Abstract: An isolated, altered fibronectin-binding protein (Fnb) of S. aureus having at least one mutation in an amino acid selected from residues corresponding to Gin 103, Gin 105, Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of FnbA of S. aureus strain ATCC49525 is described. Replacement of these reactive residues within the fibronectin-binding protein renders this protein less capable than wild-type Fnb of covalently cross-linking with fibronectin and fibrin. The altered fibronectin-binding protein effectively interferes with adhesion of S. aureus to fibronectin and fibrin, and therefore, an immunogenic composition comprising such altered Fnb exhibits improved immunogenic properties and is safer to use.
1. An isolated, altered Staphylococcal aureus (S. aureus) fibronectin-binding protein (Fnb), wherein the alteration is a mutation of least one amino acid selected from the group consisting of residues corresponding to glutamine (Gin) 103, Gin 105, lysine (Lys) 157, Lys503, Lys620, Lys762, Gln783 and Gln830 of FnbA of S. aureus strain ATCC49525, wherein the altered Fnb is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor Xllla or tissue transglutaminase, and the human proteins are selected from the group consisting of fibronectin and fibrin.
2. The isolated, altered Fnb as claimed in claim 1, which is derived from FnbA or FnbB.
3. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at Glnl03.
4. The isolated, altered Fnb as claimed in claim 3, wherein the mutation is from glutamine to alanine.
5. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at GlnlOS.
6. The isolated, altered Fnb as claimed in claim 5, wherein the mutation is from glutamine to alanine.
7. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at Lysl57.
8. The isolated, altered Fnb as claimed in claim 7, wherein the mutation is from lysine to alanine.
9. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at Lys503.
10. The isolated, altered Fnb as claimed in claim 9, wherein the mutation is from lysine to alanine.
11. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at Lys620.
12. The isolated, altered Fnb as claimed in claim 11, wherein the mutation is from lysine to alanine.
13. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at Lys762.
14. The isolated, altered Fnb of claim 13, wherein the mutation is from lysine to alanine.
15. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at Gln783.
16. The isolated, altered Fnb as claimed in claim 15, wherein the mutation is from glutamine to alanine.
17. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at Gln830.
18. The isolated, altered Fnb as claimed in claim 17, wherein the mutation is from glutamine to alanine.
19. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at each of residues Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830.
20. The isolated, altered Fnb as claimed in claim 19, wherein the mutation at each of residues Gin 103, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 is to Ala.
21. The isolated, altered Fnb as claimed in claim 19, wherein the mutation at any one of residues G!nlG3, Gin 105, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gm830 is to Ala.
22. An immunogenic composition comprising a physiologically acceptable vehicle and an isolated, altered S. aureus fibronectin-binding protein (Fnb), wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, and where the altered Fnb retains immunogemcity and, when incorporated into the immunogenic composition and administered to a vertebrate, the altered Fnb is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XJH, Factor Xllla or tissue transglutarninase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus.
23. The immunogenic composition as claimed in claim 22, further comprising an adjuvant.
24. A method of immunizing a vertebrate against S. aureus, comprising administering to the vertebrate a composition comprising a physiologically acceptable vehicle and an immunologically effective amount of an isolated, altered Fnb of S. aureus. wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to Ginl03, GlniOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, and where the altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XIHa or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the isolated, altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus.
25. The method as claimed in claim 24, wherein the vertebrate is a seronegative human.
26. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues glutamine (Gin) 134, Gin 136, lysine (Lys) 188, Lys534, Lys651, Lys793, Gln814 and Gln861 of the FnbA of £ aureus strain Mu50.
27. The isolated, altered Fnb of claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues glutamine (Gin) 134, Gin 136, lysine (Lys) 188, Lys534, Lys651, Lys793, Gln814 and Gln861 of the FnbA of S, aureus strain N315.
28. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues glutamine (Gin) 139, Glnl41, lysine (Lys) 539, Lys656, Lys798, Gln819 and Gln866 of the FnbA of S. aureus strain MW2.
29. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues glutamine (Gin) 147, Gin 149, lysine (Lys) 547, Lys664, Lys806, Gln827 and Gln874 of the FnbA of £ aureus strain MSSA-476.
30. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues glutamine (Gin) 139, Gin 141, lysine (Lys) 655, Lys797 and Gln865 of the FnbA of S. aureus strain COL.
31. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues glutamine (Gin) 139, Gin 141, lysine (Lys) 655, Lys797 and Gln865 of the FnbA of S. aureus strain 8325-4.
32. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues glutamine (Gin) 147, Gin 149, lysine (Lys) 549, Lys666, Gln791 and Gln838 of the FnbA of S. aureus strain EMRSA-16.
33. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues glutamine (Gin) 111, lysine (Lys) 602, Gln765 and Gln812 of the FnbB of S. aureus strain Mu50.
34. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues glutamine (Gin) 111, lysine (Lys) 602, Gln765 and Gln812 of the FnbB of S. aureus strain N315.
35. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues lysine (Lys) 598, Lys740 and glutamine (Gin) 808 of the FnbB of S. aureus strain MW2.
36. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues lysine (Lys) 598, Lys740, and glutamine (Gin) 808 of the FnbB of S. aureus strain MSSA-476.
37. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues lysine (Lys) 591, Lys 733 and glutamine (Gin) 801 of the FnbB of S. aureus strain COL.
38. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues lysine (Lys) 591, Lys733 and glutamine (Gin) 801 of the FnbB of S. aureus strain 8325-4.
39. An isolated nucleic acid molecule encoding an altered Fnb of S. aureus, wherein the alteration is a mutation of least one amino acid selected from the group consisting of residues corresponding to glutamine (Gin) 103, GlnlOS, lysine (Lys) 157, Lys503, Lys620, Lys762, Gln783 and Gln830 of FnbA of S. aureus strain ATCC49525, wherein the altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, and the human proteins are selected from the group consisting of fibronectin and fibrin.
40. An expression vector comprising the isolated nucleic acid molecule as claimed in claim 39 operably linked to a regulatory sequence.
41. A recombinant host cell comprising the expression vector as claimed in claim 4.
42. A method of producing an altered Fnb, wherein the alteration is a mutation as claimed in least one amino acid selected from the group consisting of residues corresponding to glutamine (Gin) 103, GlnlOS, lysine (Lys) 157, Lys503, Lys620, Lys762, Gln783 and Gln830 of FnbA of S. aureus strain ATCC49525, wherein the altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, where the human proteins are selected from the group consisting of fibronectin and fibrin, the method comprising maintaining the recombinant host cell of claim 41 under conditions suitable for expression of the altered Fnb.
43. An immunogenic composition comprising a physiologically acceptable vehicle and an isolated nucleic acid molecule encoding an altered Fnb of S. aureus, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to GlnlOS, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, where the altered Fnb retains immunogenicity and, when incorporated into the immunogenic composition and administered to a vertebrate, the altered Fnb is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus.
44. The immunogenic composition as claimed in claim 43, further comprising a transfection-facilitating agent.
45. A method of inducing an immune response in a vertebrate, comprising administering to the vertebrate the immunogenic composition of claim 43 in an amount effective to induce an immune response.
46. A method of immunizing a vertebrate against S. aureus, comprising administering to the vertebrate a composition comprising a physiologically acceptable vehicle and an immunologically effective amount of a nucleic acid molecule encoding an altered Fnb of S. aureus, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to Gin 103, Gin105, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, and where the altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor Xllla or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus.
47. The method as claimed in claim 46, wherein the vertebrate is a seronegative human.
48. An isolated, altered Staphylococcal aureus (S. aureus) fibronectin-binding protein (Fnb), wherein the alteration is a mutation of least one amino acid selected from the group consisting of residues corresponding to glutamine (Gin) 103, GlnlOS, lysine (Lys) 157, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of FnbA of S. aureus strain ATCC49525, wherein the altered Fnb is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XIHa or tissue transglutaminase, and the human proteins are selected from the group consisting of fibronectin and fibrin.
49. The isolated, altered Fnb as claimed in claim 48, wherein the mutation is at Lys702.
50. The isolated, altered Fnb as claimed in claim 49, wherein the mutation is from lysine to alanine.
51. The isolated, altered Fnb as claimed in claim 48, wherein the mutation is at each of residues GlnlOS, Glnl05, Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830.
52. The isolated, altered Fnb as claimed in claim 51, wherein the mutation at each of residues Gin 103, Gin 105, Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 is to Ala.
53. The isolated, altered Fnb as claimed in claim 48, wherein the mutation at any one of residues Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 is to Ala.
54. An immunogenic composition comprising a physiologically acceptable vehicle and an isolated, altered S. aureus fibronectin-binding protein (Fnb), wherein the alteration is a mutation of at least one ami no acid selected from the group consisting of residues corresponding to Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, and where the altered Fnb retains immunogenicity and, when incorporated into the immunogenic composition and administered to a vertebrate, the altered Fnb is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XUIa or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus.
55. The immunogenic composition as claimed in claim 54, further comprising an adjuvant.
56. A method of immunizing a vertebrate against S. aureus, comprising administering to the vertebrate a composition comprising a physiologically acceptable vehicle and an immunologically effective amount of an isolated, altered Fnb of S. aureus, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to Gin 103, GlnlOS, Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, and where the altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the isolated, altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with £ aureus.
57. The method as claimed in claim 56, wherein the vertebrate is a seronegative human.
58. An isolated nucleic acid molecule encoding an altered Fnb of S. aureus, wherein the alteration is a mutation of least one amino acid selected from the group consisting of residues corresponding to glutamine (Gin) 103, GlnlOS, lysine (Lys) 157, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of FnbA of S. aureus strain ATCC49525, wherein the altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, and the human proteins are selected from the group consisting of fibronectin and fibrin.
59. An expression vector comprising the isolated nucleic acid molecule of claim 58 operably linked to a regulatory sequence.
60. A recombinant host cell comprising the expression vector of claim 59.
61. A method of producing an altered Fnb, wherein the alteration is a mutation of least one amino acid selected from the group consisting of residues corresponding to glutamine (Gin) 103, GlnlOS, lysine (Lys) 157, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of FnbA of S. aureus strain ATCC49525, wherein the altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor Xllla or tissue transglutaminase, where the human proteins are selected from the group consisting of fibronectin and fibrin, the method comprising maintaining the recombinant host cell of claim 60 under conditions suitable for expression of the altered Fnb.
62. An immunogenic composition comprising a physiologically acceptable vehicle and an isolated nucleic acid molecule encoding an altered Fnb of S. aureus, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to GlnlOS, GlnlOS, Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, where the altered Fnb retains immunogenicity and, when incorporated into the immunogenic composition and administered to a vertebrate, the altered Fnb is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor Xllla or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus.
63. The immunogenic composition as claimed in claim 62, further comprising a transfection-facilitating agent.
64. A method of inducing an immune response in a vertebrate, comprising administering to the vertebrate the immunogenic composition of claim 62 in an amount effective to induce an immune response.
65. A method of immunizing a vertebrate against S. aureus, comprising administering to the vertebrate a composition comprising a physiologically acceptable vehicle and an immunologically effective amount of a nucleic acid molecule encoding an altered Fnb of S. aureus, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of the FnbA of S, aureus strain ATCC49525, and where the altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with £ aureus.
66. The method as claimed in claim 65, wherein the vertebrate is a seronegative human. Dated this 17th day of May 2005
This invention relates to Altered fibronectin-binding protein of staphylococcus
aureus
FIELD OF THE INVENTION
The present invention relates to an altered fibronectin-binding protein of Staphylococcal aureus having reduced reactivity to coagulation Factor XIEIa. Immunogenic compositions comprising this altered fibronectin-binding protein have improved antigenic properties and are safer to use.
BACKGROUND OF THE INVENTION
Staphylococcal aureus (S. aureus) fibronectin-binding protein (Fnb) is a surface-associated multifunctional receptor responsible for specific reversible binding to human proteins such as fibronectin, fibrin and fibrinogen. Such binding allows the microorganism to effectively attach and subsequently invade and colonize the human host during surgeries, vascular injuries, etc. Fnb has been evaluated as a potential candidate for inclusion in immunogenic compositions to prevent S. aureus infections. Immunization with recombinant Fnb and the generation of functionally active antibodies against this protein potentially can prevent the initial attachment of S. aureus to human tissues, and therefore, prevent infection. Recent studies, however, indicate that antibodies generated in mice, rabbits and humans do not inhibit binding of wild-type Fnb to human fibronectin and fibrinogen. Rather, they induce binding of Fnb to these human proteins, and thus, enhance bacterial adherence to the host tissue. This indicates that reversible binding to human proteins serves only as an initial phase in the process of Staphylococcal adhesion to the host tissue.
In a recent study, it was demonstrated that Staphylococcal fibronectin-binding protein A (FnbA) serves as a substrate for the human enzyme called plasma transglutaminase (Matsuka et al. 2003). This is a novel function, previously unknown for FnbA. Plasma transglutaminase (also known as Factor XHIa) is an enzyme that catalyzes covalent (irreversible) cross-linking of a very limited number of human proteins (Table 1) resulting in the formation of high molecular mass homo- and heteropolymers. Factor XIII is a member of the transglutaminase family
the FnbA of S. aureus strain ATCC49525, wherein the altered Fnb is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIH, Factor Xllla or tissue transglutaminase, and the human proteins are selected from the group consisting of fibronectin and fibrin. In one embodiment, these amino acids are mutated to alanine. In a further embodiment, the isolated, altered Fnb is derived from FnbA or FnbB.
The invention also relates to an altered Fnb as just described, wherein the alteration is a mutation of the amino acid Lys702.
The invention also relates to an altered Fnb as just described, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of the residues of the protein and S. aureus strain as follows:
(Table Remove)
of enzymes that catalyze the formation of isopeptide bond(s) either within or between polypeptide chains. Factor XIII circulates in the blood and is therefore considered to be an extracellular enzyme, whereas tissue transglutaminases (TG) (e.g., liver TG, keratinocyte TG, epidermal TG, prostate TG and erythrocyte TG) are located inside the cells, and therefore, act as intracellular enzymes (Aeschlimann et al. 1994). Distinct transglutaminases recognize the same protein as substrate, but often with a different affinity and/or specificity. Overall, the substrate specificity for Factor XHIa is more stringent than for tissue transglutaminases (Gorman et al. 1981; Gorman et al. 1984; Fesus et al. 1986).
Cross-linking reactions catalyzed by Factor Xllla are important steps in various normal physiological reactions including blood coagulation, wound healing, and fibrinolysis. Factor Xllla-catalyzed protein cross-linking takes place via formation of covalent bonds between specific glutamine (Gin) and lysine (Lys) amino acid residues. It has been demonstrated that FnbA can be readily cross-linked to human fibronectin and fibrin by Factor Xllla (Matsuka et al. 2003). Thus, upon immunization with FnbA, FnbA undergoes immediate covalent (irreversible) cross-linking to fibronectin and fibrin. This formation of an irreversible complex of an antigen with human proteins very likely compromises the immune response and leads to the production of antibodies that lack inhibitory / neutralizing activity.
Thus, there is a need to identify the specific reactive amino acid residues (Gin and Lys) within wild-type staphylococcal fibronectin-binding protein that are directly involved in Factor XIHa-catalyzed covalent cross-linking with human proteins, and substitute those residues to produce an altered form of Fnb that has reduced reactivity to coagulation Factor Xllla and will effectively inhibit cross-linking and irreversible binding to fibronectin and fibrin.
SUMMARY OF THE INVENTION
Accordingly, this invention pertains to an isolated, altered fibronectin-binding protein (Fnb) of S. aureus, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to glutamine (Gln)103, GlnlOS, lysine (Lys)157, Lys503, Lys620, Lys762, Gln783 and Gln830 of
This invention also pertains to an isolated nucleic acid molecule encoding an altered fibronectin-binding protein of S. aureus, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA from S. aureus strain ATCC49525, wherein the altered fibronectin-binding protein retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor Xllla or tissue transglutaminase, and the human proteins are selected from the group consisting of fibronectin and fibrin.
The invention also relates to an isolated nucleic acid molecule as just described, wherein the alteration is a mutation of the amino acid Lys702.
The invention also pertains to a nucleic acid construct comprising an isolated nucleic acid molecule described herein operably linked to a regulatory sequence.
The invention also relates to a recombinant host cell comprising a nucleic acid construct described herein, as well as to a method of producing an altered fibronectin-binding protein of S. aureus described herein, the method comprising maintaining a recombinant host cell of the invention under conditions suitable for expression of the altered fibronectin-binding protein.
The invention also pertains to the use of the altered fibronectin-binding protein, or recombinant host cell for expression thereof, to prepare immunogenic compositions that elicit an immune response against S. aureus.
The invention further relates to an immunogenic composition comprising a physiologically acceptable vehicle and an altered fibronectin-binding protein of S. aureus which retains immunogenicity and, when incorporated into the immunogenic composition and administered to the vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor Xllla or tissue transglutaminase, such as fibronectin and fibrin. The
altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus. The alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA from S. aureus strain ATCC49525. The immunogenic composition can also comprise an adjuvant.
The invention also relates to an immunogenic composition comprising a physiologically acceptable vehicle and a nucleic acid molecule encoding an altered Fnb of S. aureus, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to Gin 103, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, where the altered Fnb retains immunogenicity and, when incorporated into the immunogenic composition and administered to a vertebrate, the altered Fnb is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus.
The invention also relates to immunogenic compositions as just described, wherein the alteration is a mutation of the amino acid Lys702.
The invention also relates to a method of immunizing a vertebrate against S. aureus, comprising administering to the vertebrate a composition comprising a physiologically acceptable vehicle and an immunologically effective amount of an altered fibronectin-binding protein of S. aureus, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, where the altered fibronectin-binding protein retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a
substrate for Factor XIII, Factor XHIa or tissue transglutaminase, such as fibronectin and fibrin, and does not enhance binding of wild-type fibronectin-binding protein to said human proteins upon subsequent infection of the vertebrate with S. aureus.
