Sign In to Follow Application
View All Documents & Correspondence

An Improved Enzyme Catalyzed Carboxylation Reaction

Abstract: The present invention relates to an improved process for the preparation of an aromatic hydroxy compound (Z) (as described herein), and salts thereof, using a decarboxylase enzyme. More particularly, there is provided an improved process for the preparation of the 2,6-dihydroxy benzoic acid (Z1) (as described herein) by an enzyme catalyzed reaction using decarboxylase, wherein the enzyme is produced by incorporation of the recombinant pET-30a(+) into the host cell such as Escherichia coli.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
27 September 2022
Publication Number
28/2023
Publication Type
INA
Invention Field
CHEMICAL
Status
Email
Parent Application

Applicants

PI INDUSTRIES LTD.
Udaisagar Road Udaipur - Rajasthan 313001

Inventors

1. SRINIVAS, Pullela Venkata
39, Ramanasuryam, 27th cross, Thimmareddy Layout, Kaggadasapura Road Bangalore- Karnataka 560093
2. SHARMA, Parhalad Ray
Plot No. 8, KNo. 2421, Near Vaaidehi Premium Houses, Mansarovar Colony, Near Bhuwana Bypass, Bedla Udaipur- Rajasthan 313001
3. RAO, Kandiraju Venkata Sita Ram
Flat No. 506, DSR Reganti, Behind Westin Hotel, Madhapur Telangana- Hyderabad, 500081

Claims

1. An improved process for the preparation of an aromatic hydroxy compound (Z), using a decarboxylase enzyme as a catalyst; 5 , wherein D is a carbocycle, heterocycle, aryl, heteroaryl, aromatic or hetero-aromatic ring, mono or bicyclic aromatic, mono or bicyclic hetero-aromatic; n= 1-5; comprising the step of contacting the decarboxylase enzyme with the substrate (A), 10 represented by the formula: wherein, D and n are as described above; in the presence of a carbonate ion source or a carbon dioxide (CO2) source and a suitable solvent; wherein said enzyme is produced by incorporation of the recombinant pET-30 15 into the host cell. .

2. The process as claimed in claim 1, wherein the D represent phenyl ring.

3. The process as claimed in claim 1, wherein said compound of formula Z is Z1 or a salt thereof: 23 PI External

4. The process as claimed in claim 1, wherein said compound of formula A is A1 or a salt thereof; .

5. The process as claimed in claim 1, wherein said process 5 is a process for the synthesis of compound of formula Z1 or a salt thereof: comprising the step of contacting the decarboxylase enzyme with the substrate (A1), . 10 in the presence of a carbonate ion source or a carbon dioxide (CO2) source; wherein said enzyme is produced by incorporation of the recombinant pET-30 into the host cell.

6. The process as claimed in claim 1, wherein said enzyme is produced by incorporation of the recombinant pET-30 into the host cell such as Escherichia coli.

7. The process as claimed in claim 1, wherein said process may optionally be carried out in 15 the presence of a suitable buffer as sodium hydrogen phosphates (NaH2PO4, Na2HPO4), potassium hydrogen phosphates (KH2PO4, K2HPO4), potassium bicarbonate (KHCO3), 24 PI External ammonium carbonate (NH4CO3), ammonium bicarbonate (NH4HCO3), sodium bicarbonate (NaHCO3), sodiumbisulphite (NaHSO3), ammonium chloride (NH4Cl).

8. The process as claimed in claim 1, wherein said carbonate ion source or said carbon dioxide (CO2) source is selected from carbon dioxide gas (CO2), potassium bicarbonate (KHCO3), ammonium carbonate (NH4CO3), 5 ammonium bicarbonate (NH4HCO3), sodium bicarbonate (NaHCO3), potassium carbonate (K2CO3) or sodium carbonate (Na2CO3).

9. The process as claimed in claim 1, wherein said suitable solvent is selected from the group consisting of protic solvents, polar aprotic solvents and nonpolar solvents, 10 including aromatic hydrocarbons, chlorinated hydrocarbons, ethers, aliphatic hydrocarbons, alcohols, esters, ketones, amides, water or mixtures thereof.

10. The process as claimed in claim 1, wherein the product formed was precipitated by adding suitable quaternary ammonium salts.

11. The process as claimed in claim 9, wherein said suitable quaternary ammonium salt is 15 selected from tetra-butyl ammonium bromide, tetra-butyl ammonium chloride, tetrabutyl ammonium fluoride, dodecyltrimethyl ammonium chloride, or tetrabutylammonium hydrogensulfate.

12. The process as claimed in claim 1, wherein yield of said aromatic hydroxy compound (Z) is in the range of 60 to 98%. 20 13. The process as claimed in claim 1, wherein purity of said aromatic hydroxy compound (Z) is in the range of 90 to 99%.

