Sign In to Follow Application
View All Documents & Correspondence

"Alpha Crystallin Based Immunization Against Mycobacterium And Methods Thereof"

Abstract: The present invention provides a recombinant BCG over-expressing α-crystallin protein for use in generating an immunogenic response in a subject against Mycobacterium and a vaccine formulation comprising the recombinant BCG. The invention further provides a prime boost vaccination approach against the Mycobacterium and a vaccination kit for the same.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
09 March 2009
Publication Number
38/2010
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

UNIVERSITY OF DELHI
DEPT OF BIOCHEMISTRY, SOUTH CAMPUS BENITO JUAREZ ROAD, NEW DELHI-110021, INDIA.
DEPARTMENT OF BIOTECHNOLOGY
GOVT OF INDIAN, MINISTRY OF SCIENCE AND TECHNOLOGY, BLOCK-2, 7TH FLOOR, C.G.O COMPLEX, LODHI ROAD, NEW DELHI-110003, INDIA.

Inventors

1. TYAGI, ANIL KUMAR
DEPARTMENT OF BIOCHEMISTRY, UNIVERSITY OF DELHI SOUTH CAMPUS, NEW DELHI 110021, IN.
2. DEY, BAPPADITYA
DEPARTMENT OF BIOCHEMISTRY, UNIVERSITY OF DELHI SOUTH CAMPUS, NEW DELHI 110021, IN.
3. JAIN, RUCHI
DEPARTMENT OF BIOCHEMISTRY, UNIVERSITY OF DELHI SOUTH CAMPUS, NEW DELHI 110021, IN.
4. KHERA, APARNA
DEPARTMENT OF BIOCHEMISTRY, UNIVERSITY OF DELHI SOUTH CAMPUS, NEW DELHI 110021, IN.
5. VADAKKUPPATTU DEVASENAPATHI, RAMANATHAN
DEPARTMENT OF CLINICAL PATHOLOGY, TUBERCULOSIS RESEARCH CENTER, CHETPET,CHENNAI 600031, IN.
6. GUPTA, UMESH DATTA
NATIONALJALMA INSTITUTE FOR LEPROSY & OTHER MYCOBACTERIAL DISEASES, TAJGANJ, AGRA, 282001, IN.
7. KATOCH, VISHWA MOHAN
NATIONALJALMA INSTITUTE FOR LEPROSY & OTHER MYCOBACTERIAL DISEASES, TAJGANJ, AGRA, 282001, IN.

