirdly, as the inhibitory activity is dependent on the RNA structure, stabler derivatives using different nucleotide (eg. phosphorothioate) or backbone (eg. PNA) chemistries and small molecule structural analogs of the RNA can be utilized to increase the deliverability and stability of the therapeutic molecule.
Accordingly, it is the primary object of the present invention to investigate whether small RNA molecules corresponding to the different stem-loop (SL) domains of the HCV IRES, when introduced in trans, can bind to the cellular proteins and antagonize their binding to the viral IRES, thereby inhibiting HCV IRES-mediated translation.
It is another object of the present invention to identify the RNA molecule corresponding to a sub-domain of SL m region of the HCV IRES, which could efficiently inhibit HCV IRES-mediated translation in a dose-dependent manner without affecting cap-dependent translation.
A further object of the present invention is to provide a small synthetic ribonucleic acid sequence GGGA GGGC CCTCTCG GTAGA ACACCA TGACGGA CTATCCCACGAACGCTCACGGGGCCCTCC, its structural analog or mimic thereof.
A further object of the present invention is to provide a therapeutic molecule/composition, which will be useful in the treatment of hepatitis C induced liver cirrhosis and hepato cellular carcinoma and a method of preparing the said composition.

Further objects of the present invention are providing a polynucleotide, a recombinant vector, a method of preparing the same using the synthetic HCV IRES ribonucleic acid and a method for inhibiting HCV IRES mediated translation.
The term "structural analogs" can be described as RNAs that are structurally and functionally similar but the nucleotide composition and origin (derived from) could be different.
"Macromolecular mimicry" can be described as a phenomenon, that large parts of proteins (domain or sub domains) resemble in shape (and possibly also in function) a large part of a nucleic acid. The structural mimic can also be extended to materials other then proteins (e.g. compounds). Accordingly, the term "structural mimic" in this specification can be described as substances/compounds that resemble in shape (and possibly also in function) a large part of the RNA structure.
Summary of invention:
HCV is a positive stranded RNA virus and the translation of the viral genomic RNA to produce the proteins required for replication is an early obligatory step of the infection process. The translation initiation of the uncapped viral RNA takes place through the highly structured Internal Ribosome Entry Site (IRES) located in the 5'UTR of the viral RNA. The process of IRES-mediated translation is an attractive target for designing antiviral therapeutics with high target specificity and low host cytotoxicity because of its fundamental difference from the cap-dependent translation of cellular proteins and its importance in the viral life cycle.
The cap independent internal initiation of translation is mediated by the interaction between the cellular trans acting factors with the cis acting elements within the HCV 5'UTRRNA.
The present invention proposes a molecular approach to inhibit HCV IRES-mediated translation by using small RNA molecules analogous to the structure of the defined stem-loop (SL) domains of the HCV 5'UTR (IRES element). These RNA molecules, when introduced in trans, were expected to specifically bind to the cellular proteins that interact

with the viral IRES and are required for internal initiation of translation. As a result of this sequestration, the cellular proteins would be prevented from binding to die IRES of the viral RNA and this may lead to the inhibition of viral protein synthesis.
When the above proposal was tested experimentally, it has been observed that a small RNA molecule corresponding to domain HI of the HCV IRES and a smaller molecule corresponding to the SL HI e+f subdoraain binds to specific cellular proteins interacting with the HCV IRES and strongly inhibit HCV IRES-mediated translation without inhibiting cap-dependent translation in vitro and in vivo in cultured cells. Further, the SLIII e+f RNA was found to interact with the 40 S ribosomal subunit protein S5. As the S5 protein of the 40S subunit is crucial for ribosome binding to the HCV IRES, binding of me SL m e+f RNA to me S5 protein blocked me ribosome interaction with the HCV IRES and resulted in the inhibition of translation initiation {Ray and Das, 2004, Nucleic Acids Res).
These observations helped to conclude that a small RNA molecule analogous to a specific stem-loop structure of the HCV IRES can be used to selectively inhibit HCV IRES-mediated translation. Small molecule structural analogs of the SL III e+f RNA, that prevent the binding of ribosomes to the HCV IRES by interacting with the S5 protein, may be developed, which might act as potent inhibitors of HCV translation and may act as novel antivirals to combat HCV infection.
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS:
Fig. 1: Dose-dependent inhibition of HCV IRES-mediated translation in vitro by SL III RNA.
(A) Proposed secondary structure of the HCV Ires RNA spanning nucleotides 40-372 of the 5'UTR of the viral RNA. The domains that were PCR amplified and cloned to generate small RNAs are delineated. (B) 100-fold and 200-fold molar excess of in vitro transcribed SL II EI and IV RNAs were added to in vitro translation reactions of HCV vicistronic RNA. 5ul of the translation reactions was resolved on SDS-12.5% PAGE and exposed for phosphorimaging. The flue and Rluc protein products are indicated by