Specification

FIELD OF THE INVENTION:
The present invention relates to an improved process 5 for the preparation of an aromatic
hydroxy compound (Z), and salts thereof, using a decarboxylase enzyme. More particularly,
an improved process for the preparation of 2,6-dihydroxybenzoic acid (Z1) is provided by an
enzyme catalyzed reaction using decarboxylase.
10 BACKGROUND OF THE INVENTION:
The following discussion of the prior art is intended to present the invention in an appropriate
technical context and allows its significance to be properly appreciated. Unless clearly
indicated to the contrary, reference to any prior art in this specification should not be
construed as an expressed or implied admission that such art is widely known or forms part of
15 common general knowledge in the field.
Phenolic acids such as hydroxybenzoic acids are important intermediates in the
pharmaceutical and agrochemical industry. A number of enzyme catalyzed
regioselective ortho- or para-carboxylation reactions of aromatic hydroxy compounds have
20 been reported in the literature. There are several approaches reported for the synthesis of
hydroxybenzoic acids which includes both synthetic approaches as well as through enzymatic
catalysis. Enzymes of the decarboxylase class are very useful for the synthesis of alcohols,
carboxylic acids and other important chemicals. There are significant advantages in biocarboxylation
technology over synthetic techniques in terms of quality and quantity of the
25 product.
Archives of Microbiology, 155 (1), 68-74 (1990) disclosed an anaerobic metabolism of
resorcyclic acids.
and resorcinol (1,3-benzenediol) in a fermenting co-culture of a Clostridium species with a
30 Campylobacter species and other gram-negative bacterium.
Japanese patent application JP2001046093A disclosed a general method for producing a
carboxylic acid of an aromatic alcohol by contacting the aromatic alcohol with a
3
PI External
microorganism in the presence of carbonate ions or a carbon dioxide source (CO2); as
depicted in the below Scheme-(1):
Scheme-(1)
5
Journal of Bacteriology 186 (20), 6855-63 (2004) disclosed a thermophilic, reversible γ-
resorcylate decarboxylase purified from Rhizobium species strain MTP-10005, and utility of
the enzyme as a reaction catalyst for the decarboxylation of 2,3- and 2,6-dihydroxybenzoate
(resorcylate).
10
Japanese patent JP4414786 disclosed a method for producing 2,6-dihydroxy benzoic acid
wherein the carbonic acid addition reaction is carried out under pressure reaction conditions
in the presence of a 2,6-dihydroxy benzoic acid decarboxylase or a microbial strain such as
Agrobacterium tumefaciens IAM 12048 strain having a 2,6-dihydroxy benzoic acid
15 decarboxylase activity.
Biotechnology Letters 29 (5), 819-822 (2007) disclosed a regioselective and enzymatic
production of γ-resorcylic acid from resorcinol using recombinant Escherichia coli cells
20 expressing a novel decarboxylase gene, wherein a recombinant Escherichia coli, expressing
the rdc gene, which encodes a γ--resorcylic acid decarboxylase (Rdc) reversibly catalyzing
regioselective carboxylation of resorcinol derived from Rhizobium radiobacter WU-0108.
Journal of Molecular Catalysis B: Enzymatic 122, 348–352 (2015) disclosed an enzymatic
25 carboxylation of hydroxystilbenes by the resorcylic acid decarboxylase obtained from
recombinant Rhizobium radiobacter WU-0108) with the pET21-d(+) vector, as depicted in
Scheme-(2):
4
PI External
Scheme-(2)
In addition to the afore discussed literature documents, there are a number of published patent
and non-patent documents available that describe 5 methods for carboxylation of resorcinol by
synthetic methods as well as enzyme catalyzed methods; WO2005/054462 A1; Archives of
Microbiology 181 (6), 391–397 (2004); BIOCHEMICAL AND BIOPHYSICAL
RESEARCH COMMUNICATIONS 324 (2), 611-620 (2004); JP4719535 B; JP5126808 B;
WO2013/023999 A.
10 It is evident from the above discussion that several enzyme catalyzed transformations
including carboxylase enzymes are reported in literature; however the above referred
literature documents do not mention the use of recombinant pET-30 for the production of 2,6-
dihydroxy benzoic acid decarboxylase and further its utility in the carboxylation reaction.
It is further evident that the traditionally reported carboxylase catalyzed reactions as
15 discussed above are performed in an autoclave under controlled conditions and, some of the