The invention further relates to a method of immunizing a vertebrate against S. aureus, comprising administering to the vertebrate a composition comprising a physiologically acceptable vehicle and an immunologically effective amount of a nucleic acid molecule encoding an altered S. aureus fibronectin-binding protein, optionally with a transfection-facilitating agent, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, where the altered fibronectin-binding protein retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor Xllla or tissue transglutaminase, such as fibronectin and fibrin, and does not enhance binding of wild-type fibronectin-binding protein to said human proteins upon subsequent infection of the vertebrate with S. aureus.
In one embodiment, the vertebrate is a seronegative human.
The invention also relates to methods of immunizing as just described, wherein the alteration is a mutation of the amino acid Lys702.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 depicts Factor XHIa-catalyzed incorporation of dansylcadaverine (panels A and C) and dansyl-PGGQQIV (panels B and D) probes into rFnbA. Modification reactions were carried out for 4 and 18 hours. After the removal of unreacted probes modified for 4 hours (lane 1) and 18 hours (lane 3) rFnbA samples were analyzed by SDS-PAGE, Alternatively, the rFnbA samples modified over 4 and 18 hours were subjected to limited proteolysis by thrombin and then analyzed by SDS-PAGE (lanes 2 and 4). After electrophoresis the gels were photographed under ultraviolet light (panels C and D) and then stained with Coomassie Brilliant Blue (panels A and
B). Arrows show positions of probe-modified rFnbA and its thrombin-generated fragments. Lane 5 in each panel contains molecular mass standards as indicated.
FIG. 2 depicts HPLC separation of dansylcadaverine-labeled peptides from the trypsin digest of Factor XHIa-modified rFnbA. Factor XHIa-catalyzed incorporation of dansylcadaverine into rFnbA was carried out for 4 (panels A and B) and 18 hours (panels C and D). The dansylcadaverine-labeled rFnbA preparations were digested by trypsin and the peptides were separated on an Aquapore RP-300 Cg reverse phase column. The elution was monitored by absorbance at 210 nm as well as by fluorescence at 550 nm. Fluorescent peaks 1 (panels B and D), 2, and 3 (panel D) were collected, and after a second round of reverse phase chromatography subjected to NH2-terminal sequence and mass-spectral analysis.
FIG. 3 depicts HPLC separation of dansylcadaverine-labeled peptides from the Glu-C protease digest of Factor XHIa-modified rFnbA. Factor XHIa-catalyzed incorporation of dansylcadaverine into rFnbA was carried out for 4 (panels A and B) and 18 hours (panels C and D). The dansylcadaverine-labeled rFnbA preparations were digested by Glu-C protease and the peptides were separated on an Aquapore RP-300 Cg reverse phase column. The elution was monitored by absorbance at 210 nm as well as by fluorescence at 550 nm. Fluorescent peaks 1 (panels B and D), 2, 3, 4, 5, 6 and 7 (panel D) were collected, and after a second round of reverse phase chromatography subjected to NHa-terminal sequence and mass-spectral analysis.
FIG. 4 depicts HPLC separation of dansyl-PGGQQIV-labeled peptides from the Glu-C protease digest of Factor Xllla-modified rFnbA. Factor XHIa-catalyzed incorporation of dansyl-PGGQQIV into rFnbA was carried out for 4 (panels A and B) and 18 hours (panels C and D). The dansyl-PGGQQIV-labeled rFnbA preparations were digested by Glu-C protease and the peptides were separated on an Aquapore RP-300 Cg reverse phase column. The elution was monitored by absorbance at 210 nm as well as by fluorescence at 550 nm. The fluorescent peak depicted by an asterisk (panel B) and peaks 1, 2, 3, 4, 5, 6 and 7 (panel D) were collected, and after the second round of reverse phase chromatography, subjected to NH2-terminal sequence and mass-spectral analysis.
FIG. 5 depicts the location of Factor XJIIa-reactive Gin and Lys residues within the amino acid sequence of wild-type FnbA. It is a schematic illustration of the structural organization of the rFnbA (residues Alal-Pro839) of S. aureus strain ATCC49525 used in this study (top) and its amino acid sequence (bottom) (SEQ ID NO:1). Fig. 5 shows the location of the major regions: A- fibrinogen-binding region; Bl and B2 -homologous repeats of unknown function; Du, Dl, D2, D3, and D4-fibronectin-binding repeats. Arrows show the positions of Factor XII la-reactive Gin (103, 105, 783, and 830) and Lys (157, 503, 620, and 762) residues within the A, Du, D2, and D4 regions of FnbA. Bold letters denote the same Factor XHIa-reactive Gin and Lys residues in the primary sequence of FnbA. Underlined letters depict the location of the predicted thrombin cleavage site Arg202-Gly203.
FIG. 6 depicts the alignment of the amino acid sequences of FnbA and FnbB species of various S. aureus strains (SEQ ID NOS:1-14). Regions surrounding Factor XHIa-reactive Gin and Lys residues are shown. Positions of the identified reactive Gin and Lys residues at the top correspond to that of FnbA of S. aureus strain ATCC49525. The bold letters in the primary sequences of FnbA and FnbB species highlight conserved Factor Xllla-reactive Gin acceptor and Lys donor sites. Multiple sequence alignment was performed using the CLUSTAL W (1.81) program.
FIG. 7 depicts a schematic representation of the wild type and mutated FnbA species used in this study (top) and SDS-PAGE analysis of the isolated proteins (bottom). This figure shows the location of the major regions in FnbA from S. aureus strain ATCC49525: A- fibrin(ogen) binding region; Bl and B2- homologous repeats of unknown function; and Du, Dl, D2, D3, D4- fibronectin-binding repeats. The positions of reactive Gin residues and introduced Gln-»Ala mutations are indicated by closed triangles while the positions of reactive Lys residues and introduced Lys->Ala mutations are shown by open diamonds. The schematic representation of the FnbA species and SDS-PAGE (4-20% gel) analysis of purified proteins are shown in the following order: 1- wild type FnbA; 2- 1Q FnbA mutant; 3- 4Q4K FnbA mutant. The outer lanes in the gel contain molecular mass standards as
indicated.
FIG. 8 depicts the Factor XHIa-catalyzed incorporation of dansylcadaverine (A) and dansyl-PGGQQIV probe (B) into the wild type and mutated forms of FnbA. Incorporation of dansylcadaverine was performed in 20 mM Tris, pH 7.4, 150 mM NaCl, 5 mM DTT, 5 mM CaCl2, while incorporation of dansyl-PGGQQIV was carried out in 20 mM Tris, pH 8.5, 15 mM NaCl, 5 mM DTT, 5 mM CaCI2. Control reactions were also performed in the same buffers containing 2 mM EDTA. Aliquots were removed at the indicated time points, mixed with SDS, heated, and analyzed by SDS-PAGE on 4-20 gradient gels. Aliquots removed from control reactions at 60 (A) and 120 min (B) are labeled with asterisks. After electrophoresis, the gels were photographed under ultraviolet light (A and B, bottom) and then stained with Coomassie Brilliant Blue (A and B, top). The outer lanes in the gels contain molecular mass standards as indicated.
FIG. 9 depicts the Factor XHIa-catalyzed cross-linking of the wild-type and mutated forms of FnbA to fibrin. At indicated time points, reactions were terminated and analyzed by SDS-PAGE on a 3-8% gradient gel under reducing conditions. After electrophoresis the gels were either stained with Coomassie Brilliant Blue (A), or subjected to transfer to nitrocellulose membranes followed by immunostaining with anti-FnbA (B) and anti-fibrinogen a chain (C) antibodies. Arrows show the positions of FnbA and a, P, Y chains of fibrin, and cross-linked YY chains of fibrin. The major high mobility product of cross-linking between FnbA and fibrin a chain is designated as a, while low mobility products of cross-linking are depicted as b, c, and d. The left-hand lane in each panel contains molecular mass standards having, from top to bottom, the following Mr values: 250, 150, 100, 75, 50, and 37 kDa.
FIG. 10 depicts the rate of XHIa-catalyzed cross-linking of the wild-type and mutated forms of FnbA to the fibrin a chain. The amount of remaining monomeric (uncross-linked) wild type FnbA (filled circles), 1Q FnbA (empty circles), and 4Q4K FnbA (filled triangles) was assayed as described in Materials and Methods and plotted as a function of time.
FIG. 11 depicts Factor Xllla-catalyzed cross-linking of the wild-type and mutated forms of FnbA to fibronectin. At indicated time points, reactions were terminated and analyzed by SDS-PAGE on a 4-20% gradient gel under reducing conditions. After electrophoresis the gels were either stained with Coomassie Brilliant Blue (A), or subjected to transfer to nitrocellulose membranes followed by immunostaining with anti-FnbA (B) and anti-fibronectin (C) antibodies. Arrows show the positions of FnbA and fibronectin. The products of cross-linking between FnbA and fibronectin are depicted as a, b, c, and d. The left-hand lane in each panel contains molecular mass standards having, from top to bottom, the following Mr values: 250, 150, 100, 75, and 50 kDa.
FIG. 12 depicts the rate of Xllla-catalyzed cross-linking of the wild-type and mutated forms of FnbA to fibronectin. The amount of remaining monomeric (uncross-linked) wild-type FnbA (filled circles), 1Q FnbA (empty circles), and 4Q4K FnbA (filled triangles) was assayed as described in Materials and Methods and plotted as a function of time.
FIG. 13 shows the MALDI-TOF mass spectrum of isolated dansyl-PGGQIV-labeled peptide (fluorescent peak 3 (Anderson et al. 2004)) from the Glu-C protease digest of Factor Xllla-modified wild-type FnbA.
FIG. 14 shows an alignment of the amino acid sequences of the FnbA and FnbB species from various S, aureus strains. The region surrounding Factor XHIa-reactive Lys702 is shown. The position of the identified reactive Lys residue at the top corresponds to that of the FnbA from S. aureus strain ATCC49525. The multiple sequence alignment was performed using the CLUSTAL W (1.81) program (Thompson et al. 1994).
DETAILED DESCRIPTION OF THE INVENTION
FnbA is covalently cross-linked to either fibronectin or fibrin by the transglutaminase action of Factor XHIa, resulting in the formation of receptor-ligand homo- and heteropolymers(s). Coagulation Factor XIHa or plasma transglutaminase
(EC 2.3.2.13) belongs to the transamidase class of enzymes that catalyze the covalent cross-linking of specific protein substrates through the formation of intermolecular £-(Y-glutamyl)lysine isopeptide bonds. Cross-linking occurs via an acyl transfer reaction in which the y carboxyamide group of glutamine serves as the acyl-donor (amine-acceptor) and the e-amino group of lysine serves as the acyl-acceptor (amine-donor) (Henschen and McDonagh 1986; Lorand 2001).
Factor XIII circulates in the blood as a non-active tetramer precursor, A2B2, that is composed of two catalytic A subunits and two regulatory B subunits. Following exposure to thrombin, Factor XIII zymogen undergoes a Ca2+-dependent activation to Factor Xllla (Factor XIII activated), which subsequently catalyzes the formation of covalent cross-links between y chains and between a chains of a fibrin clot. This reaction represents the final event in the blood coagulation cascade and is essential for normal hemostasis. Factor Xllla is also involved in the covalent incorporation of several different human proteins into fibrin clots by the same mechanism. See Table 1. Among them are fibronectin and ocj-antiplasmin whose cross-linking to the clot plays an important role in wound healing and fibrinolysis.
The protein-protein cross-linking reactions catalyzed by Factor Xllla represent a two-stage process. First, proteins specifically associate with each other to form a reversible (non-covalent) complex, and second, they become covalently cross-linked by Factor Xllla. In general, protein cross-linking catalyzed by Factor Xllla produces a variety of fused homo- and heteropolymeric structures that play an important role in a number of physiological reactions (Lorand and Graham 2003). The recent finding, that S. aureus can utilize transglutaminase activity for adhesion to human extracellular matrix (ECM) molecules (Matsuka et al. 2003), indicates that protein cross-linking is involved in pathological reactions associated with bacterial infection.
Most S. aureus strains express one (FnbA) or two (FnbA and FnbB) fibronectin-binding proteins encoded by two different, but closely related, genes (Signas, Raucci et al. 1989; Jonsson, Signas et al. 1991). The NH2-terminal region of the mature fibronectin-binding protein is formed by about a 500-residues long A region
responsible for fibrinogen/fibrin binding activity of the receptor. The A region of FnbA contains the B1-B2 double copy of a 30-residues long repeat of unknown function which is missing in the FnbB version of the protein. The COOH-terminal region of fibronectin-binding protein contains five conserved, about 40-residues long, Du, Dl, D2, D3 and D4 repeats that form the fibronectin-binding region of the receptor. The COOH-terminus of fibronectin-binding protein is covalently attached to the cell wall peptidoglycan by the transpeptidase activity of sortase (Schneewind, Fowler et al. 1995). The reversible binding of FnbA to fibronectin or fibrin is a prerequisite for efficient intermolecular covalent cross-linking. The association of FnbA with fibronectin or fibrin results in appropriately positioned donor lysine and acceptor glutamine residues that subsequently become cross-linked by Factor XHIa. Factor XIIla also catalyzes the formation of an isopeptide bond between the y-carboxamide group of peptide-bound reactive glutamine residues and the amino groups of a variety of primary amines, including those of putrecine, spermidine, and cadaverine (Lorand, Rule et al. 1968; Lorand, Siefring et al. 1979). Incorporation of an alternative amine donor inhibits protein cross-linking and leads to an enzyme-directed, site-specific labeling of the participating glutamine residues in the acceptor protein (Lorand 2001). Similarly, by utilizing peptides patterned after the N-terminal sequence of fibronectin or oi2-antiplasmin, containing reactive glutamine residues, specific labeling of the participating lysine residues in the donor protein can be achieved (Parameswaran, Velasco et al. 1990; Lorand, Parameswaran et al. 1992; Sobel and Gawinowicz 1996). It has been recently determined that in the presence of Factor XHIa, staphylococcal rFnbA could be modified by the amine donor synthetic probe dansylcadaverine and dansylated peptide patterned after the N-terminal sequence of fibronectin, which acts as an amine acceptor probe (Matsuka et al. 2003).
In the present invention there have been identified within the staphylococcal FnbA, reactive Gin and Lys residues that are targeted by human coagulation Factor XIIla or tissue transglutaminase. This is the first report on the localization of Factor XHIa-reactive amine acceptor and donor sites in a bacterial protein. Site-specific labeling of the Factor XHIa-reactive glutamines was performed using the fluorescent lysine analog dansylcadaverine (Lorand, Rule et al. 1968; Lorand, Siefring et al. 1979).
Factor XHIa reacted with only 4 of the 48 Gin residues present in the rFnbA receptor. Residues Gin 103, Gin 105, Gln783, and Gln830 serve as amine acceptor sites in FnbA, when the latter is incubated with dansylcadaverine and coagulation Factor XHIa. The rate and degree of dansylcadaverine modification of Gin 103 was significantly higher than that of Gin 105, Gln783, and Gln830 (FIG. 2, B, D and Fig. 3 B, D), suggesting that Gin 103 acts as a major amine acceptor site. The reactive residues Glnl03 and GlnlOS are located within the NHj-terminal A region of FnbA receptor (FIG. 5), while the Gln783 and Gln830 residues are situated in the COOH-terminal part of the molecule and belong to the Dl and D4 repeats, respectively. Identification of the Glnl03 as a major amine acceptor site of the FnbA is consistent with the results of limited proteolysis experiments. The cleavage of dansylcadaverine-modified rFnbA by thrombin results in the release of a low molecular mass NH2-terminal fragment, which exhibited a high intensity of fluorescence upon UV illumination, due to the presence of the major Gin 103 acceptor site. The high molecular mass band corresponding to the COOH-terminal fragment and containing the minor Gln783 and Gln830 sites (FIG. 5) produced a low emission signal (FIG. 1 A and C). Thus, limited proteolysis and SDS-PAGE data obtained for the dansylcadaverine-modified rFnbA provided another line of evidence suggesting various degrees of reactivity of identified acceptor sites. Upon SDS-PAGE analysis the thrombin-generated rFnbA fragments and the parent rFnbA exhibited lower than expected electrophoretic mobility. Most likely this is caused by a high content of charged residues in FnbA, which are known to decrease the capability of SDS-binding and, therefore, decrease electrophoretic mobility. When the rFnbA sample was subjected to mass-spectral analysis, its experimentally determined molecular mass value was essentially indistinguishable from the calculated value.
The dansyl-PGGQQIV peptide probe patterned on the NH2-terminal sequence of fibronectin containing reactive glutamine residues, was utilized for the labeling of Factor Xllla-reactive lysine residues (Parameswaran, Velasco et al. 1990; Lorand, Parameswaran et al. 1992). The labeling procedure revealed that 4 of the 56 potential lysine donor residues within rFnbA incorporated the peptide probe. These residues are Lysl57, Lys503, Lys620, and Lys762. The identified Factor XHIa-
reactive lysine sites are distributed between the fibrin(ogen)-binding region A and the fibronectin-binding D repeats. Lys 157 is located within the NH2-terminal part of the A region, while Lys503 is located in its COOH-terminal segment adjacent to the B1B2 repeats. The fibronectin-binding Du and D2 repeats contain the Factor Xllla-reactive Lys620 and Lys762 sites, respectively (FIG. 5). Interestingly, despite the NHb-terminal location of the reactive Lysl57, thrombin cleavage of the dansyl-PGGQQIV-decorated rFnbA did not produce a fluorescent low molecular mass fragment (FIG. 1 D, lanes 2 and 4). The low molecular mass fragment was not detectable upon staining of the gel with Coomassie Brilliant Blue (FIG. 1 B, lanes 2 and 4). These observations indicate that the modification of Lys 157 with the dansyl-PGGQQIV probe might induce higher susceptibility of the NHa-terminal region of FnbA to thrombin attack resulting in the generation of small peptides that are not detectable on SDS-PAGE.