arrows. (C) The percent Flue activity representing the efficiency of HCV IRES-mediated translation from a HCV bicistronic template in presence of six increasing concentrations of SL n, IH and IV RNAs. The Flue activity at each concentration is represented as a percentage of the control reaction (expressed as 100%). (D) The percent Rluc activity representing the efficiency of cap-dependent translation from the same set of experiments were plotted. The Rluc acitivity at each concentration is represented as a percentage of the control reaction. The translation efficiency was not reduced to below 50% by either SL m or SL H.
Fig. 2: Effect of SL III RNA on HCV IRES-mediated translation in vivo.
(A) Three-way co-transfections were performed in HeLa cells using pRL-CMV, pCD-HCV5'UTR-Fluc and two concentrations of pCD-SL m and pCD-SL H DNAs. DNA quantity per dish was normalized by transfecting pGEM-3Z DNA. The black bars represent Flue activity (HCV IRES-mediated translation) whereas the gray bars represent Rluc activity (cap-dependent translation). (B) The same experiment was repeated in the Huh7 cell line. Combined data from three independent experiments in each cell line are shown. Luciferase activity in control reactions is expressed as 100%. Values which significantly differ from controls (P<0.01) are indicated by asterisks.
Figure 3: Constitutive expression of SL III RNA does not cause general inhibition of cellular transcription and translation.
(A) Huh7 cells were transfected with an eukiaryotic expression vector encoding the SL III RNA, upstream of a ribozyme sequence (schematically represented), which generated the SL IH RNA in vivo. (B) The cells were selected by G418 selection to generate a cell line constitutively expressing the SL m RNA. RT-PCR of total RNA isolated from untransfected Huh7 cells and cells stably transfected with the pCD-SL m-Ribo DNA using SL El-specific or actin-specific primers. The amplified products are indicated. (C) in vivo metabolic labelling of Huh7 and Huh7-SLffl cells using 35S-MET/35S-Cys. The cells were lysed after labelling and the cell lysates resolved by SDS-10%PAGE.

Figure 4: Specific inhibition of HCV IRES-mediated translation in vitro by SL III
e+fRNA.
(A) Proposed secondary structure of HCV IRES (internal ribosome entry site) domain in (121-315nt), delineating the SL structures, which were generated by oligonucleotide-driven transcription. (B) Schematic representation of the process of oligonucleoude-driven transcription of the HCV IRES SL RNAs using synthetic oligonucleotide templates (C) The percent Flue activity representing the efficiency of HCV IRES-mediated translation from a HCV bicistronic template in presence of five increasing concentrations of SL III a+c, b, d and e+f RNAs was plotted. Luciferase activity in control reactions is expressed asl00%. (D) The percent Rluc activity representing the efficiency of cap-dependent translation from the same set of experiments was plotted. The reporter gene activity at each concentration is represented as a percentage of the control reaction.
Figure 5: Effect of SL III e+f RNA on HCV IRES-mediated translation and replication in vivo.
Huh 7 cells were co-transfected with 6 ug of in vitro transcribed capped HCV bicistronic RNA and two concentrations (6 and 12 ug) of either SL HI e+f RNA or SL HI d RNA. The RNA quantities in each dish were normalized by adding appropriate amounts of an in vitro transcribed RNA corresponding to the polylinker sequence of the pGEM 3Z plasmid. The black bars represent Flue activity whereas the gray bars represent Rluc activity. Luciferase activity in control reactions is expressed as 100%. Values which significantly differ from controls (P<0.01) are indicated by asterisks.
Figure 6: SL III e+f (A297GF) RNA fails to bind to S5 ribosomal protein and does not inhibit HCV IRES-mediated translation.
In the results Fig 5A and B seem to indicate binding of HeLa lysate and purified S5 protein with all the small RNAs. Please check.
(A) Representation of the SL III e+fRNA showing the muation of A297 to G. (B) 32P-labeled RNAs corresponding to SL III e+f and SL m e+f (A297G) were UV-crosslinked