Specification

FILED OF INVENTION
The present invention relates to α-crystallin based immunization against Mycobacterium.
BACKGROUND OF THE INVENTION
Tuberculosis (TB) is a disease of global concern and represents one of the oldest enemies of the human race killing more than 2 million people annually (Global Tuberculosis Control: surveillance, planning, financing. In WHO report 2008, Geneva: World Health Organization). One of the major contributing factors to the success of Mycobacterium tuberculosis (M. tb) as a human pathogen is its ability to survive the hostile immune responses and persist in a dormant state without causing active disease for long periods of time. It is estimated that l/3rd of the world's population is latently infected with M. tb, and majority of the contagious tuberculosis (TB) cases arise due to reactivation of this enormous pool of latent TB infection. Thus latency and reactivation contribute significantly to the problems associated with the incidence, transmission and pathogenesis of TB. M. bovis Bacille Calmette Gurein (BCG), the only vaccine currently in use against TB, provides consistent protection against severe child hood TB meningitis, however, it does not confer adequate protection against pulmonary TB in adults. More over, the deterioration of the BCG induced immunity through child hood and young adult life (25-35 years) coincides with a gradual increase in the incidence rate in the TB endemic regions. (Hart, P. D. and Sutherland, I. (1977), Does the efficacy of BCG decline with time since vaccination? Int J Tuberc Lung Dis 2, 200-7; Hart PD, Sutherland I (1977) BCG and vole bacillus vaccines in the prevention of tuberculosis in adolescence and early adult life. Br Med J 2, 293-5). In addition, repeated immunization with BCG does not show any improvement over the single dose regimen (Rodrigues, L. C. (1996), BCG revaccination against tuberculosis. Lancet 348, 611). Thus, an efficient global control of TB requires development of vaccination strategies that improve BCG rather than replace it.
Expression of immunodominant mycobacterial proteins by DNA vaccines is known to direct the immune system towards stronger and persistent CD4 and CD8 T cell responses, which constitute an important component of anti-mycobacterial immunity. However, a report by Kaufman and colleagues, have described lack of protection by DNA vaccine expressing this antigen against M. tb infection in mice (Mollenkopf, H. J., Grode, L., Mattow, J., Stein, M., Mann, P., Knapp, B., Ulmer, J. and Kaufmann, S. H. (2004). Application of mycobacterial proteomics to vaccine design: improved protection by Mycobacterium bovis BCG prime-Rv3407 DNA boost vaccination against tuberculosis. Infect Immun 72, 6471-9).
SUMMARY OF THE INVENTION
The present invention relates to a recombinant BCG over-expresseing a-crystallin and the prime boost approach for vaccination against tuberculosis using the BCG.
One aspect of the present invention relates to a recombinant BCG over-expresseing a-crystallin protein for use in generating an immunogenic response in a subject against Mycobacterium, wherein the BCG comprises recombinant vector having nucleotide sequence coding for a-crystallin protein.
One aspect of the present invention relates to a vaccine formulation for generating an immunogenic response in a subject against Mycobacterium, wherein the formulation comprises an immunologically effective amount of the recombinant BCG.
One aspect of the present invention relates to a process for producing a recombinant BCG over-expressing a-crystallin protein from Mycobacterium as- disclosed in the present invention, the process comprising: introducing a nucleotide sequence coding for a-crystallin protein from Mycobacterium into a suitable expression vector to obtain a recombinant vector and transforming BCG with the recombinant vector to obtain a recombinant BCG over-expressing a-crystallin protein.
One aspect of the present invention relates to a process of generating an immunogenic response in a subject against Mycobacterium, the process comprising administering to the subject vaccine formulation as disclosed in the present invention.
One aspect of the present invention relates to a vaccination kit comprising a priming formulation comprising the recombinant BCG as disclosed in the present invention and a boosting formulation comprising nucleotide sequence coding for a-crystallin protein for sequential administration.
One aspect of the present invention relates to a vaccination kit comprising a priming formulation comprising BCG over-expressing a-crystallin protein and a boosting formulation comprising nucleotide sequence coding for a-crystallin protein for sequential administration.
Another aspect of the present invention relates to a process of generating an immunogenic response in a subject against Mycobacterium, the process comprising administering to the subject a priming formulation comprising the recombinant BCG as disclosed in the present invention and a boosting formulation comprising nucleotide sequence coding for a-crystallin protein for sequential administration.
Yet another aspect of the present invention relates to a process of generating an immunogenic response in a subject against Mycobacterium, the process comprising administering to the subject a priming formulation comprising BCG and a boosting formulation comprising nucleotide sequence coding for a-crystallin protein for sequential administration.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1: shows outline for cloning of the gene encoding a -crystallin in mycobacterial expression vector pSD5.hsp65
Figure 2: shows the experimental protocol for the evaluation of protective efficacy in Guinea pigs
Figure 3: shows effect of a -crystallin based vaccination regimens on lung (Figure. 3A) and spleen (Figure. 3B) bacillary load in guinea pigs following M. tb infection.
Figure 4: shows influence of vaccination on gross pathology in various organs following M. tb infection. Gross pathological damage in lung (Figure. 4A), spleen (Figure. 4B) and liver (Figure. 4C) was scored and graded from 1-4 based on the extent of involvement, number and size of tubercles, areas of inflammation and necrosis.
Figure 5: shows granulomatous response in lung and liver of guinea pigs at 10 weeks post-infection. The figure depicts the granuloma percent in lung (Figure. 5A) and liver (Figure. 5B), respectively by box plot, wherein median values are denoted by horizontal line, the mean is represented by '+', inter quartile range by boxes, and the maximum and minimum values by whiskers, **, p '< 0.01, when compared to the saline group (Mann-Whitney U test).
Figure 6: shows bacillary load in lung and spleen of guinea pigs immunized with various vaccines based on a-crystallin. Immunized and saline treated guinea pigs were challenged via aerosol route with 50 - 100 bacilli of M. tb H37Rv and bacillary load was determined in lung (Figure. 6A, 6C) and spleen (Figure. 6B, 6D) at 10 and 16 weeks post-challenge, respectively.
Figure 7: shows influence of vaccination on gross pathology in various organs following M. tb infection. Gross pathological damage in lung, liver and spleen was scored and graded from 1-4 based on the extent of involvement, number and size of tubercles, areas of inflammation and necrosis. The gross scores are represented graphically for Exp-II at 10 weeks (Figure. 7A- Figure. 7C) and 16 weeks (Figure. 7D-Figure. 7F) post-challenge.
Figure 8: shows histopathological changes in lung and liver of guinea pigs immunized with heterologous prime boost regimens and infected with Mtb. The figure depicts the granuloma percent in lung (Figure. 8A, 8C) and liver (Figure. 8B, 8D), respectively by
box plot, wherein median values are denoted by horizontal lines, the mean is represented by '+', inter quartile range by boxes, and the maximum and minimum values by whiskers. *, p < 0.05, **,p < 0.01, when compared to the saline group; Φ, p < 0.05 and ΦΦ, p < 0.01, when compared to the BCG group (Mann-Whitney U test).
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to a-crystallin based prime boost vaccination against tuberculosis. The present invention provides a recombinant BCG over-expresseing a-crystallin protein for use in generating an immunogenic response in a subject against Mycobacterium. The invention further provides prime boost vaccination approach against the Mycobacterium, wherein vaccination is performed by priming a subject with a priming composition comprising Mycobacterium antigen and boosting the subject with a boosting composition comprising a nucleic acid sequence encoding for an alpha crystalline protein. The invention also provides use of alpha crystalline protein as an antigen for vaccination against Mycobacterium.
The present invention provides a method of immunization against TB, the method comprises administering a single dose of BCG followed by a single dose of a-crystallin DNA vaccine.
The present invention provides a method of immunization against TB, the method comprises administering a single dose of recombinant BCG over expressing a-crystallin followed by a single dose of a-crystallin DNA vaccine.
In still yet another embodiment of the present invention there is provided a recombinant Mycobacterium bovis BCG strain that over expresses α-crystallin gene of Mycobacterium tuberculosis under the transcriptional control of a strong mycobacterial promoter.
One embodiment of the present invention provides an improved method of immunization against tuberculosis using recombinant BCG- α-crystallin.
In another embodiment there is provided a prime boost approach for immunization against tuberculosis using recombinant rBCG-α-crystallin
In further embodiment of the present invention there is provided a heterologous prime boost regimen for immunization against tuberculosis comprising injecting a single dose of BCG vaccine followed by a booster dose of DNA vaccine expressing α-crystallin.
In another embodiment of the present invention a regimen for immunization against tuberculosis comprising injecting a single dose of the recombinant BCG strain over-expressing α-crystallin of Mycobacterium tuberculosis under the transcriptional control of hsp65 promoter derived from M. leprae by intradermal (i.d.) route.
In another embodiment there is provided a regimen for immunization against tuberculosis comprising injecting a single dose of rBCGacr by i.d. route followed by a booster of DNAacr i.e. DNA vaccine by intramuscular (i.m.) route.
In yet another embodiment there is provided a regimen for immunization against tuberculosis comprising injecting a single dose of DNA vaccine i.e. DNAacr by i.m. route followed by a booster of rBCGacr by i.d. route.
Further in another embodiment, the present invention provides a regimen for immunization against tuberculosis comprising injecting only DNA vaccines i.e DNAacr by i.m. route thrice at 3 weeks interval.
In one embodiment, the present invention provides a regimen for immunization against tuberculosis comprising injecting plasmid DNA vector by i.m. route thrice at 3 weeks interval.
In another embodiment, the present invention provides a regimen for immunization against tuberculosis comprising injecting a single dose of M. bovis BCG by i.d. immunization.
One embodiment of the present invention provides a recombinant BCG over-expressing α-crystallin protein for use in generating an immunogenic response in a subject against Mycobacterium, wherein the BCG comprises recombinant vector having nucleotide sequence coding for α-crystallin protein.
One embodiment of the present invention provides a recombinant BCG over-expressing α-crystallin protein, wherein the a-crystallin protein is from Mycobacterium tuberculosis.
One embodiment of the present invention provides a recombinant BCG over-expressing α-crystallin protein, wherein the α-crystallin protein is from Mycobacterium bovis.
One embodiment of the present invention provides a recombinant BCG as, wherein the nucleotide sequence coding for α-crystallin protein is as set forth in SEQ IP NO: 1.
One embodiment of the present invention provides a recombinant BCG as disclosed in the present invention, wherein amino acid sequence of the a-crystallin protein is as set forth in SEQ ID NO: 2.
One embodiment of the present invention provides a recombinant BCG, wherein the BCG is selected from a group consisting of Danish strain, Glaxo strain, Pasteur strain, Tice strain and Connaught strain; preferably Danish strain.
One embodiment of the present invention provides a vaccine formulation for generating an immunogenic response in a subject against Mycobacterium, said formulation comprising an immunologically effective amount of the recombinant BCG as disclosed in the present invention.