reported processes primarily provide products with low purity and yield, which involve
critical reaction conditions, isolation of enzyme, biphasic separations, purification using
column chromatography, critical work up procedures and require special technical
instruments; which render the process costlier, and hence the processes are not industrially
20 feasible.
In view of these drawbacks, there is a need to develop an industrially viable commercial
process for the production of 2,6-dihydroxy benzoic acid decarboxylase and eventually the
carboxylation of the aromatic hydroxy compound (Z); which is a simple, efficient and costeffective
process and provides the desired compounds in improved yield and purity.
25 Inventors of the present invention have developed an improved process that addresses the
problems associated with the processes reported in the prior art. The present invention relates
to the production of 2,6-dihydroxy benzoic acid decarboxylase by introducing recombinant
pET-30 into the host cell, and subsequently the enzyme catalyzed carboxylation of aromatic
hydroxy compound (Z), which is a chemical intermediate used for the preparation of various
30 agrochemicals as well as pharmaceutical compounds. More particularly, the present invention
relates to the carboxylation of aromatic hydroxy compound (Z1) using 2,6-dihydroxy benzoic
5
PI External
acid decarboxylase enzyme, wherein the enzyme is produced by incorporation of the
recombinant pET-30 into the host cell such as Escherichia coli. Effectively, the process of the
present invention does not involve the use of any toxic and/or costly solvents and reagents.
Moreover, the process does not require a specified instrumental set up, additional purification
steps and critical workup procedures. 5 Accordingly, the present invention provides a process
for the carboxylation of a substrate, which is simple, efficient, cost effective, environmentally
friendly and commercially scalable for large scale operations.
SUMMARY OF THE INVENTION:
In one aspect, the present invention relates to an improved process for the preparation of an
10 aromatic hydroxy compound (Z) (as described herein), using decarboxylase enzyme as a
catalyst:
wherein D is a carbocycle, heterocycle, aryl, heteroaryl, aromatic or hetero-aromatic ring,
mono or bicyclic aromatic, mono or bicyclic hetero-aromatic,
15 n= 1-5.
In one aspect, the present invention relates to an improved process for the preparation of an
aromatic hydroxy compound (Z) (as described herein), by contacting the decarboxylase
enzyme with the substrate (A) in the presence of a carbonate ion or carbon dioxide (CO2)
20 source; wherein the enzyme is produced by incorporation of the recombinant pET-30 into the
host cell:
6
PI External
wherein D is a carbocycle, heterocycle, aryl, heteroaryl, aromatic or hetero-aromatic ring,
mono or bicyclic aromatic, mono or bicyclic hetero-aromatic;
and n= 1-5.
In another aspect, the present invention relates to 5 an improved process for the preparation of
an aromatic hydroxy compound (Z1) (as described herein), by contacting the decarboxylase
enzyme with the substrate (A1) (as described herein) in the presence of a carbonate ion or
carbon dioxide source (CO2); wherein the enzyme is produced by incorporation of the
recombinant pET-30 into the host cell.
10
In another aspect, the present invention relates to an improved process for the preparation of
2,6-dihydroxy benzoic acid (Z1) (as described herein), by contacting the 2,6-dihydroxy
benzoic acid decarboxylase with the substrate (A1) in the presence of carbonate ions or a
carbon dioxide (CO2) source; wherein the enzyme is produced by incorporation of the
15 recombinant pET-30a(+) into the host cell such as Escherichia coli.
DETAILED DESCRIPTION OF THE INVENTION:
For the purpose of the instantly presented invention the ‘host cell’ represents the bacterial cell
20 wherein the recombinant plasmid vector is overexpressed. The host cell can be selected from
but is not limited to Escherichia coli, Aspergillus species, Comamonas and Bordetella strain,
or Verminephrobacter strain.
It is evident from the literature that the pET-30a-c(+) vectors carry an N-terminal
25 His•Tag®/thrombin/S•Tag™/enterokinase configuration plus an optional C-terminal His•Tag
sequence. In the plasmid (P) the the sequence is numbered by the pBR322 convention, so the
T7 expression region is reversed on the circular map. The cloning/expression region of the
coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented
7
PI External
so that infection with helper phage will produce virions containing single-stranded DNA that
corresponds to the coding strand. Therefore, single-stranded sequencing should be performed
using the T7 terminator primer:
5
(P)
Accordingly, the present invention relates to a process for the preparation of an aromatic
10 hydroxy compound (Z) or a salt thereof; represented by the formula:
8
PI External
wherein D is a carbocycle, heterocycle, aryl, heteroaryl, aromatic or hetero-aromatic ring,
mono or bicyclic aromatic, mono or bicyclic hetero-aromatic;
n= 1-5;
comprising the step of contacting the decarboxylase enzyme with the substrate (A),
5 represented by the formula:
in the presence of a carbonate ion or a carbon dioxide source (CO2); wherein the enzyme is
produced by overexpression of the recombinant pET-30 into the host cell.
The meaning of various terms used in the description, and precisely relevant to define the
10 scope of the organic moiety (D), shall be illustrated as follows:
wherein D is a carbocycle, heterocycle, aryl, heteroaryl, aromatic or hetero-aromatic ring,
mono or bicyclic aromatic, mono or bicyclic hetero-aromatic groups, as defined herein, are
optionally substituted (e.g., "substituted" or "unsubstituted" carbocyclyl, "substituted" or
"unsubstituted" heterocyclyl, "substituted" or "unsubstituted" aryl or "substituted" or
15 "unsubstituted" heteroaryl group). In general, the term "substituted", whether preceded by the
term "optionally" or not, means that at least one hydrogen present on a group (e.g., a carbon
or nitrogen atom etc.) is replaced with a permissible substituent, e.g., a substituent which
upon substitution results in a stable compound. Unless otherwise indicated, a "substituted"
group has a substituent at one or more substitutable positions of the group, and when more
20 than one position in any given structure is substituted, the substituent is either the same or
different at each position.
The term "carbocycle" includes "aromatic carbocyclic ring system" and "nonaromatic
carbocylic ring system" or polycyclic or bicyclic (spiro, fused, bridged, nonfused) ring
25 compounds in which ring may be aromatic or non-aromatic (where aromatic indicates that the
Huckel rule is satisfied and non-aromatic indicates that the Huckel rule is not statisfied).
The term "hetero" in connection with rings refers to a ring in which at least one ring atom is
not carbon and which can contain 1 to 4 heteroatoms independently selected from the group
9
PI External
consisting of nitrogen, oxygen and sulfur, provided that each ring contains no more than 4
nitrogens, no more than 2 oxygens and no more than 2 sulfurs.
The term "aromatic" indicates that the Huckel rule is satisfied and the term "non-aromatic"
indicates that the Huckel rule is not satisfied.
The term "heterocycle" or "heterocyclic" or 5 "heterocyclic ring system " includes "aromatic
heterocycle" or "heteroaryl bicyclic ring system" and "nonaromatic heterocycle ring system"
or polycyclic or bicyclic (spiro, fused, bridged, non-fused) ring compounds in which ring
may be aromatic or non-aromatic, wherein the heterocycle ring contains at least one
heteroatom selected from N, O, S(O)0-2, and or C ring member of the heterocycle may be
10 replaced by C(=O), C(=S), C(=CR*R*) and C=NR*, * indicates integers.
The term "non-aromatic heterocycle" or "non-aromatic heterocyclic" means three- to fifteenmembered,
preferably three- to twelve-membered, saturated or partially unsaturated
heterocycle containing one to four heteroatoms from the group of oxygen, nitrogen and
sulphur: mono, bi- or tricyclic heterocycles which contain, in addition to carbon ring
15 members, one to three nitrogen atoms and/or one oxygen or sulphur atom or one or two
oxygen and/or sulphur atoms; if the ring contains more than one oxygen atom, they are not
directly adjacent; for example (but not limited to) oxetanyl, oxiranyl, aziridinyl, thietanyl, 2-
tetrahydrofuranyl, 3-tetrahydrofuranyl, 2-tetrahydrothienyl, 3-tetrahydrothienyl, 1-
pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 3-isoxazolidinyl, 4-isoxazolidinyl, 5-
20 isoxazolidinyl, 3-isothiazolidinyl, 4-isothiazolidinyl, 5-isothiazolidinyl, 1-pyrazolidinyl, 3-
pyrazolidinyl, 4-pyrazolidinyl, 5-pyrazolidinyl, 2-oxazolidinyl, 4-oxazolidinyl, 5-
oxazolidinyl, 2-thiazolidinyl, 4-thiazolidinyl, 5-thiazolidinyl, 1-imidazolidinyl, 2-