to HeLa S10 extract and digested with RNase A. The nucleoprotein complexes were resolved by SDS-15% PAGE and the position of p25 is indicated. (C) The same RNAs were UV-crosslinked to purified S5 ribosomal protein and the nucleoprotein complexes were resolved by SDS-15% PAGE. (D) 100-fold and 200-fold molar excess of in vitro transcribed SL m e+f (A297G) RNA was added to in vitro translation reactions of HCV bicistronic RNA and luciferase activity was assayed. The black bars represent Flue activity (HCV IRES-mediated translation) whereas the gray bars represent Rluc activity (Cap-dependent translation). Luciferase activity in control reactions is expressed as 100%. Combined data from three independent experiments is represented.
Figure 7: SL ID e+f prevents 40S ribosomal subunit recruitment by the HCV IRES.
(A) Sucrose gradient sedimentation profiles of 32P-UTP-labeled HCV 5'UTR RNA incubated in RRL in absence and presence of 200 fold excess of unlabeled SL III e+f RNA. (B) Sedimentation profile of radiolabeled HCV 5'UTR RNA in presence of 2mM GMP-PNP and in the presence or absence of 200 fold excess of unlabeled SL HI e+f RNA. The filled circles represents the control reaction profile and the open circles show the profile in the presence of SL III e+f. Both profiles show the counts per minute as a percentage of the total counts added to the reaction (~105 cpm) against the fraction number of the gradient. The fractions were collected from the bottom up wards. The SOS and 48S ribosomal peaks are indicated.
Figure 8: SL III e+f does not prevent ribosome recruitment by a capped RNA and binds directly to the 40S subunit.
(A) Sucrose density gradient sedimentation profiles of 32P-UTP-labeled capped-GFP RNA inclubated in RRL in absence and presence of 200 fold excess of unlabeled SL EI e+f RNA. (B) Sedimentation profile of radiolabeled HCV 5'UTR-GEP RNA in presence or absence of 200 fold excess of unlabeled SL III e+f RNA. The filled circles represents the control reaction profile and the open circles show the profile in the presence of SL m e+f. (C) Sucrose density gradient sedimentation profile of 32P-UTP-labeled SL m e+f RNA incubated in RRL. All the profiles show the counts per minute as a percentage of the total counts added to the reaction (~105 cpm) against the fraction number of the

gradient. The fractions were collected from the bottom upwards. The 48S ribosomal peak and the polysomal peaks are indicated.
Figure 9: Proposed model of inhibition of HCV IRES-mediatcd translation by SL IHe+fRNA.
The HCV IRES binds to the 40S ribosomal subunit as demonstrated by Spahn et al., 2001, making contact with the S5 protein (shaded in red) via SL m e and f and SL II. When SL HI e+f RNA is added in trans, it binds to the S5 protein on the 40S subunit (shown in blue) and blocks this crucial binding site for the HCV IRES RNA. This prevents ribosome recruitment by the HCV IRES and thereby inhibits HCV IRES-mediated translation. The 40S subunit, HCV IRES and SL HI e+f RNA representations are not to scale.
Preparation of the inhibitor RNA:
OUgonucleotide-driven transcription ofSUIIe+fRNA
The inhibitor RNA was synthesized by in vitro transcription assay using standard protocol described earlier (15) and also in the Promega Protocol. Briefly, synthetic DNA oligonucleotides corresponding to domain HI stem-loops e+f structures with T7 promoter sequences at the 5' end (GGGAGGGCCCTCTCGGTAGAACACCATGACGGACTATCCCACGAACGCTCA GGGGCCCTCC) was obtained from Sigma Aldrich (St. Louis, MO). The oligonucleotide was annealed to T7 RNA polymerase promoter primers and transcribed in vitro using T7 RNA polymerase as described earlier. The transcription reaction was extracted with phenol and chloroform. The synthesized RNA was purified and concentrated by alcohol precipitation. The RNA pellet was dried in vaccum centrifuge and dissolved in nuclease free water.
The SL Ille+f (A297G) oligo had the same sequence as the SL III e+f oligo except for a T residue replaced by C at the 54th position. Radioactively labeled RNAs were
"if
synthesized similarly using the same templates and a- P-UTP.