One embodiment of the present invention provides a vaccine formulation as disclosed in the present invention, wherein the formulation further comprises an adjuvant and a pharmaceutically effective carrier.
One embodiment of the present invention provides a vaccine formulation for generating an immunogenic response in a subject against Mycobacterium, the formulation comprising an immunologically effective amount of the recombinant BCG as disclosed in the present invention.
One embodiment of the present invention provides a process for producing a recombinant BCG over-expressing α-crystallin protein from Mycobacterium, wherein the process comprises; introducing a nucleotide sequence coding for α-crystallin protein from Mycobacterium into a suitable expression vector to obtain a recombinant vector and transforming BCG with the recombinant Vector to obtain a recombinant BCG over-expressing α-crystallin protein.
One embodiment of the present invention provides a process for producing a recombinant BCG over-expressing α-crystallin protein, wherein the transformation of BCG strain with the recombinant vector results in over-expression of a-crystallin protein from an episomal plasmid.
One embodiment of the present invention provides a process for producing a recombinant BCG over-expressing α-crystallin protein, wherein the transformation of BCG strain with the recombinant vector results in the integration of the DNA coding for the a-crystallin protein into the chromosome of the recombinant BCG.
One embodiment of the present invention provides a process for producing a recombinant BCG over-expressing a-crystallin protein, wherein the BCG is selected from a group consisting of Danish strain, Glaxo strain, Pasteur strain, Tice strain and Connaught strain; preferably Danish strain.
One embodiment of the present invention provides a process for producing a recombinant BCG over-expressing a-crystallin protein, wherein said Mycobacterium is Mycobacterium tuberculosis or Mycobacterium bovis.
One embodiment of the present invention provides a process for producing a recombinant BCG over-expressing α-crystallin protein, wherein the nucleotide sequence coding for α-crystallin protein is as set forth in SEQ ID NO: 1.
One embodiment of the present invention provides a process for producing a recombinant BCG over-expressing α-crystallin protein, wherein amino acid sequence of the a-crystallin protein is as set forth in SEQ ID NO: 2.
One embodiment of the present invention provides a process for generating an immunogenic response in a subject against Mycobacterium, the process comprising administering to the subject vaccine formulation as disclosed in the present invention.
One embodiment of the present invention provides a process for generating an immunogenic response in a subject against Mycobacterium, wherein the Mycobacterium is either Mycobacterium tuberculosis or Mycobacterium bovis.
One embodiment of the present invention provides a process for generating an immunogenic response in a subject against Mycobacterium, wherein said vaccine formulation is administered via oral, subcutaneous, intraperitoneal, intravenous, intramuscular, intradermal or respiratory route.
One embodiment of the present invention provides use of the recombinant BCG over-expressing a-crystallin as disclosed in the present invention for the preparation of pharmaceutical formulation for use as a vaccine against tuberculosis.
Another embodiment of the present invention provides a vaccination kit comprising (i) a priming formulation comprising the recombinant BCG as disclosed in the present invention and (ii) a boosting formulation comprising nucleotide sequence coding for a-crystallin protein for sequential administration.
Another embodiment of the present invention provides a vaccination kit comprising (i) a priming formulation comprising BCG over-expressing α-crystallin protein and (ii) a
boosting formulation comprising nucleotide sequence coding for a-crystallin protein for sequential administration.
Another embodiment of the present invention provides a process for generating an immunogenic response in a subject against Mycobacterium, the process comprising administering to said subject a priming formulation comprising the recombinant BCG as disclosed in the present invention and a boosting formulation comprising nucleotide sequence coding for α-crystallin protein for sequential administration.
Another embodiment of the present invention provides a process for generating an immunogenic response in a subject against Mycobacterium, said process comprising administering to said subject a priming formulation comprising BCG over-expressing a-crystallin protein and a boosting formulation comprising nucleotide sequence coding for α-crystallin protein for sequential administration.
Another embodiment of the present invention provides a process for generating an immunogenic response in a subject against Mycobacterium, wherein said Mycobacterium is Mycobacterium tuberculosis or Mycobacterium bo-vis.
Another embodiment of the present invention provides a process for generating an immunogenic response in a subject against Mycobacterium, wherein the priming formulation is administered via oral, subcutaneous, intraperitoneal, intravenous, intramuscular, intradermal or respiratory route, preferably via intradermal route.
Another embodiment of the present invention provides a process for generating an immunogenic response in a subject against Mycobacterium, wherein the boosting formulation is administered orally, subcutaneously, intraperitonealy, intravenously, intramuscularly, intradermaly or via respiratory route, preferably via intramuscular route.
An embodiment of the present invention provides a use of a recombinant BCG overexpressing α-crystallin protein as disclosed in the present invention for the preparation of pharmaceutical formulation for vaccination against tuberculosis.
An embodiment of the present invention provides a use of a recombinant BCG, wherein amino acid sequence of the α-crystallin protein is as set forth in SEQ ID NO: 2 encoded by the nucleotide sequence as set forth in SEQ ID NO: 1.
A further embodiment of the present invention provides a use of a recombinant vector comprising nucleotide sequence coding for α-crystallin protein for the preparation of pharmaceutical formulation for vaccination against tuberculosis.
A further embodiment of the present invention provides a use of a recombinant vector comprising nucleotide sequence as set forth in SEQ ID NO: 1 coding for α-crystallin protein having amino acid sequence as set forth in SEQ ID NO: 2 for the preparation of pharmaceutical formulation for vaccination against tuberculosis.
A yet another embodiment of the present invention provides a use of the recombinant vector as disclosed in the present invention, wherein said recombinant vector is a eukaryotic expression vector.
The present invention describes the importance of α-crystallin (Rv2031c) of Mycobacterium tuberculosis as a vaccine candidate against TB. Further, the invention provides recombinant Mycobacterium bovis BCG- α-crystallin (rBCGacr) based immunization against TB. The invention also provides a method for developing the recombinant Mycobacterium bovis BCG strain that over expresses a-crystallin antigen of Mycobacterium tuberculosis under the transcriptional control of a strong mycobacterial promoter. Moreover, the invention provides a method to assess the protective efficacy of recombinant Mycobacterium bovis α-crystallin against Mycobacterium tuberculosis infection. The present invention also provides DNA vaccine (DNAacr) expressing a-crystallin based immunization against TB.
The invention also provides a method of immunization against TB by employing DNA vaccine as a booster vaccine subsequent to either BCG or rBCGacr vaccines.
In the present invention, the protective efficacy of α-crystallin based regimens were assessed in a highly susceptible guinea pig model against M. tuberculosis challenge by
the aerosol route. Immunization of guinea pigs with the heterologous prime boost regimens, (i) a single dose of BCG followed by a booster dose of DNAacr and (ii) a single dose of rBCGacr followed by a booster dose of DNAacr resulted in a significantly enhanced protection characterized by a marked reduction in bacillary load in lungs and spleen along with a significantly reduced pathology in various organs, when compared to BCG immunization.
Surprisingly it was found that (i) a single dose of BCG followed by a booster dose of DNAacr and (ii) a single dose of rBCGacr followed by a booster dose of DNAacr regimens have excellent imuno-protective efficacy against tuberculosis.
Development of rBCGacr: Gene encoding for a-crystallin (Rv2031c) was amplified using polymerase chain reaction from M. tuberculosis genomic DNA and cloned in expression vector under the transcriptional control of a strong promoter (hsp65 of M. leprae) known in the art. Several promoters of varying strength were screened for expression of gene encoding various antigens of M. tuberculosis and hsp65 promoter was selected as the promoter consistently provided maximum expression of the genes. Example of some of the expression vectors employed for over-expression of these antigens under the transcriptional control of strong mycobacterial promoters like hsp65, S16, acr, T106 and T31 were pSD5.hsp65, pSD5.S16, pSD5.acr, pSD5.T106 and pSD5.T31 (Dhar, N., Rao, V. and Tyagi, A. K. (2000), Recombinant BCG approach for development of vaccines: cloning and expression of immunodominant antigens of M. tuberculosis, FEMS Microbiol Lett 190, 309-16).
Nucleotide sequence coding for α-crystallin antigen is provided in SEQ ID No: 1 and amino acid sequence of α-crystallin antigen is provided in SEQ ID No: 2.
Detailed procedure of preparing recombinant Mycobacterium bovis BCG comprising the recombinant vectors carrying α-crystallin gene is provided in Fig 1.
α-crystallin based vaccination regimens:
Various immunization regimens based on a-crystallin were evaluated for their protective potential against TB. Details are given in the Fig.2.
rBCGacr: A single dose of a recombinant M. bovis BCG strain over-expressing a-crystallin of M. tuberculosis under the transcriptional control of hsp65 promoter derived from M. leprae by intradermal (i.d.) route.
rBCGacr/DNAacr: The regimen comprises injecting a single dose of rBCGacr by intradermal (i.d) route followed by a booster of DNAacr i.e. DNA vaccine by intramuscular route (100 µg, i.m.) at 6 weeks.
DNAacr/rBCGacr: The regimen comprises injecting a single dose of DNA vaccine i.e. DNAacr (100 µg, i.m) followed by a booster of rBCGacr by i.d. route at 3 weeks.
DNA: The regimen comprises injecting only DNA vaccines i.e DNAacr (100 µg, i.m.) thrice at 3 weeks interval.
Vector: The regimen comprises injecting plasmid DNA vector (100µg, i.m.) (devoid of the gene encoding for α-crystallin) thrice at 3 weeks interval.
BCG: The regimen comprises injecting a single dose of BCG - an attenuated strain of M. bovis by i.d. immunization.
BCG/DNAacr: The regimen comprises injecting a single dose of BCG by intradermal (i.d) route followed by a booster of DNAacr i.e. DNA vaccine by intramuscular route (100 µg, i.m.) at 6 weeks.
Saline: The regimen comprises injecting a single dose of normal saline by i.d. injection.
The present invention relates to a vaccine against the Mycobacterium strain, comprising a priming composition and a boosting composition; wherein said priming composition comprises at least one sub unit of Mycobacterium antigen and boosting composition comprises nucleic acid sequence encoding for a polypeptide as set forth in SEQ ID No. 1 and 2 respectively.
The invention further provides a method of eliciting an immune response against the Mycobacterium strain by administering said vaccine composition.
The present invention relates to a vaccine against the Mycobacterium tuberculosis, comprising a priming composition and a boosting composition; wherein the priming composition comprises BCG and boosting composition comprises nucleic acid sequence encoding for a polypeptide as set forth in SEQ ID No. 1 and 2 respectively.