Overall, all of the identified reactive Gin acceptor and Lys donor residues tend to cluster in the NHz- and COOH-terminal areas of FnbA that form the fibrin(ogen)-and fibronectin-binding sites. The existence of additional Gin acceptor and Lys donor residues within the staphylococcal FnbA receptor, however, cannot be excluded since the fluorescent tracer containing peptides corresponding to peak 2 (FIG. 2 D), peaks 2, 3, 5 (FIG. 3 D) and peak 3 (FIG. 4D) was not positively identified. Nevertheless, site-specific labeling allowed the localization of the exact positions of reactive Gin and Lys residues participating in Factor XHIa-catalyzed cross-linking reactions of FnbA with fibronectin, fibrin, and, possibly, other human host proteins. Upon sequencing, several peaks produced more than one residue in each cycle, indicating the heterogeneity of HPLC fractions. Heterogeneity of these samples was also evident from the results of mass-spectral analysis. Comparison of the residues in each cycle against the known sequence of FnbA and the available map with the predicted trypsin- or Glu-C proteinase-generated cleavage sites allowed most individual sequences to be identified. The results of the NHa-terminal sequence analysis in this study always correlated with the mass-spectral data, which showed the presence of signals corresponding to the predicted probe-modified peptides.
Up to now, only a little more than a dozen protein substrates have been
identified for coagulation Factor XIHa. Among the known glutamine-containing substrates for Factor XIHa, there exists little sequence homology and reactivity is difficult if not impossible to predict. The identified reactive glutamines are usually located in the solvent-exposed surface regions or flexible extensions (Cottrell, Strong et al. 1979; McDonagh, McDonagh et al. 1981; Matsuka, Medved et al. 1996). Without being bound by theory, both the primary structure and the conformation of a protein appear to determine whether a glutamine residue can be reactive. These observations are consistent with the data shown herein for the staphylococcat FnbA receptor.
The reactive Gln783 and Gln830 acceptor sites are situated in the D2 and D4 fibronectin-binding repeats, which, according to several reports, do not have a compact structure and exist in a rather unfolded state (House-Pompeo, Xu et al. 1996; Penkett, Redfield et al. 1997; Penkett, Redfield et al. 1998). The reactive Gin 103 and Gin 105 sites are located in the NH2-termina! region of FnbA that appears to be sensitive to proteolysis and, therefore, again may indicate lack of an ordered structure. The selectivity of Factor XIHa towards the amine donor lysine residues in proteins is not sufficiently understood either. Despite the common notion that Factor XIHa is less selective toward lysine residues than to glutamine residues, only a restricted number of amine donor sites can participate in a particular protein-protein cross-linking reaction and undergo modifications with a peptide probe. It was shown that Factor XIHa exhibits broad yet clearly differentiated tolerance with respect to the residue preceding the amine donor lysine in protein substrates. Analysis of protein substrates for Factor XIHa or tissue transglutaminase revealed that the residues directly preceding the amine donor site include uncharged and basic polar residues, as well as the small aliphatic ones (Grootjans, Groenen et al. 1995). The data disclosed herein for the staphylococcal FnbA receptor further supports these observations. Among the four identified Factor XHIa-reactive lysines, Val precedes Lysl57, Ala precedes Lys503, and Thr precedes Lys620. The only exception is Glu, which precedes Lys762 (FIG. 5).
In order to investigate whether the identified Factor XHIa-reactive sites are conserved in other fibronectin-binding proteins from different S. aureus strains, their
amino acid sequences were analyzed using a multiple sequence alignment. The amino acid sequence of FnbA of S. aureus strain ATCC49525 (SEQ ID NO:1) was compared with the FnbA and FnbB sequences of strains 8325-4 (SEQ ID NO:7 and SEQ ID NO:14) (Signas, Rauci et al. 1989; Jonsson, Signas et al. 1991), MW2 (SEQ ID NO:4 and SEQ ID NO:11) (Baba, Takeuchi et al. 2002), EMRSA-16 (SEQ ID NO:8), MSSA-476 (SEQ ID NO:5 and SEQ ID NO: 12), COL (SEQ ID NO:6 and SEQ ID NO: 13), Mu50 (SEQ ID NO:2 and SEQ ID NO:9), and N315 (SEQ ID NO:3 and SEQ ID NO: 10) (Kuroda, Ohta, et al. 2001). The amino acid sequences of FnbA and FnbB of strains EMRSA-16 and MSSA-476 were obtained from the Wellcome Trust Sanger Institute. The S. aureus COL sequence was obtained from the Institute for Genomic Research. Multiple sequence alignment was performed using the CLUSTAL W (1.81) program (Thompson, Higgins, et al. 1994).
FIG. 6 shows the amino acid sequence alignment of the regions surrounding the identified reactive Gin and Lys residues in the FnbA of S. aureus strain ATCC49525. A multiple alignment revealed that the reactive Glnl03, GlnlOS, Gln830, and Lys620 residues are conserved in all analyzed FnbA sequences. In the FnbA of strains MW2, MSSA-476, COL, 8325-4, and EMRSA-16 the reactive Lysl57 is replaced with a Thr residue. In strains COL and 8325-4, the reactive Lys503 is substituted to an Asn residue. The segment of polypeptide chain containing reactive Lys762 is missing in the FnbA sequence of EMRSA-16 strain and the reactive Gln783 is substituted to His in COL and 8325-4 strains (FIG. 6). This observation indicates that the reactivity of FnbA of different S. aureus strains towards the transglutaminase action of Factor XIHa can vary.
Also, it is apparent that the Factor XIHa-reactive acceptor and donor sites are less preserved within the FnbB family of receptors. None of the analyzed FnbB sequences possess the reactive Gin 103, Lys 157, and Lys503, while Lys762 is missing in Mu50 and N315 strains. The reactive Gin 105 and Gln783 are not preserved in the FnbB sequence of strains MW2, MSSA-476, COL, and 8325-4. Among all of the identified Factor XIHa-reactive sites, only the Lys620 and Gln830 residues are highly conserved and present in all analyzed FnbA and FnbB sequences (FIG. 6).
Interestingly, upon treatment of FnbA with Factor XHla, the conserved reactive Lys620 residue consistently exhibited the highest reactivity towards the dansyl-PGGQQ1V probe (FIG. 4 B peak* and D peak 5, Table 3). This further indicates the physiological importance of the Lys donor site at position 620. The fact that the major Gin 103 acceptor site along with the LyslS? and Lys503 donor sites are absent in ali evaluated FnbB sequences suggests that the B form of fibronectin-binding protein plays a less prominent role in Factor Xllla-catalyzed cross-linking reactions. These differences also indicate that the A and B forms of fibronectin-binding protein exhibit different selectivity toward their human host protein cross-linking partners.
With the exception of the staphylococcal FnbA receptor, all currently known Factor XHla protein substrates are involved in blood coagulation, fibrinolysis, extracellular matrix assembly, and wound healing reactions. The inventors' finding that S, aureus FnbA serves as a bifunctional substrate for Factor XHla and undergoes cross-linking to fibronectin or fibrin (Matsuka et al. 2003) suggests that coagulation Factor XHla also plays an important role in molecular pathogenesis. The ability of pathogenic 5. aureus to utilize the transglutaminase activity of Factor XHIa for covalent attachment to human host molecules explains the extremely high efficiency of bacterial colonization upon tissue injury. Following injury, the formation of a blood clot serves both to restore vascular integrity and to provide a provisional matrix for the initiation of wound repair (Mosesson 1992). The clot's major protein components, fibrin and plasma fibronectin are essential for these functions. Both fibrin and fibronectin also serve as ligands for the surface-associated FnbA receptor of S. aureus, and therefore, responsible for the binding of the bacteria to the wound site. As the clot matures, coagulation Factor XHla initiates catalysis of intermolecular cross-Unking between fibrin molecules and between fibrin and fibronectin. Covalent cross-linking between fibrin molecules increases the structural stability of the clot (Henschen and McDonagh 1986), while the cross-linking of fibronectin to fibrin is important for cell adhesion and migration events required for the wound healing process (Grinnel, Feld et al. 1980; Knox, Crooks et al. 1986; Corbett, Lee et al. 1997). The staphylococcal FnbA receptor that is reversibly associated with fibrin or fibronectin at this stage can be covalently cross-linked to its ligands by Factor XHla. The covalent incorporation of FnbA to fibrin or fibronectin
increases the probability of staphylococcal colonization and establishment of infection. It also competes with fibrin-fibrin and fibrin-fibronectin cross-linking reactions (Matsuka, Medved et at. 1994; Matsuka, Migliorini et al. 1997) (Matsuka et al. 2003), and therefore, can affect the structural integrity of the clot and inhibit the wound-healing reaction. Such implications of Factor XHIa-catalyzed cross-linking of staphylococcal FnbA to human extracellular matrix proteins most likely served as a driving force for the molecular evolution of the FnbA receptor, resulting eventually in its acquiring a new and useful property. The evolved reactivity of FnbA towards Factor XHIa has provided a significant advantage in the colonization of the host and subsequently has had a positive impact on the survival of S. aureus.
In addition to identifying the reactive amino acid residues (Gin and Lys) within wild-type staphylococcal FnbA that are directly involved in the Factor Xllla-catalyzed covalent cross-linking reaction described herein, the present invention relates to the synthesis of Fnb-derived proteins that are less capable than wild-type Fnb of covalently cross-linking with fibronectin and fibrin upon subsequent S. aureus infection. Specifically, the work described herein is directed to compositions and methods of preparation of proteins and/or polypeptides comprising altered fibronectin-binding proteins or polypeptides that can be used as immunogens in immunogenic composition formulations, including multivalent immunogenic compositions, and which can be used for active immunization. The strategy involves alteration of one or more amino acids in a Fnb sequence, resulting in a protein or polypeptide derived from Fnb that is immunogenic without inducing enhanced binding of wild-type Fnb to fibronectin and fibrin upon subsequent S. aureus infection. Mutations of two, three or more of the amino acid residues identified herein are within the scope of the invention.
The wild type (native) nucleotide and amino acid sequences of Fnb are known in the art (U.S. Patent Nos. 5,320,951; 5,571,514; 5,175,096; 5,652,217). As used herein, "alteration" and its derivatives is intended to mean an amino acid sequence which is different from the wild-type sequence, as well as a nucleotide sequence which encodes an amino acid sequence which is different from the wild- type amino acid sequence. Alteration includes insertion, deletion and/or substitution of one or more
nucleotides or amino acids.
For example, the alteration can be the insertion or deletion of a single nucleotide, or of more than one nucleotide, resulting in a frame shift mutation; the change of at least one nucleotide, resulting in a change in one or more encoded amino acids; the change of at least one nucleotide, resulting in the generation of a premature stop codon; the deletion of several nucleotides, resulting in a deletion of one or more amino acids encoded by the nucleotides; the insertion of one or several nucleotides, resulting in an interruption of the coding sequence of the gene; duplication of all or a part of the gene; transposition of all or a part of the gene; or rearrangement of all or a part of the gene. More than one such mutation may be present in a single gene. Such sequence changes cause an alteration in the Fnb encoded by the gene. For example, if the alteration is a frame shift mutation, the frame shift can result in a change in the encoded amino acids, and/or can result in the generation of a premature stop codon, causing generation of a truncated protein.
For example, the alteration(s) can preferably preserve the three-dimensional configuration of the native Fnb. Moreover, amino acids that are essential for the function of Fnb, particularly for immunogenicity, can be identified by methods known in the art. Particularly useful methods include identification of conserved amino acids, site-directed mutagenesis and alanine-scanning mutagenesis (for example, Cunningham and Wells 1989), crystallization and nuclear magnetic resonance. The altered polypeptides produced by these methods can be tested for particular biologic activities, including immunogenicity and antigenicity.
Specifically, appropriate amino acid alterations can be made on the basis of several criteria, including hydrophobicity, basic or acidic character, charge, polarity, size, the presence or absence of a functional group (e.g., --SH or a glycosylation site), and aromatic character. Assignment of various amino acids to similar groups based on the properties above will be readily apparent to the skilled artisan; further appropriate amino acid changes can also be found in Bowie et al. (Science 247:1306-1310(1990)). For example, the alteration can take the form of conservative (e.g., glycine for
alanine; valine for isoleucine; histidine for lysine; asparagine for glutamine) site-directed mutation of the glutamine and lysine residues (FIG. 6) which retains attributes of the region of the FnbA involved in protective immune responses but deletes or modifies epitopes involved in the stimulation of S. aureus infections (i.e., a biological equivalent). The alteration can also take the form of non-conservative mutations (e.g., lysine for threonine; alanine for lysine; alanine for glutamine) wherein the deleterious stimulation of S. aureus infections is reduced or abolished. The alteration can also take the form of complete deletion of any of the glutamine or lysine residues identified herein, with continued use of the remaining Fnb derived moiety. Deletions can be replaced by linker regions that retain the spatiality of the remaining Fnb or polypeptide in order for optimal translation and/or immunogenicity. Alterations can be made using any standard mutagen or mutagenic process, such as site-directed mutation involving phages or use of polymerase chain reaction (PCR) technology involving synthetic oligonucleotides.
Accordingly, the invention pertains to an isolated nucleotide sequence encoding an altered Fnb of S. aureus, or portion thereof, wherein the altered Fnb or portion thereof retains immunogenicity. As used herein, the term "altered Fnb" is intended to mean a Fnb (or portion thereof) of S. aureus which retains immunogenicity and which, when incorporated into an immunogenic composition and administered to a vertebrate, does not enhance binding to fibronectin or fibrin upon subsequent infection with S. aureus. In a particular embodiment, the altered Fnb comprises a mutation of at least one amino acid selected from the group consisting of residues corresponding to Gin 103, Gin 105, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525. In one embodiment, these amino acids are mutated to alanine.
Although the invention is specifically described with relation to the amino acids corresponding to Gin 103, Gin 105, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, it is intended that the methodologies described herein used to identify these residues can be applied to additional residues of the wild-type Fnb to identify additional residues for alteration. As appropriate, nucleic acid molecules of the present invention can be RNA, for
example, mRNA, or DNA, such as cDNA and genomic DNA. DNA molecules can be double-stranded or single-stranded; single stranded RNA or DNA can be the coding, or sense, strand or the non-coding, or antisense, strand. In one embodiment, the nucleic acid molecule comprises at least about 14 nucleotides; in another embodiment, at least about 50 nucleotides; and in even yet another embodiment, at least about 200 nucleotides. The nucleotide sequence can be only that which encodes at least a fragment of the amino acid sequence of the altered Fnb; alternatively, the nucleotide sequence can include at least a fragment of the altered Fnb amino acid coding sequence along with additional non-coding sequences such as introns and non-coding 3' and 5' sequences (including regulatory sequences, for example). Additionally, the nucleotide sequence can be fused to a marker sequence, for example, a sequence that encodes a polypeptide to assist in isolation or purification of the polypeptide.
The term "nucleotide sequence" can include a nucleotide sequence that is synthesized chemically or by recombinant means. Thus, recombinant DNA contained in a vector is included in the invention. Also, nucleotide sequences include recombinant DNA molecules in heterologous host cells, as well as partially or substantially purified DNA molecules in solution. In vivo and in vitro RNA transcripts of the DNA molecules of the present invention are also encompassed by nucleotide sequences of the invention. Such nucleotide sequences are useful, e.g., in the manufacture of the encoded altered Fnb.
The invention also encompasses variations of the nucleotide sequences of the invention, such as those encoding portions, analogues or derivatives of the altered Fnb, provided the portion, analogue or derivative comprises the altered Fnb. Such variations can be naturally occurring variations in the unaltered portion of the nucleotide sequence, such as in the case of allelic variation, or non-naturally-occurring, such as those induced by various mutagens and mutagenic processes. Intended variations include, but are not limited to, addition, deletion and substitution of one or more nucleotides that can result in conservative or non-conservative amino acid changes, including additions and deletions. The invention described herein also relates to fragments of the nucleic acid
molecules described above. The term "fragment" is intended to encompass a portion of a nucleotide sequence described herein which is from at least about 14 contiguous nucleotides to at least about 50 contiguous nucleotides or longer in length, providing that such fragments encode an altered Fnb polypeptide; such fragments are useful as primers. Certain primers and probes selectively hybridize to the nucleic acid molecule encoding the altered Fnb described herein. For example, fragments that encode antigenic portions of the altered Fnb described herein are useful.
The invention also pertains to nucleotide sequences that hybridize under medium and high stringency hybridization conditions (e.g., for selective hybridization) to a nucleotide sequence described herein. Appropriate stringency conditions are known to those skilled in the art or can be found in standard texts such as Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
Accordingly, the invention pertains to nucleotide sequences which have a substantial identity with the altered nucleotide sequences described herein, such as, for example, at least 90% identity or at least 95% identify with these sequences. Particular nucleotide sequences encode polypeptides having substantially similar immunogenic activity as the altered Fnb described herein.
This invention also pertains to an altered Fnb or polypeptide thereof of S. aureus. The altered Fnb or polypeptide is a Fnb (or portion thereof) of S. aureus which retains immunogenicity and which, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of cross-linking with fibronectin and fibrin upon subsequent infection with S. aureus. In a particular embodiment, the altered Fnb comprises a mutation of at least one amino acid selected from the group consisting of residues corresponding to Gin 103, Gin 105, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525. The altered Fnb of the invention is substantially purified (e.g., purified to homogeneity), and is substantially free of other proteins.