imidazolidinyl, 4-imidazolidinyl, 1,2,4-oxadiazolidin-3-yl, l,2,4-oxadiazolidin-5-yl, l,2,4-
thiadiazolidin-3-yl, 1,2,4-thiadiazolidin-5-yl, l,2,4-triazolidin-1-yl, l,2,4-triazolidin-3-yl,
25 l,3,4-oxadiazolidin-2-yl, l,3,4-thiadiazolidin-2-yl, 1,3,4-triazolidin-1-yl, 1,3,4-triazolidin-2-yl,
2,3-dihydrofur-2-yl, 2,3-dihydrofur-3-yl, 2,4-dihydrofur-2-yl, 2,4-dihydrofur-3-yl, 2,3-
dihydrothien-2-yl, 2,3-dihydrothien-3-yl, 2,4-dihydrothien-2-yl, 2,4-dihydrothien-3-yl,
pyrrolinyl, 2-pyrrolin-2-yl, 2-pyrrolin-3-yl, 3-pyrrolin-2-yl, 3-pyrrolin-3-yl, 2-isoxazolin-3-
yl, 3-isoxazolin-3-yl, 4-isoxazolin-3-yl, 2-isoxazolin-4-yl, 3-isoxazolin-4-yl, 4-isoxazolin-4-
30 yl, 2-isoxazolin-5-yl, 3-isoxazolin-5-yl, 4-isoxazolin-5-yl, 2-isothiazolin-3-yl, 3-isothiazolin-
3-yl, 4-isothiazolin-3-yl, 2-isothiazolin-4-yl, 3-isothiazolin-4-yl, 4-isothiazolin-4-yl, 2-
isothiazolin-5-yl, 3-isothiazolin-5-yl, 4-isothiazolin-5-yl, 2,3-dihydropyrazol-l-yl, 2,3-
dihydropyrazol-2-yl, 2,3-dihydropyrazol-3-yl, 2,3-dihydropyrazol-4-yl, 2,3-dihydropyrazol10
PI External
5-yl, 3,4-dihydropyrazol-l-yl, 3,4-dihydropyrazol-3-yl, 3,4-dihydropyrazol-4-yl, 3,4-
dihydropyrazol-5-yl, 4,5-dihydropyrazol-l-yl, 4,5-dihydropyrazol-3-yl, 4,5-dihydropyrazol-4-
yl, 4,5-dihydropyrazol-5-yl, 2,3-dihydrooxazol-2-yl, 2,3-dihydrooxazol-3-yl, 2,3-
dihydrooxazol-4-yl, 2,3-dihydrooxazol-5-yl, 3,4-dihydrooxazol-2-yl, 3,4-dihydrooxazol-3-yl,
3,4-dihydrooxazol-4-yl, 3,4-dihydrooxazol-5 5-yl, 3,4-dihydrooxazol-2-yl, 3,4-dihydrooxazol-
3-yl, 3,4-dihydrooxazol-4-yl, piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-piperidinyl,
pyrazynyl, morpholinyl, thiomorphlinyl, l,3-dioxan-5-yl, 2-tetrahydropyranyl, 4-
tetrahydropyranyl, 2-tetrahydrothienyl, 3-hexahydropyridazinyl, 4-hexahydropyridazinyl, 2-
hexahydropyrimidinyl, 4-hexahydropyrimidinyl, 5-hexahydropyrimidinyl, 2-piperazinyl,
10 l,3,5-hexahydrotriazin-2-yl, l,2,4-hexahydrotriazin-3-yl, cycloserines, 2,3,4,5-
tetrahydro[1H]azepin-1- or -2- or -3- or -4- or -5- or -6- or -7- yl, 3,4,5,6-tetrahydro[
2H]azepin-2- or -3- or -4- or -5- or -6- or-7-yl, 2,3,4,7-tetrahydro[1H]azepin-1- or -2-
or -3- or -4- or -5- or -6- or-7- yl, 2,3,6,7-tetrahydro[1H]azepin-1- or -2- or -3- or -4- or -5- or
-6- or -7- yl, hexahydroazepin-1- or -2- or -3- or -4-yl, tetra- and hexahydrooxepinyl such as
15 2,3,4,5-tetrahydro[1H]oxepin-2- or -3- or -4- or -5- or -6- or -7- yl, 2,3,4,7-
tetrahydro[1H]oxepin-2- or -3- or -4- or -5- or -6- or -7- yl, 2,3,6,7-tetrahydro[1H]oxepin-2-
or -3- or -4- or -5- or -6- or -7- yl, hexahydroazepin-1- or -2- or -3- or -4- yl, tetra- and
hexahydro-1,3-diazepinyl, tetra- and hexahydro-1,4-diazepinyl, tetra- and hexahydro-1,3-
oxazepinyl, tetra- and hexahydro-1,4-oxazepinyl, tetra- and hexahydro-1,3-dioxepinyl, tetra20
and hexahydro-1,4-dioxepinyl. This definition also applies to heterocyclyl as a part of a
composite substituent, for example heterocyclylalkyl etc., unless specifically defined
elsewhere.
The term "heteroaryl" or "aromatic heterocyclic" means 5 or 6-membered, fully unsaturated
monocyclic ring system containing one to four heteroatoms from the group of oxygen,
25 nitrogen and sulphur; if the ring contains more than one oxygen atom, they are not directly
adjacent; 5-membered heteroaryl containing one to four nitrogen atoms or one to three
nitrogen atoms and one sulphur or oxygen atom: 5-membered heteroaryl groups which, in
addition to carbon atoms, may contain one to four nitrogen atoms or one to three nitrogen
atoms and one sulphur or oxygen atom as ring members, for example (but not limited thereto)
30 furyl, thienyl, pyrrolyl, isoxazolyl, isothiazolyl, pyrazolyl, oxazolyl, thiazolyl, imidazolyl,
l,2,4-oxadiazolyl, l,2,4-thiadiazolyl, l,2,4-triazolyl, l,3,4-oxadiazolyl, l,3,4-thiadiazolyl, l,3,4-
triazolyl, tetrazolyl; nitrogen-bonded 5-membered heteroaryl containing one to four nitrogen
atoms, or benzofused nitrogen-bonded 5-membered heteroaryl containing one to three
11
PI External
nitrogen atoms: 5-membered heteroaryl groups which, in addition to carbon atoms, may
contain one to four nitrogen atoms or one to three nitrogen atoms as ring members and in
which two adjacent carbon ring members or one nitrogen and one adjacent carbon ring
member may be bridged by a buta-l,3-diene-l,4-diyl group in which one or two carbon atoms
may be replaced by nitrogen atoms, where these rings are attached 5 to the skeleton via one of
the nitrogen ring members, for example (but not limited to) 1-pyrrolyl, 1-pyrazolyl, 1,2,4-