Construction of rBCGacr vaccine over-expressing a -crystallin: For construction of rBCGacr over-expressing a -crystallin, pSD5.hsp65- the hsp65 promoter derivative of Mycobacteria - Escherichia coli shuttle plasmid pSD5 was employed. The hsp65 promoter allowed over expression of the a -crystallin (Dhar, N., Rao, V. and Tyagi, A. K. (2000). Recombinant BCG approach for development of vaccines: cloning and expression of immunodominant antigens of M. tuberculosis. FEMS Microbiol Lett 190, 309-16;) (Dhar et al., 2000; Jain, S., Kaushal, D., DasGupta, S. K. and Tyagi, A. K. (1997). Construction of shuttle vectors for genetic manipulation and molecular analysis of mycobacteria. Gene 190, 37-44). Gene encoding mycobacterial α -crystallin (Rv2031c) was PCR amplified by using M. tb H37Rv genomic DNA as the template and gene specific primers with Ndel and Mlul over hangs, forward primer 5'gggcatcatatggccaccaccc 3' (SEQ ID NO: 3) and reverse primer 5'gggacgcgtcagttggtggaccggatgtg 3' (SEQ ID NO: 4). The strategy employed for cloning of the gene encoding a -crystallin protein is depicted schematically in Fig 1. The PCR Amplicon, after end repair, was sub-cloned into pLITMUS38 at EcoR V site generating pLITMUS38.acr. The gene fragment was excised out from pLITMUS38.acr by restriction digestion with Ndel and Mlul followed by cloning into pSD5.hsp65 at Ndel and Mlul restriction sites. The resultant construct was designated as pSD5.hsp65.acr (Fig. 1). The mycobacterial origin of DNA replication is designated as Ori M; p15A represent the E. coli origin of DNA replication; TER2, TER3 and TER4 are the transcriptional terminators; Pro is the hsp65 promoter. For preparation of rBCGacr, the cells of BCG Danish strain were transformed with pSD5.hsp65.acr.
rBCGacr strain expressed and secreted considerably higher levels of a -crystallin (by 15 fold in cytosolic fraction) in comparison to the parental BCG strain.
Evaluation of protective efficacy of a -crystallin based vaccines in guinea pigs:
For protective efficacy studies, two experiments were carried out. Exp-I was a preliminary experiment for the evaluation of the protective efficacy of rBCGacr and DNAacr vaccines, when used alone. In this experiment, groups of 6 guinea pigs were immunized with either rBCGacr or DNAacr vaccine and were challenged 6 weeks after the last immunization with 50-100 bacilli of virulent M. tb H37Rv via the respiratory route in an aerosol chamber (Fig. 2). Saline, BCG and vector treated animals served as the control groups. Guinea pigs were euthanized 10 weeks postinfection. In Exp-II, various heterologous prime boost regimens, combining the BCG or rBCGacr with DNAacr, were evaluated for their protective efficacy. Guinea pigs were immunized with one of the following combinations: (i) rBCGacr once, followed by a booster dose of DNAacr or vector at 6 weeks (R/P and R/V), (ii) DNAacr or vector, followed by a booster dose of rBCGacr once at 3 weeks (D/R and V/R) and (iii) BCG once, followed by a booster dose of DNAacr or vector at 6 weeks (B/D and B/V). BCG, rBCGacr and saline treated animals served as the control groups (Fig. 2). In this experiment guinea pigs were challenged at 12 weeks after the primary immunization and were euthanized at two different time points, at 10 weeks and 16 weeks post-infection. For the evaluation of protective efficacy, the following parameters were measured: (i) bacillary load in lung and spleen, (ii) gross pathological damage in lung, liver and spleen and (iii) histopathology of lung and liver (granuloma percent). A significant reduction in these parameters in vaccinated animals in comparison to the control groups was considered as a protective effect the vaccine.
Protective efficacy of a -crystallin based rBCG and DNA vaccines: On comparing the bacillary load, in Exp-I, at 10 weeks post-infection, immunization with both BCG and rBCGacr significantly reduced the bacillary load in both lung and spleen, when compared to the saline treated animals, however, the degree of protection varied
between these groups (Fig. 3). Although, immunization with rBCGacr resulted in only a comparable protection in lung, it significantly reduced the hematogenous spread to spleen, when compared to BCG vaccination (1.27 logio, p < 0.05). In contrast, DNAacr, when used alone in a homologous prime boost approach, did not result in any considerable reduction in bacillary load in comparison to the saline and vector treated animals.
Guinea pigs immunized with various vaccines were challenged via aerosol route with 50-100 bacilli and bacillary load was determined in the lungs and spleen at 10 weeks post-challenge. Guinea pigs (n = 6) immunized with rBCGacr showed a comparable reduction in lung (Figure. 3A) and significantly greater reduction of bacillary load in spleen (Figure. 3B), when compared to that of BCG immunization. DNAacr did not show any significant reduction in bacillary load in both lung and spleen in comparison to the saline and vector treated animals. Each point in the graph represents the Logio CFU value for an individual animal and the bar depicts mean (± SE) for each group. The lower limit of detection was 1.0 log10/g of tissue and animals with undetectable bacillary count were allotted 1 logio. Missing data points represent the animals that succumbed to disease before the time of euthanasia. **, p < 0.01, when compared to the saline group. Φ, p < 0.05, when compared to the BCG group (Man-Whitney U test).
The trend in gross pathological damage supported the findings of bacteriological evaluation, wherein, saline and vector treated animals showed increased pathological damage with numerous large sized granulomas in lung, liver and spleen (Fig. 4). Immunization of animals with both BCG and rBCGacr showed a significant reduction in pathological damage with very few small sized tubercles in lungs and spleen along with no evident pathological damage in liver. However, immunization with DNAacr, exhibited pathological damage comparable to that observed in vector treated animals.
At 10 weeks post infection BCG and rBCGacr regimens showed a significant reduction in gross pathological lesions in lung, liver and spleen compared to saline
treated animals. Immunization with DNAacr, failed to restrict pathological damage showing scores comparable to that observed in vector treated animals. Each point represents score for an individual animal and the bar depicts median (± inter quartile range) for each group. Missing data points represent the animals that succumbed to disease before the time of euthanasia. **, p < 0.01 and ***,p <0..001, when compared to the saline group (Mann-Whitney U test).
To study the effect of various vaccine regimens in preventing pulmonary and hepatic pathological damage, tissue sections were stained with H & E and areas of granulomatous inflammation were assessed by light microscopy. At 10 weeks postinfection with M. tb, saline treated animals developed extensive granulomatous lesions with multiple coalescing granulomas covering 46% area of the lung sections (Fig. 5). Immunization with both BCG and rBCGacr resulted in a significant reduction in pulmonary consolidation (14%) when compared to the saline control group. Commensurate to gross pathology, immunization animals with DNAacr alone resulted in extensive granulomatous inflammation in lung (32%), which was comparable to that observed in the saline and vector treated animals. On comparing the hepatic damage, vaccination with BCG and rBCG (2%) acr resulted only in a negligible granulomatous response, when compared to the saline treated animals (36%). Unlike rBCGacr, immunization with DNAacr resulted in a substantial increase in the granulomatous inflammation with multiple foci of cellular infiltration, as observed in vector treated animals.
Since rBCGacr showed significant protection over BCG vaccination, further studies were carried out to assess the ability of DNAacr to improve the protective efficacy of BCG or rBCGacr vaccines by employing these vaccines in various heterologous prime boost regimens with DNAacr.
Prime boost vaccination confers long-term superior protection: To determine the efficacy of various heterologous prime boost immunization strategies based on acr to limit the growth of M. tb in guinea pigs, the number of bacilli in lung and spleen were
estimated. In Exp-II, when guinea pigs were euthanized at 10 weeks post infection, BCG immunization resulted in a significant reduction in bacillary counts in both lung (0.94 logic P < 0.01) and spleen (1.48 logio, p < 0.01), when compared to saline treated animals (Fig. 6 A, B, Table I). Immunization with rBCGacr vaccine either alone or in various combinations with DNAacr resulted in a significant reduction in lung and spleen bacillary load, when compared to saline treated animals, however, the degree of protection varied amongst these groups. Vaccination with rBCGacr significantly reduced the lung and spleen bacillary load, which was comparable to that observed in BCG immunized animals. However, a booster dose of DNAacr subsequent to rBCGacr priming, significantly enhanced the protection, as demonstrated by a significant reduction in lung (1.34 logio) and spleen (1.72 logic P < 0.01) bacillary load in comparison to BCG vaccination. Moreover, DNAacr, when used as a priming agent prior to rBCGacr boosting, resulted in a phenomenal reduction in both lung and spleen bacillary load compared to that of BCG immunized animals (2.12 logic/? < 0.05 in lung and 4.08 logicP < 0.01 in spleen). Both the heterologous prime boost regimens afforded considerably greater reduction in bacillary load, when compared to their respective control groups, wherein, DNAacr was replaced by the vector treatment. Further more, in an attempt to boost the protective efficacy of BCG, when DNAacr was used as a boosting agent following BCG priming, it out-performed the BCG as evident from a significantly lower pulmonary and splenic bacillary load (1.37 logic p < 0.05 in lung and 1.96 logio, p < 0.01 in spleen) in B/D group when compared to BCG immunization.
On prolonging the post challenge period to 16 weeks, l/3.rd of the saline treated guinea pigs (2/6) succumb to the disease, however, the animals that survived, showed comparable bacillary load to that of BCG vaccinated animals (Fig. 6 C, D). At this time point, although BCG immunized animals did not show any mortality, no further reduction in bacillary load was observed, when compared to 10 weeks time point. Immunization with rBCGacr, although significantly reduced the lung bacillary load
(1.72 logio, p < 0.05), splenic bacillary count remained similar to that observed in BCG vaccinated animals. However, DNAacr, when used as a boosting agent subsequent to BCG or rBCGacr priming, significantly improved the protection afforded by solitary immunization with these vaccines, as evident from a consistent reduction in pulmonary (2.01 and 2.75 logics < 0.01, respectively) as well as splenic (1.47 and 1.65 logio, p < 0.05, respectively) bacillary load. However, in case of D/R regimen, although bacillary load in lung was reduced to significantly lower levels (1.06 logio,/? < 0.01), when compared to that of BCG immunization, bacillary load in spleen remained comparable. All the heterologous prime boost regimens afforded relatively greater reduction in bacillary load, when compared to their respective control groups. As evident from these observations, prime boost regimens, R/D and B/D, conferred superior protection against aerosol M. tb challenge, when compared to BCG immunization at least up to 16 weeks of infection.
In other words, at 10 weeks post-infection, guinea pigs (n = 5) immunized with both BCG and rBCGacr showed significant reduction in both lung and spleen bacillary load, when compared to the saline treated animals. Both the heterologous prime boost regimens (R/D and D/R) resulted in a significant reduction in bacillary load in both lung and spleen, when compared to BCG and to their respective control groups (R/V and V/R) (Figure. 6A, 6B). At 16 weeks post-infection, BCG immunized guinea pigs (n = 6) did not show any significant reduction in bacillary load in both lung (Figure. 6C) and spleen (Figure. 6D). rBCGacr and D/R regimens showed significant reduction in the lung bacillary load when compared to BCG vaccination and a comparable bacillary count in spleen. R/D and B/D regimens imparted significant protection, when compared to both BCG and rBCGacr immunized animals. Each point in the graph represents the Logio CFU value for an individual animal and the bar depicts mean (± SE) for each group. Missing data points represent the animals that succumbed to disease before the time of euthanasia. The lower limit of detection was 1.0 logio/g of tissue and animals with undetectable bacillary count were allotted 1 log 10. Missing
data points represent the animals that succumbed to disease before the time of euthanasia. *, p < 0.05 and **, p < 0.01, when compared to the saline group. O, p < 0.05 and <3>0, p < 0.01, when compared to the BCG group (Man-Whitney U test).
Table I: Effect of different vaccine regimens on lung and spleen bacillary load