The invention also provides expression vectors, e.g., nucleic acid constructs such as plasmids and cosmids, containing a nucleic acid sequence encoding an altered Fnb
or polypeptide, operably linked to at least one regulatory sequence. Many such vectors are commercially available, and the skilled artisan can readily prepare other suitable vectors. "Operably linked" means that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleic acid sequence; this term is intended to include both direct physical linkage and linkage by means of a linker or intervening sequence. Regulatory sequences are art-recognized and are selected to produce a polypeptide that is an altered Fnb or polypeptide. Accordingly, the term "regulatory sequence" includes promoters, enhancers, and other expression control elements which are described in Goeddel, Gene Expression Technology; Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). For example, the native regulatory sequences or regulatory sequences native to the transformed host cell can be employed. It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed.
For instance, the altered Fnb's and polypeptides of the present invention can be produced by ligating the nucleic acid molecule, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells or both (see, for example, Broach, et al. 1983, Sambrook et al. 1989).
Prokaryotic and eukaryotic host cells transfected by the described vectors are also provided by this invention. For instance, cells which can be transformed, transfected or infected with the expression vectors of the present invention include, but are not limited to, bacterial cells such as E. coli (e.g., E. coli K12 strains), Streptomyces, Pseudomonas, Serratia marcescens and Salmonella typhimurium, insect cells (baculovirus), including Drosophila, Sf9 and Sf21 cells, fungal cells, such as yeast cells, plant cells and mammalian cells, such as thymocytes, Chinese hamster ovary (CHO) cells, HEp-2 cells, Vero cells and COS cells.
Thus, a nucleotide sequence encoding the altered Fnb described herein can be used to produce a recombinant form of the protein via microbial or eukaryotic cellular processes. Ligating the polynucleotide sequence into a gene construct, such as an expression vector, and transforming or transfecting into hosts, either eukaryotic
(yeast, avian, insect, plant or mammalian) or prokaryotic (bacterial cells), are standard procedures used in producing other well known proteins. Viral vectors may also be used, including, but not limited to, adenoviruses, adeno-associated viruses, herpes simplex virus, retroviruses, lentiviruses, poxviruses, including vaccinia virus, alphaviruses, such as sindbis virus, semliki forest virus, and Venezuelan equine encephalitis virus, and non-segmented, negative-stranded RNA viruses, such as measles virus, mumps virus, and vesicular stomatitis virus. Accordingly, the invention pertains to the production of altered Fnb by recombinant technology.
In addition to the foregoing host cell systems in which the altered Fnb of this invention is produced in vitro, a variety of systems are appropriate for expression and delivery of such altered Fnb in vivo. These systems utilize attenuated pathogens such as bacteria or viruses as delivery agents. These live attenuated pathogens have inserted within them as a heterologous nucleic acid segment the nucleic acid sequence encoding the desired altered Fnb of this invention. Using these systems, the desired altered Fnb is expressed by a live, attenuated bacterium or virus within the body of a vertebrate.
The proteins of the present invention can be isolated or purified (e.g., to homogeneity) from recombinant cell culture by a variety of processes. These include, but are not limited to, anion or cation exchange chromatography, ethanol precipitation, affinity chromatography and high performance liquid chromatography (HPLC). The particular method used will depend upon the properties of the polypeptide and the selection of the host cell; appropriate methods will be readily apparent to those skilled in the art.
The present invention also pertains to immunogenic compositions comprising the altered Fnb described herein. For instance, an altered Fnb of the present invention can be formulated with a physiologically acceptable vehicle to prepare an immunogenic composition. The particular physiological vehicle may include, but is not limited to, water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol) and dextrose solutions. The optimum concentration of the active ingredient(s) in the chosen vehicle can be determined empirically, according
to well-known procedures, and will depend on the ultimate pharmaceutical formulation desired.
The altered Fnb can be used as an antigen to elicit an immune response to the antigen in a vertebrate, such as a mammalian host.
The method of the present invention comprises administering to the vertebrate an immunologically effective dose of an immunogenic composition comprising a mixture of an altered Fnb and any suitable adjuvant. As used herein, an "adjuvant" is intended to mean any agent that is sufficient to enhance or modify the immune response to the antigen. As used herein, an "immunologically effective" dose of the immunogenic composition is a dose that is suitable to elicit an immune response. The particular dosage will depend upon the age, weight and medical condition of the vertebrate to be treated, as well as on the method of administration. The skilled artisan will readily determine suitable doses. The immunogenic composition can be optionally administered in a pharmaceutically or physiologically acceptable vehicle, such as physiological saline or ethanol polyols such as glycerol or propylene glycol.
Suitable adjuvants to enhance effectiveness of the composition include, but are not limited to:
(1) aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate,
aluminum sulfate, etc.;
(2) oil-in-water emulsion formulations (with or without other specific
immunostimulating agents such as muramyl peptides (see below) or bacterial cell
wall components), such as, for example,
(a) MF59 (PCT Publ. No. WO 90/14837), containing 5% Squalene, 0.5% Tween 80,
and 0.5% Span 85 (optionally containing various amounts of MTP-PE (see below,
although not required)) formulated into submicron particles using a microfluidizer
such as Model 110Y microfluidizer (Microfluidics, Newton, MA),
(b) SAP, containing 10% Squalene, 0.4% Tween 80, 5% pluronic-blocked polymer
L121, and thr-MDP (see below) either microfluidized into a submicron emulsion or
vortexed to generate a larger particle size emulsion, and
(c) Ribi™ adjuvant system (RAS), (Corixa, Hamilton, MT) containing 2%
Squalene, 0,2% Tween 80, and one or more bacterial cell wall components from the group consisting of 3-O-deaylated monophosphorylipid A (MPL™) described in U.S. Patent No. 4,912,094 (Corixa), trehalose dimycolate (TDM), and cell wall skeleton (CWS), or MPL + CWS (Detox™);
(3) saponin adjuvants, such as Quil A or STIMULON™ QS-21 (Antigenics,
Framingham, MA) (U.S. Patent No. 5,057,540) may be used or particles generated
therefrom such as ISCOMs (immunostimulating complexes);
(4) bacterial lipopolysaccharides, synthetic lipid A analogs such as aminoalkyl
glucosamine phosphate compounds (AGP), or derivatives or analogs thereof, which
are available from Corixa, and which are described in U.S. Patent No. 6,113,918;
one such AGP is 2-[(R)-3-Tetradecanoyloxytetradecanoylamino]ethyl 2-Deoxy-4-O-
phosphono-3-O-[(R)-3-tetradecanoyloxytetradecanoyl]-2-[(R)-3-
tetradecanoyloxytetradecanoylamino]-b-D-glucopyranoside, which is also know as
529 (formerly known as RC529), which is formulated as an aqueous form or as a
stable emulsion, synthetic polynucleotides such as oligonucleotides containing CpG
motif(s) (U.S. Patent No. 6,207,646);
(5) cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7,1L-12, IL-
15, IL-18, etc.), interferons (e.g., gamma interferon), granulocyte magrophage
colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-
CSF), tumor nucrosis factor (TNF), etc.;
(6) detoxified mutants of a bacterial ADP-ribosylating toxin such as a cholera toxin
(CT) either in a wild-type or mutant form, for example, where the glutamic acid at
amino acid position 29 is replaced by another amino acid, preferably a histidine, in
accordance with published international patent application number WO 00/18434
(see also WO 02/098368 and WO 02/098369), a pertussis toxin (PT), or an E. coli
heat-labile toxin (LT), particularly LT-K63, LT-R72, CT-S109, PT-K9/G129 (see,
e.g., WO 93/13302 and WO 92/19265); and
(7) other substances that act as immunostimulating agents to enhance the
effectiveness of the composition.
As mentioned above, muramyl peptides include, but are not limited to, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl-L-alanine-2-(l'-25 dipalmitoyl-A'«-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE), etc.
The compositions of this invention can be administered to a human or non-human vertebrate by a variety of routes, including parenteral, intrarterial, intradermal, transdermal (such as by the use of slow release polymers), intramuscular, intraperitoncal, intravenous, subcutaneous, oral and intranasal routes of administration. The amount of Fnb employed in such compositions will vary depending upon the route of administration and physical characteristics of the subject vertebrate. Adjustment and manipulation of established dosage ranges used with traditional carrier antigens for adaptation to the present composition is well within the ability of those skilled in the art. The compositions of the present invention are intended for use in the treatment of both immature and adult vertebrates, and, in particular, humans.
The altered Fnb can be administered in conjunction with additional immunogens; the altered Fnb can be administered separately, sequentially or concurrently with the additional immunogen.
The altered Fnb of the present invention can be coupled to a carrier molecule in order to modulate or enhance the immune response. Suitable carrier proteins include bacterial toxins that are safe for administration to vertebrates and immunologically effective as carriers. Examples include pertussis, diphtheria, and tetanus toxoids and non-toxic mutant proteins (cross-reacting materials (CRM)), such as the non-toxic variant of diphtheria toxoid, CRMw. Fragments of the native toxins or toxoids, which contain at least one T-cell epitope, are also useful as carriers for antigens. Methods for preparing conjugates of antigens and carrier molecules are well-known in the art (Wong 1991; Bernatowicz and Matsueda 1986; Frisch et al. 1996; Boeckler et al. 1996).
In addition, if a particular peptide region is deleted, one or more epitopes from an antigen from another organism can be inserted into the deleted region, in order to create a bivalent vaccine.
The invention also relates to an immunogenic composition comprising a physiologically acceptable vehicle and a nucleic acid molecule encoding an altered
Fnb of S. aureus, wherein the altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, does not enhance binding of wild-type Fnb upon subsequent infection of the vertebrate with S. aureus. Such an immunogenic composition is referred to herein as a nucleic acid immunogenic composition or DNA immunogenic composition and is useful for the genetic immunization of vertebrates.
The term, "genetic immunization", as used herein, refers to inoculation of a vertebrate, particularly a mammal, with a nucleic acid immunogenic composition directed against a pathogenic agent, particularly S. aureus, resulting in the generation of an immune response by the vertebrate against S. aureus. A "nucleic acid immunogenic composition" or "DNA immunogenic composition" as used herein, is a nucleic acid construct comprising a nucleic acid molecule encoding a polypeptide antigen, particularly an altered Fnb of S. aureus described herein. The nucleic acid construct can also include transcriptional promoter elements, enhancer elements, splicing signals, termination and polyadenylation signals, and other nucleic acid sequences. The nucleic acid immunogenic composition does not enhance binding of the wild-type Fnb to fibronection or fibrin upon subsequent infection of the vertebrate with S. aureus.
The nucleic acid immunogenic composition is produced by standard methods. For example, using known methods, a nucleic acid (e.g., DNA) encoding an altered Fnb of S. aureus, is inserted into an expression vector to construct a nucleic acid immunogenic composition (Maniatis et al. 1989).
The individual vertebrate is immunized with the nucleic acid immunogenic composition using standard methods. The vertebrate is immunized (i.e., the composition is administered) subcutaneously, intravenously, intraperitoneally, intradermally, intramuscularly, topically, orally, rectally, nasally, buccally, vaginally, by inhalation spray, or via an implanted reservoir in dosage formulations containing conventional non-toxic, physiologically acceptable carriers or vehicles. Alternatively, the vertebrate is inoculated with the nucleic acid immunogenic composition through the use of a particle acceleration instrument (a "gene gun").
The form in which it is administered (e.g., capsule, tablet, solution, emulsion) will depend in part on the route by which it is administered. For example, for mucosal administration, nose drops, inhalants or suppositories can be used.
The nucleic acid immunogenic composition can be administered in conjunction with any suitable adjuvant as described above. The adjuvant is administered in a sufficient amount, which is that amount that is sufficient to generate an enhanced immune response to the composition. The adjuvant can be administered prior to, concurrently with, contemporaneously (simultaneously) with, or after inoculation with the nucleic acid immunogenic composition. The adjuvant can also be administered at more than one time. The adjuvant and the nucleic acid immunogenic composition can be administered at approximately the same location on the vertebrate; for example, they are both administered at a marked site on a limb of the vertebrate.
In a particular embodiment, the nucleic acid construct is co-administered with a transfection-facilitating agent. In one embodiment, the transfection-facilitating agent is dioctylglycylspermine (DOGS) (published PCT application publication no. WO96/21356). In another embodiment, the transfection-facilitating agent is a local anesthetic such as bupivacaine (U.S. Patent No. 5,593,972).
The invention also provides a method of immunizing a vertebrate, e.g., a S. aureus seronegative human, against S. aureus, comprising administering to the vertebrate a composition comprising an immunologically effective amount of altered Fnb of S. aureus described above. Alternatively, the composition comprises a nucleic acid molecule encoding an immunologically effective amount of altered Fnb which retains immunogenicity and which, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable of cross-linking with fibronectin and fibrin, and does not enhance binding of wild-type Fnb with fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus. Prior to administration in humans, the immunogenic compositions of this invention are evaluated in an animal model. The exemplary, non-limiting animal models will now be described.
In a mouse pyelonephritis model, four week-old female CD-I mice are inolculated by subcutaneous injection at 0, 3 and 6 weeks with altered Fnb in an appropriate adjuvant. The mice are bled prior to the first inoculation and on week 8. Two days following the final bleed, the mice are challenged by intraperitoneal injection of 3 x 108 cfu S. aureus Reynolds grown overnight on Columbia salt agar (Ix Columbia agar, 0,1% glucose, 1% yeast extract, 0.5% NaCl). Forty-eight hours following challenge, the mice are sacrificed and the bacteria enumerated in the kidneys.
In a rat endocarditis model, three week-old male Sprague-Dawley rats are inoculated by intramuscular injection at 0, 2 and 4 weeks with altered Fnb in an appropriate adjuvant. The rats are bled prior to the first inoculation. On week 6 the rats are bled and undergo surgery to place a polyethylene catheter through the carotid artery and the aortic arch into the left ventricle of the heart. The catheter is held in place with a silk suture and causes the formation of a sterile vegetation. Upon bacterial challenge the vegetation acts as a substrate for bacterial attachment and infection. Two days following surgery the rats are challenged by intravenous injection of 1 x 10s cfu S. aureus Reynolds grown to mid log phase in tryptic soy broth. Forty-eight hours following challenge, the rats are sacrificed and the bacteria enumerated in the heart.
EXAMPLES
The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific Examples. These Examples are described solely for the purpose of illustration and are not intended to limit the scope of the invention.
Abbreviations
HPLC high performance liquid chromatography;
MALDI-TOF MS matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry;
SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis;
DTT dithiothreitol;
TCA trichloroacetic acid;
Dansyl 5-dimethylaminonaphthalene-l-sulfonyl;
PTH phenylthiohydantoin.
ECM extracellular matrix proteins
TBS TRIS-buffered saline
PBS sodium phosphate-buffered saline
FXIII Factor XIII or plasma transglutaminase
EDTA sodium salt of ethylenediaminetetraacetic acid
10 rFnbA recombinant Gin 1 OSAla FnbA mutant
4Q4KrFnbA recombinant GlnlOSAla, GlnlOSAla, Gln783Ala, Gln830Ala,
Lysl57Ala, Lys503Ala, Lys620Ala, and Lys762Ala mutant
wt FnbA wild type FnbA
Materials And Methods
Staphylococcal Fibronectin-Binding Protein. The recombinant fibronectin-binding protein A (rFnbA) comprising residues Alal through Pro839 from S. aureus strain ATCC49525 was produced in E. coli and isolated from the soluble fraction of the cell lysate as described previously (Matsuka et al. 2003). Briefly, the fob A gene encoding FnbA amino acid residues 1-839 was produced by PCR amplification using chromosomal DNA from S. aureus strain ATCC49525 as template. The identity of the isolated rFnbA was confirmed using SDS-PAGE, Western blot, and NH2-terminal sequence analysis. Protein concentrations in all experiments were determined using bicinchoninic acid (BCA) assay according to instructions (Pierce Chemical Company, Rockford, IL).
Factor XlHa Catalyzed Incorporation of Dansylcadaverine and Dansyl-PGGQQIV Probes into rFnbA. To incorporate dansylcadaverine (Sigma, St. Louis, MO) or dansyl-PGGQQIV (custom synthesized by New England Peptide, Inc., Fitchburg, MA) into rFnbA, preactivated Factor XIII was used. For this purpose 500 ^ig/ml of Factor XIII (Haematologic Technologies, Inc., Essex Junction, VT) was activated by treatment with 0.25 U/ml of thrombin (Sigma) in TBS, pH 7.4 buffer containing 10 mM dithiothreitol and 20 mM CaClj. After incubation for 20 min at 37°C, thrombin
was inactivated by the addition of hirudin (Sigma) and this mixture was used as Factor XUIa (Takagi, Aoyama et al. 1995). Factor XHIa-catalyzed labeling of the reactive glutamine residues within rFnbA was carried out by incubating 1-2 mg of rFnbA for 4 or 18 hours at 37°C with 2.5 mM dansylcadaverine and Factor XHIa (30 fig/ml) in 20 mM Tris, pH 7.4, 150 mM NaCl, 5 mM DTT, 5 mM CaCl2 buffer. The labeling of Factor XHIa-reactive lysine residues was performed by incubating 1-2 mg of rFnbA for 4 or 18 hours at 37°C with 2 mM dansyl-PGGQQIV and Factor XUIa (30 ng/ml) in 20 mM Tris, pH 8.5, 15 mM NaCl, 5 mM DTT, 5 mM CaCl2 buffer. The total volume of reaction mixture in both cases was 0.3 ml. At the end of the incubation period, the proteins were precipitated with 7% TCA, harvested by centrifugation (5 min at 14,000 x g), and the pellets were extracted repeatedly (8 times) either with 1 ml of ethanohether (1:1 vol/vol) to remove unreacted dansylcadaverine or with 1 ml of N,N-dimethylformamide containing 1% N-methylmorpholine and 5% HaO to remove unreacted dansyl-PGGQQIV probe (Clement, Velasco et al. 1998).