triazol-l- yl, 1-imidazolyl, 1,2,3-triazol-l-yl and 1,3,4-triazol-l-yl.
6-membered heteroaryl groups which contains one to four nitrogen atoms: 6-membered
heteroaryl groups which, in addition to carbon atoms, may contain, respectively, one to three
10 and one to four nitrogen atoms as ring members, for example (but not limited thereto) 2-
pyridinyl, 3-pyridinyl, 4-pyridinyl, 3-pyridazinyl, 4-pyridazinyl, 2-pyrimidinyl, 4-
pyrimidinyl, 5-pyrimidinyl, 2-pyrazinyl, l,3,5-triazin-2-yl, l,2,4-triazin-3-yl and l,2,4,5-
tetrazin-3-yl; benzofused 5-membered heteroaryl containing one to three nitrogen atoms or
one nitrogen atom and one oxygen or sulphur atom: for example (but not limited to) indol-l15
yl, indol-2-yl, indol-3-yl, indol-4-yl, indol-5-yl, indol-6-yl, indol-7-yl, benzimidazol-l-yl,
benzimidazol-2-yl, benzimidazol-4-yl, benzimidazol-5-yl, indazol-l-yl, indazol-3-yl, indazol-
4-yl, indazol-5-yl, indazol-6-yl, indazol-7-yl, indazol-2-yl, l-benzofuran-2-yl, l-benzofuran-3-
yl, l-benzofuran-4-yl, l-benzofuran-5-yl, 1-benzofuran- 6-yl, l-benzofuran-7-yl, lbenzothiophen-
2-yl, l-benzothiophen-3-yl, l-benzothiophen-4-yl, 1- benzothiophen-5-yl, l20
benzothiophen-6-yl, l-benzothiophen-7-yl, l,3-benzothiazol-2-yl, 1,3- benzothiazol-4-yl, l,3-
benzothiazol-5-yl, l,3-benzothiazol-6-yl, l,3-benzothiazol-7-yl, l,3-benzoxazol-2-yl, l,3-
benzoxazol-4-yl, l,3-benzoxazol-5-yl, 1,3-benzoxazol-6-yl and l,3-benzoxazol-7-yl;
benzofused 6-membered heteroaryl which contains one to three nitrogen atoms: for example
(but not limited to) quinolin-2-yl, quinolin-3-yl, quinolin-4-yl, quinolin-5-yl, quinolin-6-yl,
25 quinolin-7-yl, quinolin-8-yl, isoquinolin-l-yl, isoquinolin-3-yl, isoquinolin-4-yl, isoquinolin-
5-yl, isoquinolin-6-yl, isoquinolin-7-yl and isoquinolin-8-yl. This definition also applies to
heteroaryl as a part of a composite substituent, for example heteroarylalkyl etc., unless
specifically defined elsewhere.
Bicyclic 5-6 heteroaryl systems with one bridgehead (Ring Junction) nitrogen atom
30 containing one to three nitrogen atoms or one nitrogen atom and one oxygen or sulphur atom:
for example (but not limited to) imidazo[1,2-a]pyridine, imidazo[1,2-a]pyrimidine,
[1,2,4]triazolo[1,5-a]pyrimidine, [1,2,4]triazolo[1,5-b]pyridazine, [1,2,4]triazolo[1,5-
a]pyrazine, [1,2,4]triazolo[1,5-a]pyridine, imidazo[1,2-c]pyrimidine, imidazo[1,2-
12
PI External
b]pyridazine, [1,2,4]triazolo[1,5-c]pyrimidine, 1-methyl-1H-indole, imidazo[1,2-a]pyrazine,
pyrazolo[1,5-a]pyridine and [1,2,4]triazolo[4,3-a]pyridine.
The term “aryl” further comprises “arylsulfyl” includes Ar-S(O), wherein Ar can be any
carbocyle or heterocylcle. This definition also applies to alkylsulphinyl as a part of a
composite substituent, for example haloalkylsulphinyl 5 etc., unless specifically defined
elsewhere.
Non limiting examples of “alkylsulfonyl” include but are not limited to methylsulphonyl,
ethylsulphonyl, propylsulphonyl, 1-methylethylsulphonyl, butylsulphonyl, 1-
methylpropylsulphonyl, 2-methylpropylsulphonyl, 1,1-dimethyl ethylsulphonyl,
10 pentylsulphonyl, 1-methylbutylsulphonyl, 2- methylbutylsulphonyl, 3-methylbutylsulphonyl,
2,2-dimethylpropylsulphonyl, 1-ethylpropylsulphonyl, hexylsulphonyl, 1,1-
dimethylpropylsulphonyl, 1,2-dimethylpropylsulphonyl, 1-methylpentylsulphonyl, 2-
methylpentylsulphonyl, 3-methylpentylsulphonyl, 4-methylpentylsulphonyl, 1,1-
dimethylbutylsulphonyl, 1,2-dimethylbutylsulphonyl, 1,3-dimethylbutylsulphonyl, 2,2-
15 dimethylbutylsulphonyl, 2,3-dimethylbutylsulphonyl, 3,3-dimethylbutylsulphonyl, 1-
ethylbutylsulphonyl, 2-ethylbutylsulphonyl, 1,1,2-trimethylpropylsulphonyl, 1,2,2-
trimethylpropylsulphonyl, 1-ethyl-l-methylpropylsulphonyl and 1-ethyl-2-
methylpropylsulphonyl and the different isomers. The term“arylsulfonyl” includes Ar-S(0)2,
wherein Ar can be any carbocyle or heterocylcle. This definition also applies to
20 alkylsulphonyl as a part of a composite substituent, for example alkylsulphonylalkyl etc.,
unless defined elsewhere.
The term “bicyclic ring or ring system” denotes a ring system consisting of two or more
common atoms.
The term “aromatic” indicates that the Hueckel rule is satisfied and the term “non-aromatic”
25 indicates that the Hueckel rule is not satisfied.
The terms “carbocycle” or “carbocyclic” or “carbocyclyl” include “aromatic carbocyclic ring
system” and “nonaromatic carbocylic ring system” or polycyclic or bicyclic (spiro, fused,