In order to express the inhibitor RNA in vivo from eukaryotic expression vector, the oligonucleotide DNA sequences corresponding to the inhibitor RNA (SLIII e+f) was annealed with the antisense oligonucleotide to make double stranded DNA and then cloned into pCDNA3 vector (Invitrogen). The RNA corresponding to SLUI e+f sequences were generated in vitro by Runoff transcription using T7 RNA polymerase and the RNA was tested for its inhibitory effect in the in vitro translation assays.
Examples of assay:
In vitro translation: In vitro translation was carried out using 1 ug of template RNA in 17 ul of micrococcal nuclease-treated Rabbit Reticulocyte Lysate (RRL) medium (Promega) and either 0.5 ul each of amino acid mixtures minus methionine and minus cysteine or 20 uCi of S methionine (Perkin Elmer). The reaction mixtures were preincubated with in vitro transcribed small RNAs as indicated in the results. After adding template RNA, the reaction mixtures were incubated at 30 °C for 1 h 30 min, and the products were analyzed either by Dual Luciferase assay system (Promega) in a TD 20/20 Luminometer (Turner Designs, Sunnyvale, CA) or resolved on SDS-12.5 % polyacrylamide gel followed by phosphorimaging (Fuji Imaging, Japan).
DNA and RNA transfection: 60%- 70% confluent monolayers of HeLa and Huh 7 cells in 35-mm dishes were co-transfected with plasmid DNAs using Tfx 20 reagent (Promega) as indicated in results. The cells were harvested 48 h after transfection and luciferase activity was assayed. Huh 7 cells were co-transfected with in vitro transcribed RNAs using Tfx 20 reagent as indicated in results. The cells were harvested 16 h after transfection and luciferase activity was assayed. DNA and RNA quantities were normalized using pGEM 3Z DNA (Promega) or an in vitro transcribed RNA corresponding to its polylinker sequence. Huh 7 cells were transfected with the BB7 HCV subgenomic replicon RNA followed by retransfection with SL IJJ e+f RNA after 16

h. 24 h after transfection with SL III e+f, the cells were harvested and the total RNA was isolated using Tri Reagent (Sigma Aldrich).
Ribosomal Assembly assay: 32P-labeled HCV 5'UTR RNA (~105 cpm) was added to 25 ul of translation reaction containing 17.5 ul RRL, in presence or absence of 200 fold excess of SL III e+f RNA. 2 mM 5'-Guanylyl-imidophosphate (GMP-PNP, Sigma Aldrich) was added to the reaction as indicated in the results. The reactions were incubated at 30 °C for 15 min, diluted to 150 ul with gradient buffer (20 mM Tris-Cl, pH 7.5, 100 mM KC1, 3 mM MgCl2, ImM DTT) and overlaid on a 5%- 30% linear sucrose gradient. The ribosomal complexes were sedimented by ultracentrifiigation for 3 h at 4 °C and 30000 rpm. 500 ul fractions were collected from the bottom of the column and the radioactivity was measured in a liquid scintillation counter.
Methodology for other experiments and data analysis:
in vitro transcription: The plasmid pRL-HCVlb was linearized downstream of Flue and transcribed using T7 RNA polymerase in the presence of RNA Cap Analog (Invitrogen) to generate the bicistronic capped RNA. The plasmids pCD-SL II, SLIII and SL IV were linearized with Eco RI and transcribed by in vitro run-off transcription reactions under standard conditions using reagents from Promega. 32P-labeled HCV 5' UTR RNA and the SL RNAs were transcribed from respective plasmids using T7 RNA polymerase and a-32P Uridine tri-phosphate (Perkin Elmer Life Sciences, Boston, MA).
Ultraviolet light- induced crosslinking of proteins with RNA: The in vitro transcribed 32P-labeled RNAs were incubated widi HeLa S10 extract or purified protein in 2X RNA binding buffer and UV-crosslinked as described earlier (19). Unbound RNAs were digested by treatment with 30 jig of RNase A at 37 °C for 30 min. The protein-nucleotidyl complexes were electrophoresed on SDS-10 % polyacrylamide gels followed by autoradiography.
Statistical analysis: The mean ± SD of five independent in vitro translation experiments is represented. Data from the co-transfection experiments is expressed as mean + SD of three independent replicates. The significance of differences between means was tested