(Table Removed)
Influence of prime boost vaccination on gross pathology: On comparing the gross pathology, at 10 weeks post infection, saline treated animals showed maximum pathological damage with extensive areas of necrosis and numerous large sized granulomas in lung, liver and spleen (Fig. 7 A). At 10 weeks post infection, BCG and rBCGacr regimens resulted in significant reduction in gross pathological lesions in lung, liver and spleen compared to saline treated animals. Both R/D and D/R regimens resulted in a comparable protection in lung and liver and a significantly lesser spleen pathology, when compared to BCG and rBCGacr immunized animals. B/D regimen showed comparable protection in spleen and liver and significantly reduced pulmonary pathology in comparison to BCG vaccination. By 16 weeks of infcetion, 2/6 of the saline treated animals succumbed to the disease. BCG and rBCGacr immunized guinea
pigs showed a moderate increase in pathological damage. All the heterologous prime boost regimens (R/D, D/R and B/D) resulted in a marked reduction in granulomatous lesions in lung, while remaining organs showed considerably lower gross scores, when compared to BCG vaccinated animals. Each point represents score for an individual animal and the bar depicts median (± inter quartile range) for each group. Missing data points represent the animals that succumbed to disease before the time of euthanasia. *,p < 0.05 and **, p <0.01, when compared to the saline group; 70 folds reduction in lung CFU at 16 weeks post-infection, when compared to the parent BCG vaccine, although the ability to restrict hematogenous spread remained comparable. However, when a DNA vaccine expressing a-crystallin was employed as a boosting agent subsequent to vaccination with parent BCG strain (B/D), resulted in a remarkable improvement in protective immunity induced by BCG, leading to > 100 folds and > 47 folds reduction in lung and spleen bacillary load, respectively. Furthermore, on substituting BCG with rBCGacr prior to boosting with DNAacr (R/D), a robust enhancement in the protective immunity was observed with a phenomenal reduction in the lung and spleen bacillary load (> 750 and > 65 folds, respectively) along with a commensurate reduction in the pathological damage in various organs. However, on reversing the order of immunization (D/R), despite a stupendous protection observed at 10 weeks post-infection with > 110 folds reduction in lung bacillary load and negligible bacillary count in spleen, by 16 weeks postinfection, its ability to restrict bacillary multiplication in spleen showed a considerable decline, although, it continued to impart a significant protection in lung with > 10 folds reduction in bacillary load in comparison to BCG vaccination.
The superior protection imparted by various regimens in this study provides multifaceted advantages in terms of their clinical relevance. Firstly, since majority of
the people in regions where TB is endemic, are immunized with BCG, it can be conceived that, DNAacr boosting might show a similar effect as that observed in our study. Although, in this study the influence of DNAacr boosting on BCG induced immunity has only been tested in a prophylactic mode in guinea pigs, its effect in the BCG immunized and latently infected population requires further verification in a suitable animal model of latent TB infection. Furthermore, evaluating the influence of varying the time and number of booster doses of DNAacr in a suitable experimental setting would help in designing a regimen, which is more efficacious and clinically relevant.
Secondly, rBCGacr can be used as a superior alternative to BCG in the newborn children as a prophylactic vaccine. This strategy will not only retain the beneficial attributes of BCG vaccination, will also generate effective immune response leading to enhanced and sustained protection against TB. A booster dose of DNAacr can be further employed to boost the pre-existing immunity induced by rBCGacr vaccination at an appropriate time during adolescence that would also prevent occurrence of reactivation TB.
Since, it is well acclaimed that BCG protects against childhood TB, replacing it with a vaccination regimen that does not include BCG would be neither ethical nor practical. From this perspective, the heterologous prime boost immunization strategies developed in this study, employing either BCG or rBCGacr as a primary immunizing agent and DNAaer as a booster would be of immense significance in simplifying the matter relating the clinical testing of new vaccines without hampering the child hood immunization program.
There are two issues. The first one relates to the working of α-crystallin so efficiently in spite of the fact that in earlier reports it was shown to be non-protective. This may be related to the following:
We have used an expression system that allows changes in the level of expression of the cloned gene depending upon the mycobacterial promoter used for the expression. The modular nature of the expression vector used in this work, mainly pSD5 permits testing of the expression of a gene under several mycobacterial promoters and choose the most appropriate one.
In rBCGacr, the a-crystallin gene is expressed under the hsp65 promoter, which is a very strong mycobacterial promoter leading to a high expression of the gene.
Under the hsp65 promoter, the a-crystallin protein is expressed at a high level of ~ 15.0 fold in the intracellular fraction.
We have used the Danish strain of BCG for the development of recombinant BCG, which is a currently a highly recommended strain for this purpose based on its unsurpassable safety and efficacy record. Some of the rBCG based vaccines that have shown promising results in earlier studies have used either Tice, Connaught or Pasteur strains of BCG for the development of recombinant BCG strains (Corbel MJ, Fruth U, Griffiths E, Knezevic I. Report on a WHO consultation on the characterization of BCG strains, Imperial College, London 15-16 December 2003.Vaccine. 2004 Jul 29;22(21-22):2675-80.)
The second issue in terms of the comparative protective values depicted in Table II relates to the improvements/ modifications that have been made in our approach of developing vaccine regimens based on a recombinant BCG vaccine. In this context we may state the following points:
• None of the TB vaccines depicted in Table II results from the same approach as used in the present invention.
• Vaccine composition no.l namely recombinant BCG85B (Table II) is based on the expression of Ag85B gene under its native promoter not under a very strong mycobacterial promoter.
• Vaccine composition no.2 namely, fusion protein of ESAT-6 and Ag85B is based on the injection of a purified fusion protein, hence in this case there is no continual production of protein as provided in the case of a live vaccine.
• Vaccine regimen no.3 in Table II is based on provision of BCG as a primary vaccine followed by booster dose of recombinant Modified Vaccinia Ankara virus expressing Ag85A and then a second booster in the form of a recombinant Fowl Pox Virus expressing Ag85A.
• The regimen no. 4 is based on recombinant BCG expressing Listeriolysin gene from Listeria monocytogenes, which supposedly helps in improved presentation of antigens by MHC class I pathway by allowing the BCG to escape phagolysosomal fusion and thereby come out in the cytosol. Thus this recombinant BCG approach is not based on the over expression of an M. tuberculosis antigen.
• The regimen No. 5 is based on the administration of a combination of BCG and a purified poly protein (72f fusion protein) comprising of domains from two different proteins stitched together.
• In the present invention the α-crystallin antigen regimen is based on the administration of recombinant BCG strain (expressing high levels of a-crystallin under one of the very strong promoters of Mycobacteria, namely hsp65) followed by a booster dose of DNA vaccine expressing a-crystallin. The extent of reduction in the bacillary load observed in the present invention by this regimen is remarkably greater than that observed for the vaccines known in the art for their high efficiency against TB infection (Regimens 1-5, Table II).
• In another regimen, DNAacr has been employed as a booster vaccine subsequent to BCG immunization. Although, DNAacr has been employed as a stand-alone vaccine in a homologous prime boost regimen by us as well as by other researchers, however, none of the studies so far have shown significant protection as shown by the BCG recombinant vaccine and the prime boost approach of the present invention
When DNA vaccine was employed as a booster subsequent to BCG in the present invention, the protection obtained was highly unexpected and surprising. The protection was markedly greater than that conferred by BCG vaccine when used alone.
The points stated above establish the fact that the vaccine of the present invention has not been employed earlier and result in very high levels of protection.
While development of more potent vaccines to replace BCG remained one of the most important goals of TB vaccine research, considering the enormous size of the population already vaccinated with BCG (> 4 billion), it becomes imperative to develop efficient booster vaccines that would not only (i) enhance the BCG induced immunity but also (ii) sustain the protection till old age. The robust enhancement and sustenance of protection by this regimen (B/D) in comparison to BCG, which showed a considerable decline in its efficiency to control disease progression suggests that, DNAacr if utilized, as a booster vaccine in population already immunized with BCG will help in sustaining the protection afforded by BCG.
The superior protection imparted by R/D regimen based on a-crystallin in this study provides multifaceted advantages in terms of their clinical relevance. Firstly, rBCGacr can be used as a superior substitute to BCG in the newborn children as a prophylactic vaccine. This strategy will not only retain the beneficial attributes of BCG vaccination, will also generate effective immune response leading to enhanced and sustained protection against TB. Secondly, a booster dose of DNAacr can be employed at an appropriate time during adolescence to further boost the immunity induced by rBCGacr. Since, during the transition from actively dividing to latent phase in vivo, tubercle bacilli up-regulates the production of α-crystallin, prevalence of memory immunity specific to this antigen will aid in enhanced recognition and clearance of the latent bacilli. Thus, vaccination with these regimens may also help in circumventing the problems associated with occurrence of latent and reactivation TB.