bridged, nonfused) ring compounds in which the ring may be aromatic or non-aromatic
(where aromatic indicates that the Huckel rule is satisfied and non-aromatic indicates that the
30 Huckel rule is not satisfied).
13
PI External
The term “aryl” as used herein is a group that contains any carbon-based aromatic group
including, but not limited to phenyl, naphthalene, biphenyl, anthracene, and the like. The aryl
group can be substituted or unsubstituted. In addition, the aryl group can be a single ring
structure or comprise multiple ring structures that are either fused ring structures or attached
5 via one or more bridging groups such as a carbon-carbon bond.
The term “aryl” also comprises “aralkyl” refers to aryl hydrocarbon radicals including an
alkyl portion as defined above. Examples include benzyl, phenylethyl, and 6-napthylhexyl.
As used herein, the term “aralkenyl” refers to aryl hydrocarbon radicals including an alkenyl
portion, as defined above, and an aryl portion, as defined above. Examples include styryl, 3-
10 (benzyl) prop-2-enyl, and 6-napthylhex-2-enyl.
The term “hetero” in connection with rings refers to a ring in which at least one ring atom is
not carbon and which can contain 1 to 4 heteroatoms independently selected from the group
consisting of nitrogen, oxygen and sulfur, provided that each ring contains no more than 4
nitrogens, no more than 2 oxygens and no more than 2 sulfurs.
15 The terms “heterocycle” or “heterocyclic” includes “aromatic heterocycle” or “heteroaryl
ring system” and “nonaromatic heterocycle ring system” or polycyclic or bicyclic (spiro,
fused, bridged, non-fused) ring compounds in which ring may be aromatic or non-aromatic,
wherein the heterocycle ring contains at least one heteroatom selected from N, O, S(0)0-2, and
or C ring member of the heterocycle may be replaced by C(=0), C(=S), C(=CR*R*) and
20 C=NR*, * indicates integers.
This definition also applies to heteroaryl as a part of a composite substituent, for example
heteroarylalkyl etc., unless specifically defined elsewhere.
Any of the compounds according to the invention can also exist in one or more geometric
isomer forms depending on the number of double bonds, chiral center or geometric
25 rearrangement in the compound. The invention thus relates equally to all geometric isomers
and to all possible mixtures, in all proportions. The geometric isomers can be separated
according to general methods, which are known per se by a person ordinary skilled in the art.
14
PI External
The process of the present invention as per a general embodiment relates to an improved
process for the preparation of an aromatic hydroxy compound (Z) (as described herein), using
a decarboxylase enzyme as a catalyst is illustrated in the following Scheme-(I):
wherein D is a carbocycle, heterocycle, 5 aryl, heteroaryl, aromatic or hetero-aromatic ring,
mono or bicyclic aromatic, mono or bicyclic hetero-aromatic;
n= 1-5.
According to one embodiment, the present invention relates to an improved process for the
10 preparation of an aromatic hydroxy compound (Z1) or a salt thereof; represented by the
formula:
comprising the step of contacting the decarboxylase enzyme with the substrate (A1),
represented by the formula:
15
in the presence of carbonate ions or a carbon dioxide (CO2) source; wherein the enzyme is
produced by incorporation of the recombinant pET-30 into the host cell.
In an embodiment, the source of carbonate ions or the carbon dioxide (CO2) source is
20 selected from but is not limited to carbon dioxide gas (CO2), potassium bicarbonate
15
PI External
(KHCO3), ammonium carbonate (NH4CO3), ammonium bicarbonate (NH4HCO3), sodium
bicarbonate (NaHCO3), potassium carbonate (K2CO3), sodium carbonate (Na2CO3).
In one embodiment, the product formed was precipitated by adding suitable quaternary
5 ammonium salts.
In a preferred embodiment, the source of a suitable quaternary ammonium salt is selected
from but is not limited to the tetra-butyl ammonium bromide, tetra-butyl ammonium chloride,
tetra-butyl ammonium fluoride, dodecyltrimethyl ammonium chloride, tetrabutylammonium
10 hydrogensulfate.
In one embodiment, the suitable solvent is selected from but is not limited to protic solvents,
polar aprotic solvents and nonpolar solvents, including aromatic hydrocarbons, chlorinated
hydrocarbons, ethers, aliphatic hydrocarbons, alcohols, esters, ketones, amides, water or
15 mixtures thereof.
In another embodiment, the product formed was precipitated by adding suitable acids