by Student's t test. ICSo values for inhibitory RNAs were determined by non-linear regression analysis of the inhibition curves using SigmaPlot (SPSS Inc., Chicago, IL).
Experimental evidences:
1. Specific inhibition of HCV IRES-mediated translation by RNA corresponding to
SL HI of the HCV 5'UTR.
PvNAs corresponding to the three major domains of the HCV 5'UTR: SL II, SL HI (excluding SL m e+f) and SL IV (including SL m e+f) (Fig. 1A) were transcribed in vitro. 100-fold and 200-fold excess of these RNAs was exogenously added to in vitro translation reactions of the Rluc-HCV-Fluc bicistronic RNA and the reporter gene products were radiolabeled (Fig IB). The three RNA molecules differentially inhibited HCV IRES-mediated translation of Flue and cap-dependent translation of Rluc in a dose-dependent manner. SL II did not significantly inhibit either IRES-mediated or cap-dependent translation whereas SL IV was found to inhibit both. SL in RNA was found to strongly inhibit HCV IRES-mediated translation with no significant effect on cap-dependent translation (Fig. IB). Similar results were obtained when the luciferase activity from non-radiolabeled reporter gene products was assayed (Fig. 1C). SL HI RNA caused a maximum 80% reduction of Flue activity whereas there was 73% and 57% inhibition at corresponding doses of SL IV and SL n respectively (Fig. 1C). IC50 values for SL HI, IV and II were determined to be respectively 35-fold, 60- fold and 152-fold excess of the template RNA. There was no significant inhibition of Rluc activity by either SL ID or SL n, whereas SL IV caused 68% inhibition at 200-fold excess concentration (Fig. ID). These observations indicate both an efficient and selective inhibition of HCV IRES-mediated translation by SL III which was significantly higher than that caused by SL II or SL IV RNA (P< 0.01). SL IV caused a strong inhibition of both HCV IRES-mediated translation and cap-dependent translation whereas the effect of SL II on either was not pronounced.
2. Specific inhibition of HCV IRES-mediated translation in vivo.