TABLE II: Comparative Description of the Protective Efficacy of Vaccines in Clinical Trials and Vaccine Regimens

(Table Removed)
EXAMPLES
The following examples are put forth so as to provide those of ordinary skill in the art with a complete invention and the description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all and only experiments performed.
Example 1: Microbiological techniques
Various recombinant strains of E. coli were grown either in LB medium or in 2XYT medium containing appropriate antibiotic(s) by the conventional techniques and high efficiency competent cells were prepared by the standard CaCl2 method (Sambrook, J., Fritsch, E.F, and Maniatis, T. (1989). Molecular cloning. A laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press). Mycobacteria were cultured and electrocompetent cells prepared. Stocks of mycobacteria were then prepared for immunization and infection as described by Dhar, N., Rao, V. and Tyagi, A. K. (2003). Skewing of the Thl/Th2 responses in mice due to variation in the level of expression of an antigen in a recombinant BCG system. Immunol Lett 88, 175-84.
Example 2: E. coli transformation
Transformation of E. coli was carried out by the method described by Mandel and Higa (Mandel, M. and Higa, A. (1970). Calcium-dependent bacteriophage DNA infection. J Mol Biol 53, 159-62). Transformation of M. bovis was performed by electroporation method. 1 ug of plasmid DNA was mixed with 20 ul of electrocompetent cells, the cells were revived and the transformants were selected on MB7H11 agar plates supplemented with appropriate antibiotic(s) (Dhar, N., Rao, V. and Tyagi, A. K. (2003). Skewing of the Thl/Th2 responses in mice due to variation in the level of expression of an antigen in a recombinant BCG system. Immunol Lett 88, 175-84).
Example 3: Preparation of plasmid DNA from E. coli transformants
Mini-preparation of plasmid DNA: A mini preparation of plasmid DNA was performed by Alkaline lysis method or Boiling lysis method and maxi preparation of plasmid DNA: Plasmid DNA was isolated on a large scale by the alkaline SDS method (Sambrook, J., Fritsch, E.F, and Maniatis, T. (1989). Molecular cloning. A laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press).
Large-scale preparation of plasmid DNA vaccines: For immunization of mice and guinea pigs with DNA vaccines, recombinant DNA plasmids were purified on large scale by using the QIAGEN endofree giga kit as per the manufacturer's recommendation (Qiagen GmbH, Germany). Bacterial cells (2 liter culture) were harvested at 6000 g at 4°C for 15 min and resuspended in buffer PI (containing RNase, 0.1 mg/ml), followed by successive addition of buffer P2 and P3 (pre-chilled) at an interval of 5 min. The cell lysate was clarified by centrifugation at 6000 g at 4°C for 15 min, followed by filtration through QIA filter cartridge. Clarified cell lysate was then incubated with Endotoxin removal solution on ice for 30 min. prior to loading on to the Qiagen tip-1000 (pre-equilibrated with buffer QBT), cell lysate was clarified again by centrifugation at 6000 g at 4°C for 15 min and allowed to enter the resin by gravity flow. Contaminating proteins and low molecular weight impurities were removed by washing the resin with medium salt buffer (Buffer QC). Plasmid DNA was eluted with a high salt buffer (Buffer QN). After elution, plasmid DNA was desalted and precipitated with 0.7 v/v of isopropanol in sterile endotoxin free corex tubes and recovered by centrifugation at 17000 g at 4°C for 30 min. The pellet was washed with 70% ethanol, air-dried and resuspended in appropriate volume of endotoxin free water.
Example 4: Isolation of chromosomal DNA from mycobacteria
M. tuberculosis culture (100 ml) was grown to an Aeoo nm of 1.5 in MB7H9 medium at 37°C in an orbital shaker at 200 rpm followed by incubation with glycine (1%) at 37°C for 24 hr. Spheroplasts were harvested by centrifugation at 3,076 g at room
temperature for 10 min and were lysed by incubating first with lysis buffer (TEG containing lysozyme 2 mg/ml) at 37°C for 16 hr followed by incubation with 1% SDS and Proteinase K (0.71 mg/ml) at 55°C for 40 min with intermittent gentle swirling. The lysate was incubated with NaCl (1 M) and CTAB (1.5%) at 65°C for 10 min. Genomic DNA was extracted twice with phenol-chloroform (1:1) followed by chloroform extraction two times. DNA in the aqueous phase was precipitated by incubation with 0.6 v/v isopropanol at room temperature for 15 min. The genomic DNA spool was removed by using a sterile microtip washed with 70% ethanol, air-dried and resuspended in 100 ul autoclaved double distilled water. Agarose gel electrophoresis was carried out essentially as described by Sambrook et al (Sambrook, J., Fritsch, E.F, and Maniatis, T. (1989). Molecular cloning. A laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press). DNA fragments were recovered from agarose gel by using Amersham gel elution GFX columns as per the manufacturer's instructions.
Example 5: Construction of DNA vaccine expressing a-crystallin
DNA vaccine expressing a-crystallin was constructed as described previously (Khera, A., Singh, R., Shakila, H., Rao, V., Dhar, N., Narayanan, P. R., Parmasivan, C. N., Ramanathan, V. D. and Tyagi, A. K. (2005). Elicitation of efficient, protective immune responses by using DNA vaccines against tuberculosis. Vaccine 23, 5655-65). Briefly, the gene encoding a-crystallin (Rv2031c) was PCR amplified by using M. tb H37Rv genomic DNA as template and gene specific forward primer 5'gggagatctcatatgacagagcagcagtggaatttcgcggg3' (SEQ ID NO: 5) and reverse primer 5'gggagatctacgcgtctatgcgaacatcccagtgacgttgccttcgg3' (SEQ ID NO: 6). The PCR amplicon was subsequently cloned into EcoR V digested pLITMUS38 and the ligation mixture was used to transform E. coli XL-IB cells. The transformants were selected by blue white selection on LB plates containing Xgal, IPTG, ampicillin and tetracyclin. DNA fragments encoding a-crystallin gene were excised out by restriction digestion of recombinant plasmid, pLITMUS38.acr with Bgl II, and ligated with Bgl II
linearized vector pAK4. The ligation mixture was used to transform HB101 cells, transformants were selected on LB plates containing kanamycin and ampicillin and the plasmids isolated from the transformants were analysed by restriction enzyme digestion to confirm the presence and orientation of the gene. The resultant construct was designated as DNAacr (Khera, A., Singh, R., Shakila, H., Rao, V., Dhar, N., Narayanan, P. R., Parmasivan, C. N., Ramanathan, V. D. and Tyagi, A. K. (2005). Elicitation of efficient, protective immune responses by using DNA vaccines against tuberculosis. Vaccine 23, 5655-65).
Example 6: Methods for gene expression in E. coli and protein purification
Expression of genes in E. coli: For expression and purification of recombinant proteins, pQE30 vector was employed which allowed the expression of a protein as fusion protein with a Histidine tag (containing 6 His residues) towards N terminus of the expressed protein. Escherichia coli Ml5 cells were transformed with the a-crystallin derivative of pQE30 and the transformants were selected on LB plates containing ampicillin and kanamycin. Under conditions of maximal expression, cc-crystallin, was found to be aggregated resulting in insoluble inclusion bodies as disclosed in the present invention. In order to purify these His-tagged proteins sequestered in inclusion bodies, proteins were solublized with 8M urea as denaturant and purified by employing Ni-NTA based affinity chromatography. The protein purification was carried out by using Ni-NTA superflow resin as per the manufacturer's recommendations.
Example 7: Expression of antigens in mycobacteria
Expression of antigen a-crystallin in recombinant M. bovis BCG vaccine strain was analyzed as described in (Dhar, N., Rao, V. and Tyagi, A. K. (2003). Skewing of the Thl/Th2 responses in mice due to variation in the level of expression of an antigen in a recombinant BCG system. Immunol Lett 88, 175-84). Briefly, M. bovis BCG was separately transformed with pSD5.hsp65.acr. The amount of protein in the cell free