Fragmentation of Dansylcadaverine' and Dansyl-PGGQQIV-Labeled rFnbA by Thrombin. Proteolytic fragmentation of dansylcadaverine- or dansyl-PGGQQIV-modifled rFnbA was performed using thrombin (Sigma). After the removal of unreacted dansylcadaverine and dansyl-PGGQQIV probes, the modified rFnbA pellets were dissolved in 0.5 ml of TBS, pH 7.4 buffer containing 5 mM CaCh- Limited proteolysis was carried out by incubating the modified rFnbA with thrombin for 1 hour at 25°C at an enzyme / substrate ratio of 1:200 (w/w). The reaction was terminated by heating at 95°C in the presence of 2% SDS, and analyzed by SDS-PAGE.
SDS-PAGE Analysis. Dansylcadaverine- or dansyl-PGGQQIV-modified rFnbA preparations and their thrombin-generated fragments were analyzed by SDS-PAGE using precast 4-20% (BioRad Laboratories, Hercules, CA) gradient gels. All SDS-polyacrylamide gels in this study were examined under ultraviolet light and then stained with Coomassie Brilliant Blue R (BioRad Laboratories).
Digestion of Dansylcadaverine- and Dansyl-PGGQQIV-Labeled rFnbA. Enzymatic hydrolysis of the dansylcadaverine-modified rFnbA was achieved by treatment with
GIu-C (V-8) protease (Worthington Biochemical Corp., Freehold, NJ) and L-(tosylamido 2-phenyl) ethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemical Corp.). Hydrolysis of the dansyl-PGGQQIV-modified rFnbA was performed using Glu-C protease only. Followed by TCA precipitation and extraction, the modified rFnbA pellets were dissolved in 0.3 ml of either TBS, pH 7.4 for cleavage with trypsin or PBS, pH 7.8 for cleavage with Glu-C protease. Enzymatic cleavage was carried out by incubating the modified rFnbA with trypsin or Glu-C protease for 16 h at 37°C at an enzyme / substrate ratio of 1:20 (w/w). An additional amount of trypsin or Glu-C protease was added to the reaction mixture resulting in a final enzyme / substrate ratio of 1:10 (w/w) and the digestion was continued for another 8 hours at 37°C. The digestion mixture was diluted 1:1 (vol/vol) with 0.2% trifluoroacetic acid, centrifuged at 14,000 x g for 5 minutes, and the supernatant was subjected to reverse-phase HPLC.
Reverse Phase HPLC Separation of Dansylcadaverine- and Dansyl-PGGQQIV-Labeled Peptides. Dansylcadaverine- and dansyl-PGGQQIV-labeled peptides were separated on Aquapore RP-300 Cg column (Brownlee Labs, Santa Clara, CA) by gradient elution with acetonitrile in 0.1% trifluoroacetic acid. Separation was carried out using a Dynamax HPLC station equipped with a ProStar fluorescence detector (Varian, Walnut Creek, CA). Peptides were eluted with a 0-50% linear gradient of acetonitrile over a 90-min interval at a flow rate of 0.5 ml/min. Elution of peptides was detected by monitoring of absorbance at 210 nm and fluorescence at 550 nm with excitation at 350 nm. The fluorescent tracer peaks were collected and after concentration to smaller volumes (50 - 200 jo.1) were reinjected to the same column. The second round of elution was performed using a 10-20% or 20-35% linear gradient of acetonitrile over a 60-min interval at a flow rate of 0.5 ml/min. The isolated dansylcadaverine- or dansyl-PGGQQIV-labeled peptides were subjected to mass spectral and NHa-terminal sequence analysis.
Sequence Analysis. The NH2-terminal sequence analysis was performed with an Applied Biosystems model 490 sequenator. Selected samples were also submitted for service analysis to M-Scan Inc. These samples were analyzed using Applied Biosystems model 477 A sequenator. The NH2-termini of the isolated peptides were
determined by sequencing for up to 18 cycles.
Theoretical Estimation of the Molecular Masses of Peptides. Calculation of the molecular masses of trypsin- and Glu-C proteinase-generated peptides was performed from the known primary sequence of staphylococcal rFnbA using Peptide Companion VI.25 software. The effect of dansylcadaverine (335.50 Da) or dansyl-PGGQQIV (932.00 Da) modification on the mass of the peptide was calculated by the addition of molecular mass of the probe. Since the formation of each e-(y-glutamyl)lysine isopeptide bond is accompanied by the release of one ammonia (17.04 Da), the final molecular mass values were adjusted accordingly.
Mass Spectral Analysis. The determination of molecular masses of the isolated peptides was performed using MALDI-TOF mass spectrometer Voyager DE-STR (Perseptive Biosystems, Foster City, CA). Ions formed by laser desorption at 337 nm (Na laser) were recorded at an acceleration voltage of 20 kV in the reflector mode. In general, 200 single spectra were accumulated for improving the signal / noise ratio and analyzed by the use of the Data Explorer software supplied with the spectrometer. The a-cyano-4-hydroxycinnamic acid (Aldrich Chemical Co., Milwaukee, WI) was used as an ultraviolet-absorbing matrix. One jo.1 of a 10 mg/ml solution of the matrix compounds in 70% acetonitrile / 0.1% trifluoroacetic acid was mixed with 1 \i\ peptide solution (5-10 pmole/uTj. For MALDI-TOF MS, 1 ul of this mixture was spotted on a stainless steel sample target and dried at room temperature. The mass spectra were calibrated using external standards: bovine serum albumin, human Glul-fibrinopeptide B, human angiotensin I, and synthetic des-Argl-bradykinin. The mass accuracy was in the range of 0.1%. Example I
Factor XHIa-directed Incorporation of Dansylcadaverine and Dansyl-PGGQQIV into rFnbA and Fragmentation of Probe-decorated Protein by Thrombin
It has been reported that ftbronectin-binding protein A from S. aureus strain ATCC49525 serves as a bifunctional substrate for coagulation Factor XHIa that contains both reactive Gin and Lys residues (Matsuka et al. 2003). To assess the location of reactive Gin and Lys residues within FnbA, amine donor
(dansylcadaverine) or amine acceptor (dansyl-PGGQQIV) fluorescent probes were incorporated into rFnbA by the catalytic action of Factor XHIa. Reactions were carried out for 4 or 18 hours, followed by the removal of unreacted probes and the fragmentation of fluorescent-tracer-Iabeled rFnbA by thrombin. The existence of a single Arg202-Gly2Q3 peptide bond within FnbA that is sensitive to thrombin attack allows the generation of two fragments representing the N- and C-terminal portions of rFnbA with theoretically estimated molecular masses of 22 and 70.7 kDa, respectively. The products of thrombin-mediated cleavage of rFnbA were evaluated by SDS-PAGE with subsequent examination of the gels under UV light prior to Coomassie Brilliant Blue staining (FIG. 1). Incubation of dansylcadaverine- or dansyl-PGGQQIV-decorated rFnbA with thrombin resulted in the appearance of two discrete fragments, consistent with the hydrolysis of a single peptide bond. The mobility of the thrombin-generated low- and high-molecular mass fragments on SDS-PAGE was somewhat lower than that expected for 22 kDa and 70.7 kDa fragments. This observation, however, is consistent with the overall low mobility on SDS-PAGE of the band corresponding to the parent rFnbA (both non-modified and fluorescent probe-modified), which migrates between the 120 kDa and 203 kDa standards (Matsuka et al. 2003). The molecular mass obtained for rFnbA using mass-spectral analysis was very close to the value estimated from the primary sequence (92. 656 kDa), therefore, suggesting abnormally low migration of rFnbA and its fragments on SDS-PAGE.
The modification of rFnbA with dansylcadaverine catalyzed by Factor XHIa for 4 h resulted in the fluorescence of the band corresponding to monomeric rFnbA (FIG. 1 A and C, lane 1). The thrombin-generated cleavage of the dansylcadaverine-decorated rFnbA and subsequent analysis of the reaction mixture by SDS-PAGE revealed that fluorescence almost entirely localized within the low molecular mass fragment. The band corresponding to the prominent high molecular mass fragment accommodated only a small fraction of the total dansylcadaverine fluorescence (FIG. 1 A and C, lane 2). Similar results were observed with rFnbA modified with dansylcadaverine over the extended, 18-hour period of time (FIG. 1 A and C, lanes 3 and 4). Prolonged incubation of rFnbA with dansylcadaverine and Factor Xllla also resulted in the appearance of the minor high molecular mass band
corresponding to rFnbA dimer (FIG. 1 A and C, lane 3). Incubation of rFnbA in the presence of Factor XHIa and dansyl-PGGQQIV peptide for 4 hours or 18 hours resulted in the incorporation of the probe in the monomeric rFnbA as well as in the appearance of the bands corresponding to dimers and high molecular mass polymers (FIG. 1 B and D). Nevertheless, it is apparent that under the experimental conditions employed, protein cross-linking was almost completely inhibited and the incorporation of dansylcadaverine and dansyl-PGGQQIV probes occur in the predominantly monomeric form of rFnbA. When the dansyl-PGGQQIV-modified rFnbA was subjected to thrombin-catalyzed cleavage, only the high molecular mass fragment exhibited fluorescence upon UV illumination (FIG. 1 B and D, lanes 2 and 4). Thus, limited proteolysis data revealed that the major glutamine acceptor and lysine donor sites are spatially separated within the polypeptide chain of the rFnbA molecule and located in the N- and C-terminal regions, respectively.
Example 2
Identification of the rFnbA Glutamine Acceptor
Sites Involved in Factor Xllla Cross-linking Reactions
To identify the specific reactive Gin residue(s) within rFnbA, the latter was incubated for 4 and 18 hours in the presence of Factor XHIa and a molar excess of the fluorescent probe dansylcadaverine. Following the dansylcadaverine labeling reaction, the modified rFnbA preparations were washed from the unreacted probe and then digested with trypsin. HPLC separation of the tryptic peptides produced after a 4 hour Factor XHIa-catalyzed incorporation of dansylcadaverine into rFnbA revealed a complex profile at 210 nm (FIG. 2 A). In contrast, only one major peak with retention time of approximately 44 min was detected in the same sample upon monitoring of fluorescence at 550 nm (FIG. 2 B, peak 1). Extension of the incubation time of rFnbA in the presence of Factor XIHa and dansylcadaverine from 4 hours to 18 hours and subsequent digestion with trypsin did not have an impact either on the elution profile at 210 nm (FIG. 2 C) or on intensity or retention time of the major fluorescent peak (FIG. 2 D, peak 1). At the same time, extending the time of dansylcadaverine incorporation into rFnbA resulted in the increase of intensities of two minor fluorescent peaks depicted as 2 and 3 (FIG. 2 D). The fluorescent
tracer-decorated peptides labeled as peak 1 (FIG. 2 B) and peaks 1, 2, 3 (FIG. 2 D) were collected and after a second passage through a Cg column were characterized by NHa-terminal sequence and mass spectral analysis (Table 2). Sequence analysis of the peptide from the major fluorescent peak 1 revealed that it corresponds to a 13-mer fragment derived from the NHa-terminal portion of the rFnbA. During Edman degradation, the residue in the 12th cycle was not detected, while proper sequencing was resumed in the next 13th cycle. The 12th residue, which did not yield a conventionally recognized amino acid in the Edman procedure, corresponds to Gin 103 therefore suggesting that it was modified. Two other Gin residues (Gln95 and Gln97) located in this peptide were released as FTH (phenylthiohydantoin)-derivatives in cycles 4 and 6, respectively. Sequencing data obtained for the tryptic 13-mer peptide (peak 1) are further supported by the results of mass-spectral analysis. The observed mass of this peptide showed m/z 1783.83, corresponding to the calculated mass of the peptide containing a single dansylcadaverine modification, 1783.07 (Table 2). Sequence and mass-spectral analysis of the tryptic peptide from the minor fluorescent peak 3 in FIG. 2 D showed that this peptide was also derived from the NH2-terminal region of the FnbA molecule. Upon sequencing, a single Gin residue (Gin 105) was not detected in the first cycle, but the registration of PHT-derivatives of the residues shown in Table 2 was resumed in the following cycles, suggesting that Gin 105 can be identified as another acceptor site. The observed mass of this peptide corresponded to the theoretical value with a single dansylcadaverine modification (Table 2). The material from peak 2 was not sufficiently homogeneous for NHa-terminal sequencing even after additional passage through a Cg reverse phase column, and therefore, was not positively identified by Edman degradation.
Because some of the predicted tryptic peptides were rather large (particularly those originating from the COOH-terminal portion of the protein), digestion of dansylcadaverine-modified rFnbA was also performed using Glu-C proteinase, which generated smaller and more manageable peptides. The rFnbA and Factor XII la were incubated in the presence of dansylcadaverine, as described in "Materials and Methods," and digested with Glu-C proteinase. A single fluorescent peak with a retention time of 46 minutes was repeatedly observed in the Glu-C proteinase
digestion mixture after the modification of rFnbA with dansylcadaverine over a 4 hour period (FIG. 3 B, peak 1). The extended, 18-hour incorporation of dansylcadaverine into rFnbA, followed by Glu-C digestion, produced the same major peak 1 and multiple minor peaks designated as 2, 3, 4, 5, 6, and 7 (FIG. 3 D). As shown in Table 2, four peptides were recovered from the Glu-C proteinase digestion mixture and positively identified. The peptides from peaks 1 and 7 contained the same reactive Gin 103 and Gin 105 residues as those identified in the tryptic digests. Both peptides correspond to the sequence 93-107 and differ only by the number of dansylcadaverine modifications. The peptide from the major fluorescent peak 1 contains one modified Gin 103 residue, while both Gin 103 and Gin 105 are modified in the peptide in peak 7. The Glu-C proteinase digestion also produced two fluorescent peptides derived from the COOH-terminal portion of rFnbA. The peptides from peaks 4 and 6 contained modified Gln830 and Gln783 residues, respectively (Table 2).
The analysis of the several separate dansylcadaverine labeling experiments performed over 4 hours and 18 hours followed by either trypsin or Glu-C proteinase digestion suggested that Gin 103 serves as a major amine acceptor site for Factor XHIa in rFnbA. The high reactivity of the Glnl03 site is responsible for the origin of a single major fluorescent peak 1 corresponding to either the tryptic peptide ETTQSQDNSGDQioaR (FIG. 2 B) or Glu-C proteinase-generated TTQSQDNSGDQ,03RQVD peptide (FIG. 3 B). Modification of the Gin 103 was fully completed after 4 hours of reaction (or earlier), since further incubation with Factor XHIa did not affect the intensity of peak 1 (FIG. 2 D and 3 D). In contrast, recovery of additional fluorescent peptides from the trypsin (peaks 2, 3) or Glu-C proteinase (peaks 4, 6, and 7) digestion mixtures was achieved only upon extended treatment with Factor XIHa. Intensities of these fluorescent peaks were still significantly lower, compared with that of the major peak 1, indicating that only a fraction of reactive Gin residues at positions 105, 783, and 830 underwent modification. Thus, modification experiments with dansylcadaverine revealed that rFnbA contains one major (Glnl03) and three minor (GlnlOS, Gln783, and Gln830) Factor XIHa-reactive amine acceptor sites. Example 3
Identification of the rFnbA Lysine Donor Sites Involved in Factor Xllla Cross-linking Reactions
The Factor XHIa-mediated titration of Lys side chains of rFnbA was performed using the dansyl-PGGQQIV peptide patterned on the N-terminal sequence of fibronectin. The rFnbA was incubated for 4 hours in the presence of Factor Xllla and dansyl-PGGQQIV probe and then digested with Glu-C proteinase. The HPLC separation of Glu-C proteinase-generated peptides again revealed multiple peaks detected at 210 nm and only a few fluorescent peaks, eluting in the range of approximately 60 minutes (FIG. 4 A and B). However, with the exception of the peak marked by an asterisk (FIG. 4 B), the degree of labeling and consequently the level of purity of the probe-modified peptides were not sufficient for required sequence analysis. To improve the recovery of dansyl-PGGQQIV-modified peptides, the rFnbA was incubated with Factor Xllla and dansyl-PGGQQIV probe for 18 hours and digested with Glu-C proteinase as described in "Materials and Methods." The HPLC separation of this digestion mixture produced a total of seven fluorescent peaks (FIG. 4 D). The elution profile of fluorescent peaks 1-7 (FIG. 4 D) was similar to that of the digestion mixture generated after 4 hours of rFnbA modification (FIG. 4 B), suggesting production of the same peptides with a higher degree of labeling. Each of these fluorescent peaks (asterisk-labeled peak from FIG. 4 B and peaks 1-7 from FIG. 4 D) was additionally purified on a reverse-phase Cg column, and then subjected to evaluation by mass-spectral and sequencing analysis. The results of performed analysis are summarized in Table 3. A total of six modified peptides were positively identified using both mass-spectral and sequencing analysis. High confidence sequences were obtained for peaks 4, 5, and 7 fractions, identifying Lysl57, Lys620, and Lys503 unambiguously as probe-modified residues (Table 3). During Edman degradation dansyl-PGGQQIV-modified Lys residues are not recognized as conventional PTH-derivatives, and therefore, cannot be detected. Upon sequencing of peak 4 this result was observed in the 2nd cycle, while the Val residue was released as PTH-derivative in the 1st cycle. Sequencing resumed in the following 3rd cycle and continued without interruptions. The Lys residue yielded in the 9th cycle further reinforced the conclusion that the modified lysine (Lysl57) was present in cycle 2. Analysis of
peptides from peaks 5 and 7 revealed the interruption of sequencing in cycles 3 and 2, respectively. Again, these data suggest that Lys620 (cycle 3 in peptide 5) and Lys503 (cycle 2 in peptide 7) were modified by Factor Xllla. As can be seen from Table 3, the results of NHa-terminal sequence analysis obtained for peaks 4, 5, and 7 are consistent with the observed m/z values. Each of these probe-modified fractions exhibited an m/z value that precisely matched the calculated mass of the respective peptide containing a single dansyl-PGGQQIV modification (Table 3). Each of the fluorescent peaks 1 and 2 represented a mixture of two labeled and unlabeled peptides, present in essentially equal amounts. Reliable reading of the double sequence was achieved by utilizing the known primary sequence of FnbA and the map of predicted cleavage sites. Similarly, reading of a sequence obtained for fluorescent peak 6 was also accomplished by knowing the amino acid sequence of FnbA and the location of predicted cleavage sites catalyzed by Glu-C proteinase. Analysis of the isolated fractions revealed that some dansyl-PGGQQIV-labeled peptides were derived from the same regions of the polypeptide chain. Partial hydrolysis of the Aspl60-Vall61 peptide bond by Glu-C proteinase resulted in the recovery of a shorter version of probe-modified peptide 1 (fragment 156-160) and a longer peptide 4 (fragment 156-168). Similarly, incomplete hydrolysis of the Asp629-His630 peptide bond resulted in the production of peptide 5 (fragment 618-629) and peptide 6 (fragment 618-634) (Table 3). Thus, Lysl57 and Lys620 again were identified as probe-modified residues in fluorescent peaks 1 and 6, respectively. Factor Xllla-catalyzed modification of Lys762 was demonstrated by the sequencing of the fraction corresponding to fluorescent peak 2. Mass spectral analysis of fractions 1, 2, and 6 provided another line of evidence supporting the results of NHa-terminal sequencing. The mass peaks at m/z 1432.37, 1820.22, and 2614.83 were present in fractions 1, 2, and 6, respectively. The observed masses obtained for fluorescent peaks 1, 2, and 6 corresponded to the theoretical values with a single dansyl-PGGQQIV modification each (Table 3). The fluorescent peak depicted by an asterisk (FIG. 4 B) represented a mixture of two peptides. The reading of this fraction was again achieved by knowing the primary sequence of FnbA. The unlabeled peptide was identified as fragment 266-280 (FIG. 5) while the tracer-containing peptide corresponded to peak 5 on FIG. 4 D and contained the single probe-modified Lys620 (Table 3). The fraction corresponding to peak 3
(FIG. 4 D) appeared to be a mixture of several peptides, sequences of which could not be resolved by Edman degradation. Thus, the treatment of rFnbA with Factor Xllla in the presence of dansyl-PGGQQIV probe resulted in the specific modification of Lysl57, Lys503, Lys620, and Lys762, suggesting that these residues serve as amine donor sites.