As SL III was found to strongly inhibit HCV IRES-mediated translation in vitro, we next tested its translation inhibitory activity in vivo. For this purpose, three-way co-transfections were performed in HeLa and Huh7 cells using pRL-CMV, pCD-HCV-Fluc and two different concentrations of pCD-SL III and pCD-SL II DNAs. The pCD-HCV-Fluc contained the entire 341 nt long HCV 5'UTR together with 42 nt from the coding region of the core to maintain the pseudoknot structure around SL IV and enhance the efficiency of translation. pRL-CMV was used to generate a capped Rluc transcript in vivo. Approximately 100 ng of both the plasmid DNAs were co-transfected along with two concentrations of either SL II or SL HI encoding DNA. SL II, which had not shown a significant effect on either IRES-mediated or cap-dependent translation in vitro, was utilized as the negative control hi these experiments. The combined data obtained from three co-transfection experiments in HeLa cells showed that SL HI significantly (P< 0.01) inhibited the HCV IRES-driven translation of Flue at both concentrations (74% and 85% inhibition respectively) whereas there was no significant effect on the cap-dependent translation of Rluc (Fig. 2A). The effect of SL II on both cap-dependent and IRES-mediated translation in vivo was not significant compared to the control. The co-transfection experiments were repeated in Huh7 cells which is a human hepatocellular carcinoma cell line supporting efficient HCV replication. There was a significant inhibition (P< 0.01) of HCV IRES-mediated translation by SL III (Fig. 2B) although the extent of inhibition was comparatively less (37% and 68% inhibition at two concentrations) than that observed in HeLa cells using similar quantities of transfected DNA. These data demonstrate that SL III RNA could specifically inhibit HCV IRES-mediated translation in bom non-liver-derived (HeLa) and liver-derived (Huh7) cells.
3. Specific inhibition of HCV IRES-mediated translation in vivo in hepatocellular carcinoma cells constitutively expressing the inhibitor SLIII RNA.
In order to investigate whether the constitutive expression of the SL III RNA in cells had any cytotoxic effect, a Huh7 cell line, stably transfected with the pCD-SL m-Ribo plasmid (Fig. 3A), was generated.

This cell line, Huh-HCVSLHI did not show any cytotoxic effect for the period of four months during which it was monitored. Other parameters like cellular morphology and doubling time also remained unchanged. The constitutive expression of the SL in RNA was investigated by RT-PCR analysis of total RNA extracted from these cells using SL HI specific primers. Semi-quantitative RT-PCR showed that the SL in RNA was expressed at a high level in the Huh-HCVSLm cell line, but was absent in untransfected Huh7 cells (Fig.3 B). A control RT-PCR using p-actin specific primers demonstrated that the level of transcription of actin in the Huh-HCVSLIU cells was similar to that in untransfected Huh7 cells, suggesting that the transcription of a housekeeping gene like actin was not compromised in these cells (Fig.3 B).
In order to investigate the effect of SL III expression on cellular protein synthesis, Huh-HCVSLIII cells and untransfected Huh7 cells were metaboHcally labeled using 35S-Mef35S-Cys and the proteins were resolved by SDS-PAGE. No difference in the cellular protein synthesis between the stably transfected and untransfected cells was observed

Documents

Application Documents

# Name Date
1 224-che-2004 pct.pdf 2011-09-02
2 224-che-2004 form-5.pdf 2011-09-02
3 224-che-2004 form-3.pdf 2011-09-02
4 224-che-2004 form-26.pdf 2011-09-02
5 224-che-2004 form-18.pdf 2011-09-02
6 224-che-2004 form-1.pdf 2011-09-02
7 224-che-2004 description (provisional).pdf 2011-09-02
8 224-che-2004 description (complete).pdf 2011-09-02
9 224-che-2004 description (complete) duplicate.pdf 2011-09-02
10 224-che-2004 correspondence po.pdf 2011-09-02
11 224-che-2004 correspondence others.pdf 2011-09-02
12 224-che-2004 claims.pdf 2011-09-02
13 224-che-2004 claims duplicate.pdf 2011-09-02
14 224-che-2004 abstract.pdf 2011-09-02
15 224-che-2004 abstract duplicate.pdf 2011-09-02
16 224-che-2004 abstract (provisional).pdf 2011-09-02

ERegister / Renewals

3rd: 19 Jan 2009

From 12/03/2006 - To 12/03/2007

4th: 19 Jan 2009

From 12/03/2007 - To 12/03/2008

5th: 19 Jan 2009

From 12/03/2008 - To 12/03/2009

6th: 19 Jan 2009

From 12/03/2009 - To 12/03/2010

7th: 09 Mar 2010

From 12/03/2010 - To 12/03/2011

8th: 09 Feb 2011

From 12/03/2011 - To 12/03/2012

9th: 29 Feb 2012

From 12/03/2012 - To 12/03/2013

10th: 28 Jan 2013

From 12/03/2013 - To 12/03/2014

11th: 05 Jun 2015

From 12/03/2014 - To 12/03/2015

12th: 05 Jun 2015

From 12/03/2015 - To 12/03/2016