extracts was estimated by Bradford's method (Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248-54). Equal amounts of various protein samples (50 ug) were subjected to SDS - PAGE and immunoblot analysis.
Example 8: Procuring BCG strain
M. bovis BCG (Danish strain) was procured from BCG laboratories, Chennai, India. M. tuberculosis H37Rv was kindly provided by Dr. J. S. Tyagi, All India institute of medical sciences, New Delhi, India. BCG, rBCG85C and M. tuberculosis strains were grown to mid-log phase in Middle Brook (MB) 7H9 media and stocks were prepared as described earlier (Singh, R., Rao, V., Shakila, H., Gupta, R., Khera, A., Dhar, N., Singh, A., Koul, A., Singh, Y., Naseema, M. et al. (2003). Disruption of mptpB impairs the ability of Mycobacterium tuberculosis to survive in guinea pigs. Mol Microbiol 50, 751-62).
Example 9: Preparation of antigens for immunization
For preparation of rBCGacr, a Mycobacteria - Escherichia coli shuttle plasmid pSD5.pro (Dhar, N., Rao, V. and Tyagi, A. K. (2000). Recombinant BCG approach for development of vaccines: cloning and expression of immunodominant antigens of M. tuberculosis. FEMS Microbiol Lett 190, 309-16) was engineered to over-express a-crystallin under transcriptional control of the promoter of M. leprae gene encoding heat shock protein 65 (hsp65). The gene encoding a-crystallin (Rv2031c) was PCR amplified by using M. tb H37Rv genomic DNA as the template and gene specific forward primer 5'gggcatcatatggccaccaccc 3' (SEQ ID NO: 3) and reverse primer 5'gggacgcgtcagttggtggaccggatgtg 3' (SEQ ID NO: 4). The PCR amplicon was subsequently cloned into pSD5.hsp65 at Nde I and Mlu I restriction sites and the resultant construct was designated as pSD5.hsp65.acr (Fig. 1). The recombinant
plasmid was electroporated into wild type M. bovis BCG (Danish) and selected on MB7H11 plates containing Kanamycin (25ug/ml).
Example 10: Experimental animals
Pathogen free 200-3OOg female outbred guinea pigs (Dunkin Hartley strain) used for the protective efficacy studies were procured from Disease Free Small Animal House Facility, Haryana Agricultural University, Hissar, India. The animals were housed in stainless steel cages and were provided with ad libitum food and water in a BSLIII facility (National JALMA Institute of Leprosy and Other Mycobacterial Diseases, Agra, India). All the experimental protocols were reviewed and approved by the animal ethics committee of the institute.
Example 11: Immunization and aerosol challenge of guinea pigs with M, tuberculosis
For evaluation of protective efficacy, two experiments were carried out. Exp-I was a preliminary experiment for the evaluation of the protective efficacy of rBCGacr and DNAacr vaccines, when used alone. In this experiment, guinea pigs (n = 6) were immunized with one of the following: (i) 5X105 CFU of either BCG or rBCGacr in 100 ul of saline by i.d. route, (ii) DNAacr or vector (100 jug in 100 ul of saline) thrice at three weeks interval by i.m. route and (iii) in the control group, guinea pigs were injected with 100 ul of saline by i.d. route. Guinea pigs were challenged 6 weeks post-immunization with 50-100 bacilli of virulent M. tb H37Rv via the respiratory route in an aerosol chamber (Inhalation exposure system, Glasscol Inc., IN, USA) and were euthanized 10 weeks post-infection.
In Exp-II, various heterologous prime boost regimens, combining DNAacr with either BCG or rBCGacr, were evaluated for their protective efficacy. Groups of 6 or 7 guinea pigs were immunized with one of the following regimens: (i) rBCGacr once (5X105 CFU in 100 ul of saline) by intra-dermal route, followed by a booster dose of DNAacr or vector (100 ng) by i.m. route at 6 weeks (R/D & R/V), (ii) or BCG once (5X105
CFU in 100 jj.1 of saline) by intra-dermal route, followed by a booster dose of DNAacr or vector (100 u.g) by i.m. route at 6 weeks (B/D and B/V) and (ii) a single dose of DNAacr or vector, followed by a booster dose of rBCGacr once at 3 weeks (D/R and V/R), (iii) a single dose of BCG or rBCGacr and (iv) saline treated animals served as the control groups. In this experiment guinea pigs were challenged at 12 weeks after the primary immunization and were euthanized at two different time points, at 10 weeks and 16 weeks post-infection.
Example 12: Measurement of protective efficacy
Animals were monitored regularly for change in body weight and general body condition as an indicator of disease progression and were euthanized at specified time points. In addition to the measurement of bacillary load in lung and spleen, gross and histopathological changes in various organs and extent of pulmonary fibrosis were evaluated. A significant reduction in these parameters in vaccinated animals was considered as a protective effect of the vaccine.
Example 13: Necropsy procedure and gross pathological evaluation
Guinea pigs were euthanized by i.p. injection of Thiopentone sodium (100 mg/kg body weight) (Neon Laboratories Ltd., India). After aseptically dissecting the animals, lung, liver and spleen were examined for gross pathological changes and scored using the Mitchison scoring system (Mitchison et al., 1960) with minor modifications (Table III), wherein equal emphasis was given to each organ. For histopathological evaluation, three lung lobes (right caudal, middle and cranial) and a portion of left dorsal lobe of iiver were removed and fixed in 10% neutral buffered formalin. Left caudal lung lobe and cranial portion of spleen were aseptically removed for the measurement of bacillary load.
Table III: Post-mortem gross pathological scoring system
(Table Removed)
Example 14: Bacterial enumeration
Specific portions of lungs and spleen were weighed and homogenized separately in 5 ml saline in a Teflon glass homogenizer. Appropriate dilutions of the homogenates were inoculated on to MB7H11 agar plates in duplicates and incubated at 37°C in a CO2 incubator for three to four weeks. The number of colonies were counted and expressed as logio CFU/g of tissue. The detection limit in case of both lung and spleen CFU was 1.0 log,0 CFU/g.
Example 15: Histopathological evaluation
Sections of 5 urn thickness from formalin fixed and paraffin embedded tissues were cut on to glass slides and stained with haematoxylin and eosin for histo-pathological examination. The percent granuloma in lung and liver, type and extent of necrosis, organization of granuloma along with the type of infiltrating cells were assessed as described earlier (Shakila et al., 1999). In order to determine the extent of collagen deposition and fibrosis, the lung sections were also stained with Van Gieson stain.
Example 16: Statistical analysis
Mean differences for Log10 CFU was analyzed by one-way analysis of variance (ANOVA). Least square difference and Duncan's post hoc tests were also carried out to determine the significance of differences between various groups. The differences between scores allotted for gross pathological lesions and granuloma percent across different groups were analysed by non-parametric methods. The non-parametric Kruskal-Wallis test was employed for comparison of multiple groups, followed by the Mann-Whitney U test for comparison between two groups. The differences were considered statistically significant when the p values were less than 0.05. These statistical tests were run on SPSS software (Version. 10.0, SPSS Inc., Illinois, USA).
SEQ ID NO: 1- a-crystallin (Rv2031c) nucleotide sequence (435 nt)
(Sequence Removed)