Example 4
Substitution of Identified Factor Xllla-reactive
Gin and Lys Residues Using Site-directed Mutagenesis
Replacements of identified reactive Gin and Lys residues were performed by
introduction of each mutation separately. For this purpose synthetic
oligonucleotides spanning the desired coding region (including Gin to Ala or Lys to
Ala changes) were utilized for PCR amplification of the rFnbA gene. Utilization of
specific subclones of the 2520 bp gene (e.g., a subclone spanning Gin 103, Gin 105,
and Lys 157 and one spanning Gln503, Lys620, Lys762, Gln783, and Gln830)
simplified "modular stepwise" reconstruction of the altered gene containing all eight
mutations. In each instance, after the reconstructed gene was subcloned into an E.
coli expression vector, the mutated rFnbA gene was sequenced to confirm the
presence of the desired mutations. For example, the Gin 103 residue of FnbA was
changed to Ala using the synthetic oligonucleotide
GACAATAGCGGAGATGCAAGACAAGTAGATTTAATAC (and its
complement) to anneal to plasmid pLP1143, which contains nucleotides corresponding to roughly, the 5' half of the wild typefobA gene. This primer was extended using Pfu Turbo polymerase to create multiple unmethylated copies of the altered region of the fnbA gene (Glnl03Ala). After digestion of the methylated template DNA with Dpnl, transformation of E coli with the products of the above reactions reduces recovery of the original methylated (wild type) copy. Plasmids recovered from the transformation mixture were then sequenced across a portion of the cloned fnbA region to confirm the presence of the desired sequence: GACAATAGCGGAGATGCAAGACAAGTAGATTTAATAC, with the codon GCA (underlined) substituting an alanine for the original codon for Gin (CCA) in the plasmid fnbA103A. To obtain a full-length fnbA coding sequence, the 5' half of
the mutated G\n\Q3Ala fnbA gene contained in plasmid fnbA103A was excised using Ncol and KpnI. The resulting DNA fragment was then cloned into the Ncol and KpnI sites of the pLP1125 (containing the full length wild type fnbA). The product of this ligation (pLP1149) contains the GlnlOSAla mutation in the full-length fnbA gene as determined by DNA sequence analysis of the entire 2.517kb fnbA gene.
In a similar fashion, Lys762 of the wild-type FnbA was replaced by Ala using the synthetic oligonucleotide GAAGATACAGAGGCAGACAAACCTAAG. in which the codon for Ala (GCA, underlined) replaces the codon for Lys (AAA). This primer was used to anneal to the plasmid pLP1144, which contains nucleotides corresponding to roughly, the 3' half of the wiId-type fnbA. After primer extension and transformation of the E. coli host, as described above, the presence of the mutated region was confirmed by DNA sequence analysis showing replacement of the Lys codon (AAA) by the codon for Ala (GCA, underlined) in plasmid fnbA762A. The Lys762Ala mutation contained in plasmid fnbA762A was introduced into the full length fnbA gene by digesting plasmid fnbA762A with Spel and Not! and ligating the resulting fragment into pLP1125 cut with the same enzymes. The resulting recombinant plasmid, pLP1150 contains the Lys762Ala mutation as determined by DNA sequencing of the entire fnbA gene.
The double mutation, fnbAQ103A.Q105A (Gin at 103 and 105 replaced by Ala) was
constructed using the synthetic oligonucleotide sequence:
GGAGATGC^AGAGCAGTAGATTTAATAC, which contains the codon for Alal05(GCA, underlined) in addition to the Gin 103Ala mutation (italicized). This primer was annealed to pLP1149 (fnbAQ103A) and the extension product (plasmid 5'103A+5'105A) sequenced across the portion of the gene containing the mutation. The Ncol, KpnI fragment, containing the double mutation was then used to replace the wild-type sequence in pLP1125 to create pLP1155. The entire fnbA gene contained in pLP1155 was sequenced to confirm the presence of the double mutation. The double mutation Lys620Ala, Lys762Ala was constructed using the oligonucleotide: CGAAGAGTCTACAGCAGGTATTGTAACTG to prime DNA synthesis using the template, plasmid pLPllSO. This oligonucleotide contained the
GCA codon for Ala620 (underlined) in place of the wild type Lys620 codon. The resulting plasmid contained the original Lys762Ala mutation of pLP1150 plus the Lys620Ala mutation as determined by DNA sequencing. The doubly mutated region was subcloned into pLPl 125 with the Spel, NotI DNA fragment from the double mutant replacing the wild-type sequence. The resulting plasmid, pLP1156 was sequenced across the entire fnbA gene, confirming the presence of the Lys620Ala, Lys762Ala mutations. This procedure is repeated until all of the mutations have been constructed in the two halves of the fnbA gene. Each set of mutations is combined by the subcloning procedure outlined above, resulting in a fnbA gene containing all eight mutations.
Example 5
Evaluation of the Cross-linking Properties of the rFnbA Mutant
The reduction of reactivity of the mutated rFnbA towards Factor XHIa is demonstrated using different approaches. The fluorescent low molecular probes, dansylcadaverine and dansyl-PGGQQIV, are utilized for the evaluation of transglutaminase reactivity of the mutated rFnbA. The lack of incorporation of the above probes into the mutated rFnbA by Factor XIHa indicates the absence of reactive Gin and Lys residues. Demonstration of the reduced or eliminated reactivity of mutated rFnbA towards Factor XIHa is also performed by the evaluation of its ability to undergo Factor Xllla-catalyzed cross-linking to human fibronectin and fibrin. The Factor Xllla-catalyzed incorporation of fluorescent probes as well as the cross-linking reactions to fibronectin or fibrin are also performed with the wild-type rFnbA as a positive control.
In the following examples, site-directed mutagenesis was used to replace the identified reactive Gin and Lys sites to Ala residues and the effect of these mutations was evaluated in FnbA-fibrin and FnbA-fibronectin cross-linking reactions. The major reactive Gin 103 site was replaced with Ala in a single residue FnbA mutant, which was designated as 10 FnbA. All of the identified Gin 103, 105, 783, 830 and Lysl57, 503, 620, 762 sites were substituted with Ala residues in the FnbA mutant, which was designated as 4Q4K FnbA. The Factor XIHa reactivity of both the 1Q FnbA and 4Q4K FnbA mutants was compared with that of the wild-type FnbA
receptor and the results are discussed with regard to the role of the host transglutaminase in staphylococcal adhesion and colonization.
Example 6
Generation of the 1Q FnbA Mutant (Q103A mutation)
The 1533 region of thefribA gene encoding the NH2-terminal A region (residues 1-
511) of staphylococcal FnbA was produced by PCR amplification using
chromosomal DNA from S. aureus strain ATCC49525 as template. Amplification
was performed using the following forward 5'-
GGCCATGGCATCAGAACAAAAGACAACTACAG-3' and reverse 5'-CGAGGATCCmTGTTTCAATTTGCTTGGC-3' PCR primers. The forward primer incorporated an Nco I restriction site (underlined) and ATG initiation codon immediately before the coding region of the mature sequence. The reverse primer included a TAA stop codon immediately after the coding segment, followed by a Bam HI site (underlined). The amplified DNA fragment was isolated, treated with Nco I and Bam HI restriction enzymes and subsequently ligated into the pET-28a vector (Novagen, Inc., Madison, WI). Mutagenesis offribA gene was performed using QuikChange 11 XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). To synthesize the mutant DNA strand we employed the pET-28a vector containing 1533 bp fragment of the fnbA gene as a template. Synthetic oligonucleotide 5'-GACAATAGCGGAGATGCAAGACAAGTAGATTTAATAC-3' and its complement were utilized as mutagenic primers. Mutagenic primers contain the GCA codon that replaced CAA to generate the desired Gin -> Ala mutation at position 103. Thermal cycling, extension of primers using Pfu Ultra DNA polymerase, and digestion of (hemi)methylated template with endonuclease Dpn I (Stratagene, La Jolla, CA) were performed according to manufacturer's instructions. Mutated DNA was transformed into competent XL 10-Gold E. coli cells (Stratagene) for nick repair. The resultant plasmid DNA was digested with Nco I and Kpn I restriction enzymes and the 680 bp DNA fragment of the fnbA gene containing the CAA -» GCA mutation was subcloned into pET-28a vector containing the wild-type fnbA gene (FnbA residues 1-839) (Matsuka et al. 2003). Ligation of the mutated 680 bp DNA fragment into the pET-28a I fnbA gene vector using Nco I and Kpn I restriction sites resulted in restoration of the 2517 bp fnbA
gene that encodes mutated FnbA (Q103A FnbA). The resulting pET-28a plasmid (Q103A FnbA mutant) was transformed into BL21(DE3) E. coli cells for protein expression. The presence of the desired Q103A mutation was confirmed by sequencing the mutated region of fnbA gene.
Example 7
Generation of the 4Q4K FnbA Mutant (GlnlOSAIa, GlnlOSAla, GIn783Ala,
Gln830Ala, LyslS7Ala, Lys503Ala, Lys620Ala, and Lys762Ala mutations)
Introduction of the K762A mutation. The region of the fnbA gene encoding the
COOH-terminal region (residues 512-839) of staphylococcal FnbA was produced by
PCR amplification using chromosomal DNA from S. aureus strain ATCC49525 as
template. Amplification was performed using the following forward 5'-
GAGCCATGGATATTAAGAGTGAATTAGG-3' and 5'-
CGAGGATCCGGCGTTGTATCTTCTTCAATC-3' reverse PCR primers. The forward and reverse primers incorporated an Nco I and Bam HI sites (underlined), respectively. The amplified DNA fragment was isolated, treated with Nco I and Bam HI restriction enzymes and ligated into a pET-28a vector (Novagen, Inc., Madison, WI). Synthesis of the mutated DNA strand was performed using the pET-28a vector containing a 984 bp fragment of the jhbA gene as a template and synthetic oligonucleotide 5'-GAAGATACAGAGGCAGACAAACCTAAG-3' and its complement as mutagenic primers. Mutagenic primers contained the GCA codon that replaced AAA to generate the desired Lys —» Ala mutation at position 762. Mutated DNA was transformed into competent XL 10-Gold E. coli cells (Stratagene, La Jolla, CA). The resultant plasmid was digested with Spe I and Not I restriction enzymes and the 612 bp mutated DNA fragment was subcloned into pET-28a vector containing full-length wild-type fnbA gene (FnbA residues 1-839).
Introduction of the Q105A andK157A mutations. The Q105A and K157A mutations were generated consecutively using the pET-28a template containing single (Q103A) and double (Q103A, Q105A) mutations in the fnbA gene, respectively. Synthetic oligonucleotides 5'-GGAGATGCAAGAGCAGTAGATTTAATAC-3' and its complement were employed as mutagenic primers for Q105A mutation, while 5'-GTTTCAGAAGTCGCAGGTACAGATGTG-3' and its complement were
utilized for introduction of the K157A mutation. Mutated DNA containing three (Q103A, Q105A, and K157A) mutations was transformed into competent DH 10B E. coli cells (Invitrogen, Carlsbad, CA). The resultant plasmid was digested with Nco I and Kpn I restriction enzymes and the 680 bp mutated DNA fragment was isolated for subsequent subcloning into the pET-28a vector.
Introduction of the K620A mutation. The K620A mutation was generated using the
pET-28a template containing the single (K762A) mutation mfnbA gene. This was
achieved using mutagenic oligonucleotide 5'-
CGAAGAGTCTACAGCAGGTATTGTAACTG-3' and its complement. Mutated DNA containing two (K620A and K762A) mutations was transformed into competent DH 10B E. coli cells (Invitrogen, Carlsbad, CA). The resultant plasmid was digested with Bsr Gl and Spe I restriction enzymes and the 1119 bp mutated DNA fragment was isolated and subcloned into the pET-28a vector containing the fnbA gene with the single K762A mutation.
Introduction of the K503A mutation. The K503A mutation was generated using the pET-28a template containing double (K620A, K762A) mutations in IhefnbA gene. Synthetic oligonucleotide 5'-GCAGTACGATGCCGCGCAAATTATTGAAAC-3' and its complement were utilized as mutagenic primers. Mutated DNA was transformed into competent DH 10B E. coli cells (Invitrogen, Carlsbad, CA). The resultant plasmid was digested with Kpn I and Spe I restriction enzymes and the 1256 bp mutated DNA fragment containing K503A and K620A mutations was isolated for subsequent subcloning into pET-28a vector.
Introduction of the Q783A mutation. The Q783A mutation was generated using the pET-28a template containing double (K620A, K762A) mutations in thsfribA gene. Synthetic oligonucleotide 5'-GACAGTGTGCCAGCAATTCATGGATTC-3' and its complement were utilized as mutagenic primers. Mutated DNA was transformed into competent DH 10B E. coli cells (Invitrogen, Carlsbad, CA). The resultant plasmid was digested with Spe I and Not I restriction enzymes and the 612 bp mutated DNA fragment containing two (K762A and Q783A) mutations was isolated for subsequent subcloning into the pET-28a vector.
Three DNA fragments containing seven mutations (680 bp - Q103A, Q105A, K157A; 1265 bp - K503A, K620A; and 612 bp - K762A, Q783A) were ligated into pET-28a vector digested with Nco I and Not I restriction enzymes, resulting in restoration of the 2516 bpjhbA gene that encodes Q103A, Q105A, K157A, K503A, K620A, K762A, Q783A FnbA mutant.
Introduction of the Q830A mutation. The Q830A mutation was generated using a
pET-28a template containing three (K620A, K762A, and Q783A) mutations \nfnbA
gene. Synthetic oligonucleotide 5'-
CAAAATGAAGGTGCACAAACGATTGAAG-3' and its complement were utilized as mutagenic primers. Mutated DNA was transformed into competent DH 10B E. coli cells (Invitrogen, Carlsbad, CA). The resultant plasmid was digested with Spe I and Not I restriction enzymes and the 612 bp mutated DNA fragment containing K762A, Q783A, and Q830A mutations was isolated for subcloning into a pET-28a vector. This resulted in restoration of the ftibA gene that encodes FnbA containing a total of eight Q103A, Q105A, K157A, K503A, K620A, K762A, Q783A, and Q830A mutations.
The resultant plasmid DNA was transformed into BL21(DE3) E. coli cells for protein expression. Each generated DNA fragment containing specific mutation was sequenced prior to subcloning into pET-28a vector. The restored mutated fnbA gene was sequenced once more to confirm the presence of desired mutations and the integrity of the entire coding region.
Proteins. Expression and purification of the wild-type FnbA, and 1Q, and 4Q4K FnbA mutants were performed according to procedures described elsewhere (Matsuka et al. 2003). All isolated FnbA preparations were dialyzed against 20 mM Tris, pH 7.4, 150 mM NaCl, aliquoted, and stored frozen at -20 °C.
Antibodies. Anti-rFnbA polyclonal antibodies were generated in rabbits as described earlier (Matsuka et al. 2003). Mouse monoclonal anti-fibrinogen Aa chain (Aa 529-539, clone 1C2-2) antibody was purchased from Accurate Chemical and Scientific Corp. (Westbury, NY). Mouse monoclonal anti-fibronectin antibody
(clone 2B6-F9) was obtained from Cedarlane Laboratories (Hornby, Ontario, Canada). Goat anti-rabbit and anti-mouse IgG alkaline phosphatase conjugates were purchased from BioRad Laboratories (Hercules, CA).
Theoretical Estimation of the Molecular Masses of Peptides. Calculation of the molecular mass of the peptides produced by Glu-C proteinase was performed from the known primary sequence of staphylococcal rFnbA using Peptide Companion VI.25 software (CSPS Pharmaceuticals, Inc., San Diego, CA). The effect of the dansyl-PGGQQIV (930.44 Da) modification on the mass of the peptide was calculated by considering the mass increase due to the probe. Since the formation of each e-(y-glutamyl)lysine isopeptide bond is accompanied by the release of one ammonia (17.03 Da), the final molecular mass values were adjusted accordingly.
Reversed Phase HPLC Separation of Dansyl-PGGQQIV-Labeled Peptides.
Dansyi-PGGQQIV-labeled peptides were separated on Aquapore RP-300 Cg column (Brownlee Labs, San Francisco, CA) by gradient elution with acetonitrile in 0.1% trifluoroacetic acid. Separation was carried out using Dynamax HPLC station equipped with ProStar fluorescence detector (Varian, Palo Alto, CA). Peptides were eluted with a 0-50% linear gradient of acetonitrile over a 90-minute interval at a flow rate of 0.5 ml/min. Elution of peptides was detected by monitoring of absorbance at 210 nm and fluorescence at 550 nm with excitation at 350 nm. The fluorescent tracer peaks were collected and after concentration to smaller volumes (50 - 200 u,l) were reinjected into the same column. The second round of elution was performed using a 10-20% or 20-35% linear gradient of acetonitrile over a 60-minute interval at a flow rate of 0.5 ml/min. The isolated dansyl-PGGQQIV-labeled peptides were subjected to mass spectral analysis.
Mass Spectral Analysis. The determination of molecular masses of the isolated peptides was performed using MALDI-TOF mass spectrometer Voyager DE-STR (Perseptive Biosystems, Foster City, CA). Ions formed by laser desorption at 337 nm (N2 laser) were recorded at an acceleration voltage of 20 kV in the reflector mode. In general, 200 single spectra were accumulated for improving the signal/noise ratio and analyzed by the use of the Data Explorer software. Alpha-
cyano-4-hydroxycinnamic acid (Aldrich Chemical Co., St. Louis, MO) was used as the matrix. One ^1 of a 10 mg/ml solution of the matrix compounds in 70% acetonitrile / 0.1% trifluoroacetic acid was mixed with 1 u.1 peptide solution (5-10 pmole/^il). For MALDI-TOF MS, 1 jal of this mixture was spotted on a stainless steel sample target and dried at room temperature. The mass spectra were externally calibrated using human Glul-fibrinopeptide B, human angiotensin I, and synthetic des-Arg 1 -bradykinin.
SDS-PAGE and Western Blot Analysis. SDS-PAGE was carried out using precast 3-8% Iris-Acetate gradient gels (Invitrogen, Carlsbad, CA). All SDS-polyacrylamide gels in this study were stained with Coomassie Brilliant Blue R (BioRad Laboratories, Hercules, CA). For Western Blot analysis protein samples were electroblotted to nitrocellulose membranes and immunostained with the corresponding rabbit polyclonal or mouse monoclonal antibody. The membranes were treated with goat anti-rabbit or anti-mouse alkaline phosphatase-conjugated secondary antibody and the alkaline phosphatase activity was developed with alkaline phosphatase conjugate substrate (BioRad Laboratories, Hercules, CA).
Activation of Factor XIII. Activation was achieved by treatment of 500 ug/ml of Factor XIII (Haematologic Technologies, Inc., Essex Junction, VT) with 0.25 U/ml of thrombin (Sigma, St. Louis, MO) in TBS, pH 7.4 buffer containing 10 mM dithiothreitol and 20 mM CaCb- After incubation for 20 min at 37°C, thrombin was inactivated by the addition of a molar excess of hirudin (Sigma, St. Louis, MO) and this mixture was used as factor XIHa (Takagi et al. 1995).
Incorporation of Dansylcadaverine and Dansyl-PGGQQIV Probes. Activated Factor XIII was employed to incorporate dansylcadaverine (Sigma, St. Louis, MO) or dansyl-PGGQQIV (New England Peptide, Inc., Gardner, MA) in FnbA species. Dansylcadaverine was utilized to probe Factor Xllla-reactive glutamines and the peptide dansyl-PGGQQIV was used to probe reactive lysines. Incorporation was carried out by incubating 2 yM of wild-type or mutated rFnbA with 30 w>/ml of Factor XIHa in the presence of either 2 mM of dansylcadaverine or 2 mM of dansyl-PGGQQIV at 3°C in 20 mM Tris, pH 7.4, ISOmMNaCl, 5 mM DTT, S mM CaCh or 20 mM Tris, pH 8.5,15 mMNaCl, S mM DTT, 5 mM CaCl2,
respectively, Control reactions were also performed in the same buffers containing 2 mM EDTA. At various times reactions were terminated by the addition of 2% SDS and 10% fi-mercaptoethanol, heated at 95°C, and analyzed by SDS-PAGE. Gels were examined under ultraviolet light and then stained with Coomassie brilliant blue.
Cross-Linking to Fibrin. Fibrin polymerization and Factor Xllla-catalyzed cross-linking of fibrin in the presence or absence of 2 fjM of wild-type or mutated FnbA was initiated by the addition of 0.5 U/ml of thrombin to a solution containing 5 (iM of human fibrinogen (Calbiochem, San Diego, CA) and 15 jag/ml of Factor XIII. Cross-linking reactions were carried out in TBS, pH 7.4 buffer containing 5 mM CaCb at 37°C. At various times the reactions were terminated by the addition of 20 mM Tris, pH 7.2, 9 M urea, 40 mM dithiothreitol, 2% SDS. The clots were solubilized at 37°C for 30 minutes, heated at 95°C, and samples were analyzed by SDS-PAGE / Western blotting.
Cross-Linking to Fibronectin. The cross-linking reaction with fibronectin was initiated by the addition of 15 j^g/ml of activated Factor XIII to a solution containing 1 E1M of wild-type or mutated FnbA and 2 HM of human plasma fibronectin (Sigma, St. Louis, MO). The reactions were carried out in TBS, pH 7.4 buffer containing 5 mM CaCb at 37°C. At various times thereafter cross-linking reactions were terminated by the addition of 2% SDS and 10% b-mercaptoethanol, heated at 95°C, and analyzed by SDS-PAGE / Western blotting.
Kinetics of Cross-Linking. The kinetics of Factor XHIa-mediated cross-linking of FnbA species to fibrin and fibronectin was examined by densitometric analysis of the gels stained with Coomassie brilliant blue. Laser densitometry was performed using a Personal Densitometer SI (Molecular Dynamics, Piscataway, NJ). Each gel was scanned and the generated images were analyzed using ImageQuant 5.2 software. The rate of reactions was evaluated by the decrease of FnbA upon its cross-linking to fibrin or fibronectin. The relative amount of FnbA in the reaction mixture was determined using the area beneath the peak corresponding to the FnbA band and then plotted as a function of time.
RESULTS
Incorporation of Dansylcadaverine and Dansyl-PGGQQIV Probes. The wild-type and mutated (1Q, 4Q4K) forms of FnbA comprising residues Alal through Pro839 (FIG. 7 A) were produced in E. coli using the pET-28a expression vector and isolated from the soluble fraction of bacterial lysate as described earlier (Matsuka et al. 2003). Each of the isolated proteins exhibited a single band on SDS-PAGE (FIG. 7 B) and displayed a single NH2-terminal sequence starting at ASEQKTTTVE. To examine if the replacement of identified Gin and Lys sites with Ala residues affected FnbA reactivity towards Factor XHIa, a series of experiments were designed in which the wild-type and mutated forms (1Q and 4Q4K) of FnbA were tested as substrates for Factor XHIa. Comparison of Factor XHIa reactivity of the wild-type FnbA with that of the 1Q and 4Q4K FnbA mutants was initially performed using dansylcadaverine and dansyl-PGGQQIV probes (FIG. 8). At various times, aliquots of reaction mixtures with dansylcadaverine or dansyl-PGGQQIV were collected, analyzed by SDS-PAGE, and examined under ultraviolet light prior to staining with Coomassie blue. In the presence of Factor XHIa and a molar excess of dansylcadaverine, the band corresponding to the wild-type FnbA undergoes a continual increase of fluorescence reflecting the enzymatic attachment of increasing molecules of the probe (FIG. 8 A). Under the same experimental conditions, incorporation of dansylcadaverine into the 1Q FnbA mutant was drastically reduced, suggesting that Gin at position 103 indeed acts as a major reactive Gin site in FnbA. Further reduction in fluorescence intensity was observed with the 4Q4K rFnbA mutant in which all four identified reactive Gin residues (Gin 103, Gin 105, Gln783, and Gin 830) were replaced with Ala (FIG. 8 A). Incubation of the 4Q4K FnbA mutant with dansylcadaverine and Factor XHIa for 60 minutes, however, resulted in a weak but detectable incorporation of the probe (FIG 8 A). The residual reactivity of the 4Q4K FnbA mutant observed in the reaction with dansylcadaverine may indicate the presence in FnbA of an additional minor reactive Gin site(s).
Factor XHIa-catalyzed incorporation of the dansyl-PGGQQIV probe into the wild-type FnbA is demonstrated in FIG. 8 B. When the 1Q FnbA mutant was assayed in the same reaction, its protein band exhibited fluorescence intensity that
was slightly higher when compared with that of the wild-type FnbA (FIG. 8). This result suggests that substitution of the major reactive Gin 103 with Ala resulted in a more efficient dansyl-PGGQQIV labeling of the Lys sites within the 1Q FnbA mutant. This effect is attributed to the high reactivity of the Gin 103 site, which might effectively compete with the dansyl-PGGQQIV peptide probe by participating in intra- and/or intermolecular protein cross-linking. Occurrence of protein cross-linking upon incorporation of the dansyl-PGGQQIV probe in the wild-type FnbA is supported by the presence of low mobility bands detectable under ultraviolet light and upon staining with Coomassie blue (FIG. 8 B). Factor XHIa incorporated the dansyl-PGGQQIV probe in the 4Q4K FnbA mutant at a reduced rate and with lower efficiency, suggesting that mutated Lysl57, Lys503, Lys620, and Lys762 serve as amine donor sites. It is apparent, however, that the overall reduction of Factor XIHa reactivity observed with 4Q4K FnbA mutant towards dansyl-PGGQQIV probe was not as significant as it was towards dansylcadaverine. This indicates that additional reactive Lys site(s) remain available for enzymatic modification with the dansyl-PGGQQIV probe.
Factor XIIIa-Mediated Cross-Linking to Fibrin. Factor Xllla reactivity of the 1Q and 4Q4K FnbA mutants was evaluated in a fibrin cross-linking reaction. In a control reaction, wild-type FnbA undergoes cross-linking to the fibrin a chain which results in the formation of high molecular mass heterocomplexes (Matsuka et al. 2003). Cross-linking was accompanied by the depletion of the band corresponding to the wild-type FnbA and by the appearance of a prominent band with an apparent molecular mass corresponding to the FnbA-a chain heterodimer (FIG. 9 A, B, and C, band a). The products of cross-linking reaction (bands a, b, c, and d) reacted with both anti-FnbA polyclonal antibody and anti-fibrinogen a chain monoclonal antibody (FIG. 9 B and C), suggesting that these complexes are composed of covalently attached FnbA and fibrin a chain. Under the same experimental conditions, both FnbA mutants (1Q and 4Q4K) exhibited extremely low Factor XIHa cross-linking reactivity. Only traces of FnbA mutant-a fibrin chain heterodimer were detected upon Coomassie blue staining (FIG. 9 A) or upon immunostaining with anti-FnbA polyclonal antibody (FIG. 9 B) and anti-fibrinogen a chain monoclonal antibody (FIG. 9 C). The consumption of the wild- type and
mutated FnbA species upon incubation with fibrin and Factor XHIa was evaluated using densitometric analysis (FIG. 10). As shown in FIG. 10, the wild-type FnbA reacted at a much higher rate than the IQ or 4Q4K FnbA mutants. After 120 minutes of incubation, the amount of free (uncross-linked) IQ or 4Q4K FnbA mutant remaining was about 85% more compared with that of the wild-type FnbA. These data suggest that the Gin site at position 103 is mostly responsible for Factor XHIa-catalyzed attachment of FnbA to fibrin a chains. The obtained data also indicate that both the IQ and 4Q4K FnbA mutants exhibit about 85% reduction of reactivity in cross-linking reaction with fibrin.
Factor XIIIa-Mediated Cross-Linking to Fibronectin. The reactivity of the IQ and 4Q4K FnbA mutants was also tested in reactions with plasma fibronectin. For this purpose SDS-PAGE and Western blot analysis were again utilized to assay reactivity of the FnbA mutants. Upon incubation with fibronectin the bands corresponding to the wild-type or mutated forms of FnbA were steadily depleted as proteins became cross-linked into high-molecular mass heterocomplexes (FIG. 11 A, B, and C). Formation of covalently cross-linked high molecular mass complexes consisting of the wild-type or mutated FnbA and fibronectin was evident from the results of Western blot analysis using anti-FnbA polyclonal antibody (FIG. 11 B) and anti-fibronectin monoclonal antibody (FIG. 11 C). Both SDS-PAGE and Western blot revealed little difference between reactivity of the wild-type and mutated FnbA species (FIG. 11). However, when the kinetics of the reaction was assayed using densitometric analysis the difference in the rate of cross-linking became apparent (FIG. 12). The IQ FnbA mutant reacted at a rate close to that of the wild type FnbA, while the 4Q4K FnbA mutant exhibited a slower rate of cross-linking. After 360 minutes of incubation, the amount of free (uncross-linked) 4Q4K FnbA mutant remaining was about 35% less when compared with that of the wild-type FnbA or IQ FnbA mutant. These data suggest that the Lys sites at positions 157, 503, 620, and 762 are involved in Factor XHIa-mediated cross-linking of FnbA with fibronectin and totally contribute about 35% of the reactivity of FnbA. The data also indicate that additional unidentified reactive Lys residue(s) of FnbA are involved in cross-linking with fibronectin.
Identification of Lys 702 as an Additional Reactive Site in FnbA. The results of the labeling experiments with the dansyl-PGGQQIV probe and cross-linking with fibronectin suggest that additional reactive Lys site(s) remain available for Factor XHIa in the 4Q4K FnbA mutant. As was reported earlier (U.S. patent application 60/573,724 and Anderson et al. 2004) for the identification of Factor XHIa-reactive Lys sites, a procedure was employed that utilized labeling of FnbA with dansyl-PGGQQIV (Parameswaran et al. 1990; Lorand et al. (1992). Using dansyl-PGGQQIV as a fluorescent tracer we labeled FnbA with the probe, digested the modified protein with Glu-C proteinase and performed HPLC separation of labeled FnbA peptides. Subsequent mass spectral and NH2-terminal sequence analysis of the isolated fluorescent peaks (tracer-containing peptides) resulted in the identification of all but one peak (designated as peak 3) (Anderson et al. 2004). To identify the additional reactive Lys site(s) in FnbA the material corresponding to fluorescent peak 3 was further purified using reversed phased HPLC and then subjected to mass spectral analysis. The analysis of the probe-modified material from peak 3 revealed the presence of a peptide with an observed mass [M + H]+ of 1941.98 (FIG. 13). This value corresponds to a calculated mass of the 9-mer NSHVDIKSE peptide containing a single dansyl-PGGQQIV modification (Table 4). The NSHVDIKSE peptide is originated from the COOH-terminal region of FnbA and contains a single Lys residue at position 702. Therefore, Lys702 was identified as a probe-modified residue that is targeted by Factor Xllla. Multiple sequence alignment of known FnbA and FnbB species from different S. aureus strains revealed that Lys702 is extremely conserved and present in all analyzed sequences (FIG. 14). The Lys702 site is situated in the region that is located between the Du and Dl fibronectin-binding repeats of FnbA (FIG. 7) and, therefore, should be readily available for cross-linking with Gln3 of fibronectin. Furthermore, the newly identified Lys702 along with reactive Lys620 (Anderson et al. 2004) are the only two Lys sites that are found in all analyzed FnbA and FnbB sequences. Both Lys620 (fluorescent peak 5, FIG. 11 D [7]) and Lys702 (fluorescent peak 3, FIG. 11 D (Anderson et al. 2004)) sites also exhibited the highest reactivity toward the dansyl-PGGQQIV probe. The observed high reactivity of the newly identified Lys702 and its high degree of preservation in FnbA and FnbB sequences suggest the importance of this site for Factor Xllla catalyzed cross-linking reactions.
It should be understood that the foregoing discussion and examples merely present a detailed description of certain embodiments. It therefore should be apparent to those of ordinary skill in the art that various modifications and equivalents can be made without departing from the spirit and scope of the invention.
All journal articles, other references, patents and patent applications that are identified in this patent application are incorporated by reference in their entirety.
(Table Remove). Factor XIII Substrates
(Table Remove)
Summary of the NH2-terminal sequence and mass-spectral analysis of dansylcadaverine-modified peptides derived from rFnbA.
Amino acid sequence
Proteinase Peak Retention time
cycle without recovery of a known amino acid and assigned to be factor XIHa-derivatized Gin.
The calculated mass of tryptic peptides 1 and 3, and Glu-C proteinase peptides 1, 4, and 6 include the mass of one incorporated dansylcadaverine molecule. The calculated mass of Glu-C proteinase peptide 7 includes the mass of two incorporated dansylcadaverine molecules (see Materials and Methods). Tryptic peptide from fluorescent peak 2 and Glu-C proteinase peptides from fluorescent peaks 2, 3, and 5 were not positively identified.