I/We Claim:
1. A recombinant BCG over-expresseing a-crystallin protein for use in generating an immunogenic response in a subject against Mycobacterium, wherein said BCG comprises recombinant vector having nucleotide sequence coding for a-crystallin protein.
2. The recombinant BCG as claimed in claim 1, wherein said a-crystallin protein is from Mycobacterium tuberculosis.
3. The recombinant BCG as claimed in claim 1, wherein said a-crystallin protein is from Mycobacterium bovis.
4. The recombinant BCG as claimed in claim 1, wherein said nucleotide sequence coding for a-crystallin protein is as set forth in SEQ ID NO: 1.
5. The recombinant BCG as claimed in claim 1, wherein amino acid sequence of said a-crystallin protein is as set forth in SEQ ID NO: 2.
6. The recombinant BCG as claimed in claim 1, wherein said BCG is selected from a group consisting of Danish strain, Glaxo strain, Pasteur strain, Tice strain and Connaught strain; preferably Danish strain.
7. A vaccine formulation for generating an immunogenic response in a subject against Mycobacterium, said formulation comprising an immunologically effective amount of the recombinant BCG as claimed in claim 1.
8. A process for producing a recombinant BCG over-expressing a-crystallin protein from Mycobacterium as claimed in claim 1, wherein said process comprises:
a. introducing a nucleotide sequence coding for a-crystallin protein from
Mycobacterium into a suitable expression vector to obtain a recombinant
vector;
b. transforming BCG with the recombinant vector to obtain a recombinant BCG
over-expressing a-crystallin protein.
9. A vaccination kit comprising (i) a priming formulation comprising the
recombinant BCG as claimed in claim 1 and (ii) a boosting formulation
comprising nucleotide sequence coding for a-crystallin protein for sequential administration. 10. A vaccination kit comprising (i) a priming formulation comprising BCG over-expressing a-crystallin protein and (ii) a boosting formulation comprising nucleotide sequence coding for a-crystallin protein for sequential administration.

Documents

Application Documents

# Name Date
1 473-DEL-2009-AbandonedLetter.pdf 2018-03-22
1 473-del-2009-form-5.pdf 2011-08-21
2 473-DEL-2009-FER.pdf 2017-08-28
2 473-del-2009-form-3.pdf 2011-08-21
3 473-del-2009-form-2.pdf 2011-08-21
3 473-del-2009-abstract.pdf 2011-08-21
4 473-del-2009-form-1.pdf 2011-08-21
4 473-del-2009-claims.pdf 2011-08-21
5 473-del-2009-correspondence-others.pdf 2011-08-21
5 473-del-2009-drawings.pdf 2011-08-21
6 473-del-2009-description (complete).pdf 2011-08-21
7 473-del-2009-correspondence-others.pdf 2011-08-21
7 473-del-2009-drawings.pdf 2011-08-21
8 473-del-2009-claims.pdf 2011-08-21
8 473-del-2009-form-1.pdf 2011-08-21
9 473-del-2009-abstract.pdf 2011-08-21
9 473-del-2009-form-2.pdf 2011-08-21
10 473-del-2009-form-3.pdf 2011-08-21
10 473-DEL-2009-FER.pdf 2017-08-28
11 473-del-2009-form-5.pdf 2011-08-21
11 473-DEL-2009-AbandonedLetter.pdf 2018-03-22

Search Strategy

1 473del_25-08-2017.pdf