(Table Remove)
Summary of the NHa-terminal sequence and mass-spectral analysis of dansyl-
PGGQQIV-modified peptides derived from rFnbA.
[K] - Indicates an Edman cycle without recovery of a known amino acid and
assigned to be Factor XIHa-derivatized Lys.
The calculated mass includes the mass of one incorporated dansyl-PGGQQIV
molecule (see Materials and Methods).
Peptide from fluorescent peak 3 was not positively identified.
(Table Remove)
Mass-spectral analysis of dansyl-PGGQQIV-modified peptide derived from rFnbA
by Glu-C proteinase
.The calculated mass includes the mass of one incorporated dansyl-PGGQQIV molecule (see Materials and Methods).
WE CLAIM:
1. An isolated, altered Staphylococcal aureus (S. aureus) fibronectin-binding
protein (Fnb), wherein the alteration is a mutation of least one amino acid selected
from the group consisting of residues corresponding to glutamine (Gin) 103,
Gin 105, lysine (Lys) 157, Lys503, Lys620, Lys762, Gln783 and Gln830 of FnbA of
S. aureus strain ATCC49525, wherein the altered Fnb is less capable than wild-type
Fnb of covalently cross-linking with human proteins that serve as a substrate for
Factor XIII, Factor Xllla or tissue transglutaminase, and the human proteins are
selected from the group consisting of fibronectin and fibrin.
2. The isolated, altered Fnb as claimed in claim 1, which is derived from FnbA
or FnbB.
3. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at
Glnl03.
4. The isolated, altered Fnb as claimed in claim 3, wherein the mutation is from
glutamine to alanine.
5. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at
GlnlOS.
6. The isolated, altered Fnb as claimed in claim 5, wherein the mutation is from
glutamine to alanine.
7. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at
Lysl57.
8. The isolated, altered Fnb as claimed in claim 7, wherein the mutation is from
lysine to alanine.
9. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at
Lys503.
10. The isolated, altered Fnb as claimed in claim 9, wherein the mutation is from
lysine to alanine.
11. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at
Lys620.
12. The isolated, altered Fnb as claimed in claim 11, wherein the mutation is
from lysine to alanine.
13. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at
Lys762.
14. The isolated, altered Fnb of claim 13, wherein the mutation is from lysine to
alanine.
15. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at
Gln783.
16. The isolated, altered Fnb as claimed in claim 15, wherein the mutation is
from glutamine to alanine.
17. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at
Gln830.
18. The isolated, altered Fnb as claimed in claim 17, wherein the mutation is
from glutamine to alanine.
19. The isolated, altered Fnb as claimed in claim 1, wherein the mutation is at
each of residues Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and
Gln830.
20. The isolated, altered Fnb as claimed in claim 19, wherein the mutation at
each of residues Gin 103, GlnlOS, Lysl57, Lys503, Lys620, Lys762, Gln783 and
Gln830 is to Ala.
21. The isolated, altered Fnb as claimed in claim 19, wherein the mutation at any
one of residues G!nlG3, Gin 105, Lysl57, Lys503, Lys620, Lys762, Gln783 and
Gm830 is to Ala.
22. An immunogenic composition comprising a physiologically acceptable
vehicle and an isolated, altered S. aureus fibronectin-binding protein (Fnb), wherein
the alteration is a mutation of at least one amino acid selected from the group
consisting of residues corresponding to Glnl03, GlnlOS, Lysl57, Lys503, Lys620,
Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, and
where the altered Fnb retains immunogemcity and, when incorporated into the
immunogenic composition and administered to a vertebrate, the altered Fnb is less
capable than wild-type Fnb of covalently cross-linking with human proteins that
serve as a substrate for Factor XJH, Factor Xllla or tissue transglutarninase, the
human proteins being selected from the group consisting of fibronectin and fibrin,
and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and
fibrin upon subsequent infection of the vertebrate with S. aureus.
23. The immunogenic composition as claimed in claim 22, further comprising an
adjuvant.
24. A method of immunizing a vertebrate against S. aureus, comprising
administering to the vertebrate a composition comprising a physiologically
acceptable vehicle and an immunologically effective amount of an isolated, altered
Fnb of S. aureus. wherein the alteration is a mutation of at least one amino acid
selected from the group consisting of residues corresponding to Ginl03, GlniOS,
Lysl57, Lys503,
Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, and where the altered Fnb retains immunogenicity and, when incorporated into an
immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XIHa or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the isolated, altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus.
25. The method as claimed in claim 24, wherein the vertebrate is a seronegative
human.
26. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
glutamine (Gin) 134, Gin 136, lysine (Lys) 188, Lys534, Lys651, Lys793, Gln814
and Gln861 of the FnbA of £ aureus strain Mu50.
27. The isolated, altered Fnb of claim 1, wherein the alteration is a mutation of at
least one amino acid selected from the group consisting of residues glutamine (Gin)
134, Gin 136, lysine (Lys) 188, Lys534, Lys651, Lys793, Gln814 and Gln861 of the
FnbA of S, aureus strain N315.
28. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
glutamine (Gin) 139, Glnl41, lysine (Lys) 539, Lys656, Lys798, Gln819 and
Gln866 of the FnbA of S. aureus strain MW2.
29. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
glutamine (Gin) 147, Gin 149, lysine (Lys) 547, Lys664, Lys806, Gln827 and
Gln874 of the FnbA of £ aureus strain MSSA-476.
30. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues
glutamine (Gin) 139, Gin 141, lysine (Lys) 655, Lys797 and Gln865 of the FnbA of S. aureus strain COL.
31. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
glutamine (Gin) 139, Gin 141, lysine (Lys) 655, Lys797 and Gln865 of the FnbA of
S. aureus strain 8325-4.
32. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
glutamine (Gin) 147, Gin 149, lysine (Lys) 549, Lys666, Gln791 and Gln838 of the
FnbA of S. aureus strain EMRSA-16.
33. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
glutamine (Gin) 111, lysine (Lys) 602, Gln765 and Gln812 of the FnbB of S. aureus
strain Mu50.
34. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
glutamine (Gin) 111, lysine (Lys) 602, Gln765 and Gln812 of the FnbB of S. aureus
strain N315.
35. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
lysine (Lys) 598, Lys740 and glutamine (Gin) 808 of the FnbB of S. aureus strain
MW2.
36. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
lysine (Lys) 598, Lys740, and glutamine (Gin) 808 of the FnbB of S. aureus strain
MSSA-476.
37. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
lysine (Lys) 591, Lys 733 and glutamine (Gin) 801 of the FnbB of S. aureus strain
COL.
38. The isolated, altered Fnb as claimed in claim 1, wherein the alteration is a
mutation of at least one amino acid selected from the group consisting of residues
lysine (Lys) 591, Lys733 and glutamine (Gin) 801 of the FnbB of S. aureus strain
8325-4.
39. An isolated nucleic acid molecule encoding an altered Fnb of S. aureus,
wherein the alteration is a mutation of least one amino acid selected from the group
consisting of residues corresponding to glutamine (Gin) 103, GlnlOS, lysine (Lys)
157, Lys503, Lys620, Lys762, Gln783 and Gln830 of FnbA of S. aureus strain
ATCC49525, wherein the altered Fnb retains immunogenicity and, when
incorporated into an immunogenic composition and administered to a vertebrate, is
less capable than wild-type Fnb of covalently cross-linking with human proteins that
serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, and the
human proteins are selected from the group consisting of fibronectin and fibrin.
40. An expression vector comprising the isolated nucleic acid molecule as
claimed in claim 39 operably linked to a regulatory sequence.
41. A recombinant host cell comprising the expression vector as claimed in
claim 4.
42. A method of producing an altered Fnb, wherein the alteration is a mutation
as claimed in least one amino acid selected from the group consisting of residues
corresponding to glutamine (Gin) 103, GlnlOS, lysine (Lys) 157, Lys503, Lys620,
Lys762, Gln783 and Gln830 of FnbA of S. aureus strain ATCC49525, wherein the
altered Fnb retains immunogenicity and, when incorporated into an immunogenic
composition and administered to a vertebrate, is less capable than wild-type Fnb of
covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, where the human proteins are selected from the group consisting of fibronectin and fibrin, the method comprising maintaining the recombinant host cell of claim 41 under conditions suitable for expression of the altered Fnb.
43. An immunogenic composition comprising a physiologically acceptable
vehicle and an isolated nucleic acid molecule encoding an altered Fnb of S. aureus,
wherein the alteration is a mutation of at least one amino acid selected from the
group consisting of residues corresponding to GlnlOS, GlnlOS, Lysl57, Lys503,
Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525,
where the altered Fnb retains immunogenicity and, when incorporated into the
immunogenic composition and administered to a vertebrate, the altered Fnb is less
capable than wild-type Fnb of covalently cross-linking with human proteins that
serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, the
human proteins being selected from the group consisting of fibronectin and fibrin,
and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and
fibrin upon subsequent infection of the vertebrate with S. aureus.
44. The immunogenic composition as claimed in claim 43, further comprising a
transfection-facilitating agent.
45. A method of inducing an immune response in a vertebrate, comprising
administering to the vertebrate the immunogenic composition of claim 43 in an
amount effective to induce an immune response.
46. A method of immunizing a vertebrate against S. aureus, comprising
administering to the vertebrate a composition comprising a physiologically
acceptable
vehicle and an immunologically effective amount of a nucleic acid molecule encoding an altered Fnb of S. aureus, wherein the alteration is a mutation of at least one amino acid selected from the group consisting of residues corresponding to
Gin 103, Gin105, Lysl57, Lys503, Lys620, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525, and where the altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor Xllla or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with S. aureus.
47. The method as claimed in claim 46, wherein the vertebrate is a seronegative
human.
48. An isolated, altered Staphylococcal aureus (S. aureus) fibronectin-binding
protein (Fnb), wherein the alteration is a mutation of least one amino acid selected
from the group consisting of residues corresponding to glutamine (Gin) 103,
GlnlOS, lysine (Lys) 157, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of
FnbA of S. aureus strain ATCC49525, wherein the altered Fnb is less capable than
wild-type Fnb of covalently cross-linking with human proteins that serve as a
substrate for Factor XIII, Factor XIHa or tissue transglutaminase, and the human
proteins are selected from the group consisting of fibronectin and fibrin.
49. The isolated, altered Fnb as claimed in claim 48, wherein the mutation is at
Lys702.
50. The isolated, altered Fnb as claimed in claim 49, wherein the mutation is
from lysine to alanine.
51. The isolated, altered Fnb as claimed in claim 48, wherein the mutation is at
each
of residues GlnlOS, Glnl05, Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830.
52. The isolated, altered Fnb as claimed in claim 51, wherein the mutation at
each of residues Gin 103, Gin 105, Lysl57, Lys503, Lys620, Lys702, Lys762,
Gln783 and Gln830 is to Ala.
53. The isolated, altered Fnb as claimed in claim 48, wherein the mutation at any
one of residues Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783
and Gln830 is to Ala.
54. An immunogenic composition comprising a physiologically acceptable
vehicle and an isolated, altered S. aureus fibronectin-binding protein (Fnb), wherein
the alteration is a mutation of at least one ami no acid selected from the group
consisting of residues corresponding to Glnl03, GlnlOS, Lysl57, Lys503, Lys620,
Lys702, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain ATCC49525,
and where the altered Fnb retains immunogenicity and, when incorporated into the
immunogenic composition and administered to a vertebrate, the altered Fnb is less
capable than wild-type Fnb of covalently cross-linking with human proteins that
serve as a substrate for Factor XIII, Factor XUIa or tissue transglutaminase, the
human proteins being selected from the group consisting of fibronectin and fibrin,
and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and
fibrin upon subsequent infection of the vertebrate with S. aureus.
55. The immunogenic composition as claimed in claim 54, further comprising an
adjuvant.
56. A method of immunizing a vertebrate against S. aureus, comprising
administering to the vertebrate a composition comprising a physiologically
acceptable vehicle and an immunologically effective amount of an isolated, altered
Fnb of S. aureus, wherein the alteration is a mutation of at least one amino acid
selected from the group consisting of residues corresponding to Gin 103, GlnlOS,
Lysl57, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of the FnbA of S.
aureus strain ATCC49525, and where the altered Fnb retains immunogenicity and,
when incorporated into an immunogenic composition and administered to a
vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the isolated, altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with £ aureus.
57. The method as claimed in claim 56, wherein the vertebrate is a seronegative
human.
58. An isolated nucleic acid molecule encoding an altered Fnb of S. aureus,
wherein the alteration is a mutation of least one amino acid selected from the group
consisting of residues corresponding to glutamine (Gin) 103, GlnlOS, lysine (Lys)
157, Lys503, Lys620, Lys702, Lys762, Gln783 and Gln830 of FnbA of S. aureus
strain ATCC49525, wherein the altered Fnb retains immunogenicity and, when
incorporated into an immunogenic composition and administered to a vertebrate, is
less capable than wild-type Fnb of covalently cross-linking with human proteins that
serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, and the
human proteins are selected from the group consisting of fibronectin and fibrin.
59. An expression vector comprising the isolated nucleic acid molecule of claim
58 operably linked to a regulatory sequence.
60. A recombinant host cell comprising the expression vector of claim 59.
61. A method of producing an altered Fnb, wherein the alteration is a mutation
of least one amino acid selected from the group consisting of residues corresponding
to glutamine (Gin) 103, GlnlOS, lysine (Lys) 157, Lys503, Lys620, Lys702, Lys762,
Gln783 and Gln830 of FnbA of S. aureus strain ATCC49525, wherein the altered
Fnb retains immunogenicity and, when incorporated into an immunogenic
composition and administered to a vertebrate, is less capable than wild-type Fnb of
covalently cross-linking with human proteins that serve as a substrate for Factor
XIII, Factor Xllla or tissue transglutaminase, where the human proteins are selected from the group consisting of fibronectin and fibrin, the method comprising maintaining the recombinant host cell of claim 60 under conditions suitable for expression of the altered Fnb.
62. An immunogenic composition comprising a physiologically acceptable
vehicle and an isolated nucleic acid molecule encoding an altered Fnb of S. aureus,
wherein the alteration is a mutation of at least one amino acid selected from the
group consisting of residues corresponding to GlnlOS, GlnlOS, Lysl57, Lys503,
Lys620, Lys702, Lys762, Gln783 and Gln830 of the FnbA of S. aureus strain
ATCC49525, where the altered Fnb retains immunogenicity and, when incorporated
into the immunogenic composition and administered to a vertebrate, the altered Fnb
is less capable than wild-type Fnb of covalently cross-linking with human proteins
that serve as a substrate for Factor XIII, Factor Xllla or tissue transglutaminase, the
human proteins being selected from the group consisting of fibronectin and fibrin,
and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and
fibrin upon subsequent infection of the vertebrate with S. aureus.
63. The immunogenic composition as claimed in claim 62, further comprising a
transfection-facilitating agent.
64. A method of inducing an immune response in a vertebrate, comprising
administering to the vertebrate the immunogenic composition of claim 62 in an
amount effective to induce an immune response.
65. A method of immunizing a vertebrate against S. aureus, comprising
administering to the vertebrate a composition comprising a physiologically
acceptable vehicle and an immunologically effective amount of a nucleic acid
molecule encoding an altered Fnb of S. aureus, wherein the alteration is a mutation
of at least one amino acid selected from the group consisting of residues
corresponding to Glnl03, GlnlOS, Lysl57, Lys503, Lys620, Lys702, Lys762,
Gln783 and Gln830 of the FnbA of S, aureus strain ATCC49525, and where the
altered Fnb retains immunogenicity and, when incorporated into an immunogenic composition and administered to a vertebrate, is less capable than wild-type Fnb of covalently cross-linking with human proteins that serve as a substrate for Factor XIII, Factor XHIa or tissue transglutaminase, the human proteins being selected from the group consisting of fibronectin and fibrin, and the altered Fnb does not enhance binding of wild-type Fnb to fibronectin and fibrin upon subsequent infection of the vertebrate with £ aureus.
66. The method as claimed in claim 65, wherein the vertebrate is a seronegative human.
Dated this 17th day of May 2005
| # | Name | Date |
|---|---|---|
| 1 | 5997-DELNP-2006-Correspondence-Others-(09-09-2009).pdf | 2009-09-09 |
| 2 | 5997-delnp-2006-pct-search report.pdf | 2011-08-21 |
| 3 | 5997-delnp-2006-pct-request.pdf | 2011-08-21 |
| 4 | 5997-delnp-2006-pct-311.pdf | 2011-08-21 |
| 5 | 5997-delnp-2006-pct-237.pdf | 2011-08-21 |
| 6 | 5997-delnp-2006-pct-220.pdf | 2011-08-21 |
| 7 | 5997-delnp-2006-gpa.pdf | 2011-08-21 |
| 8 | 5997-delnp-2006-form-5.pdf | 2011-08-21 |
| 9 | 5997-delnp-2006-form-3.pdf | 2011-08-21 |
| 10 | 5997-delnp-2006-form-2.pdf | 2011-08-21 |
| 11 | 5997-delnp-2006-form-18.pdf | 2011-08-21 |
| 12 | 5997-delnp-2006-form-1.pdf | 2011-08-21 |
| 13 | 5997-delnp-2006-drawings.pdf | 2011-08-21 |
| 14 | 5997-delnp-2006-description (complete).pdf | 2011-08-21 |
| 15 | 5997-delnp-2006-correspondence-others.pdf | 2011-08-21 |
| 16 | 5997-delnp-2006-correspondence-others-1.pdf | 2011-08-21 |
| 17 | 5997-delnp-2006-claims.pdf | 2011-08-21 |
| 18 | 5997-delnp-2006-assignments.pdf | 2011-08-21 |
| 19 | 5997-delnp-2006-abstract.pdf | 2011-08-21 |
| 20 | 5997-DELNP-2006_EXAMREPORT.pdf | 2016-06-30 |