selected from but not limited to inorganic acids (e.g. hydrochloric acid, hydrobromic acid,
sulfuric acid, etc.), organic acids (e.g. formic acid, acetic acid, trifluoroacetic acid, propionic
20 acid, methanesulfonic acid).
In one embodiment, said enzyme is produced by incorporation of the recombinant pET-30
into the host cell such as Escherichia coli.
25
In yet another embodiment, the process may optionally be carried out in the presence of a
suitable buffer selected from but not limited to sodium hydrogen phosphates (NaH2PO4,
Na2HPO4), potassium hydrogen phosphates (KH2PO4, K2HPO4), potassium bicarbonate
(KHCO3), ammonium carbonate (NH4CO3), ammonium bicarbonate (NH4HCO3), sodium
30 bicarbonate (NaHCO3), sodium bisulphite (NaHSO3), ammonium chloride (NH4Cl).
In a preferred embodiment, the present invention relates to an improved process for the
preparation of 2,6-dihydroxy benzoic acid (Z1) as depicted in the below Scheme-(II), by
contacting the 2,6-dihydroxy benzoic acid decarboxylase with the substrate (A1) in the
16
PI External
presence of carbonate ions or a carbon dioxide (CO2) source; wherein the enzyme is produced
by incorporation of the recombinant pET-30a(+) into the host cell such as Escherichia coli.
The process as illustrated in the above scheme-(5 II) comprises dissolving the compound (A1)
in a solvent, followed by its treatment with 2,6-dihydroxy benzoic acid decarboxylase
enzyme in the presence of potassium bicarbonate (KHCO3). The reaction mass was filtered
off and the desired product was isolated with a yield of more than 80% and a purity of > 99%
(HPLC).
10 In one embodiment, the yield of the aromatic hydroxy compound (Z) is in the range of 70 to
98%.
In another embodiment, the purity of the aromatic hydroxy compound (Z) is in the range of
90 to 99%.
In yet another embodiment, the 2,6-dihydroxy benzoic acid decarboxylase (2,6-DHBD)
15 producing gene sequences from Rhizobium sporomusa (MTP-10005 - 984 bp), Rhizobium
radiobacter WU-0108 or Agrobacterium tumefaciens (984 bp) were synthesized and ligated
into a pET-30a-c(+) vector. The obtained plasmids were transformed in a standard
Escherichia coli host (BL21) for overexpression.
20 The 984 bp amino acid sequence corresponds to the 2,6-dihydroxybenzoic acid
decarboxylase depicted below:
----- [atgcaaggcaaggtcgctctcgaagagcatttcgcaatcccggaaacacttcaggattcggccgggttcgtgcccggt
gattactggaaggaactgcagcatcgcctgctcgacattcaggatacgcgcctgaagctgatggatgcgcatggcatcgaaaccatg
25 atcctgtcgctgaatgcgccggcggtgcaggctattcccgacaggaggaaggcgatcgagattgcgcgccgcgccaatgacgtc
ctggctgaagaatgcgcaaagcggccggaccgcttccttgccttcgcagccctgccgttgcaggacccggatgcggc
17
PI External
gaccgaggagcttcagcgttgcgtcaacgatctcggtttcgtcggcgcgctcgtcaacggcttcagccaggagggcgat
ggccagacaccgctatattacgacctgccgcaatatcgtccattctggggcgaggtggaaaagcttgatgtgcctttctatc
tgcatccgcgcaatccgctaccgcaggattcccgcatctatgacggccacccctggctgcttggccccacctgggcgtttg
cgcaggaaacggcggttcacgcgctgcgcctcatggcatcaggcctgttcgacgagcatccgcgcctcaacatcattcttgg
ccatatgggcgagggcctgccctacatgatgtggcgcatcgaccaccgcaatgcctgggtgaagctgccgccgcgctatccggcc5 a
agcgccgtttcatggattatttcaacgagaatttccacatcaccacctctggcaatttccgcacccagaccctgatcgatgccattctgga
aatcggtgccgaccgcatcctgttctccaccgactggcccttcgagaacatcgatcatgcctccgactggttcaacgcgacgagcattg
ccgaggccgaccgggtaaagatcggccgcaccaatgcgcgccgc ctgttcaagctcgacggagcctga] ------------
10 The solvent used during any step of the process [as depicted in the Scheme-(I)/(II)] is
selected from but is not limited to halogenated solvents such as dichloromethane, 4-
bromotoluene, diiodomethane, carbon tetrachloride, chlorobenzene and chloroform; alcoholic
solvent such as methanol, ethanol, isopropanol, t-amyl alcohol, t-butyl alcohol and hexanol;
an ether solvent such as tetrahydrofuran, cyclopentyl methyl ether, 2-methyltetrahydrofuran,
15 diethyl ether and 1,4-dioxane; a ketone selected from methyl ethyl ketone, acetone; an aprotic
solvent such as acetonitrile, N,N-dimethyl formamide (DMF), N,N-dimethyl acetamide,
dimethyl sulfoxide (DMSO) and N-methylpyrrolidone (NMP); an aromatic solvent such as
toluene, xylene and benzene; acetone; water or a mixture thereof, and other polar as well as
non-polar solvents.
20
In one embodiment the carboxylation reaction of the present invention can be carried out in
closed vessel e.g autoclave.
In an embodiment, the carboxylation reaction is optionally performed under pressure
25 condition.
In the context of the present invention, the term “optionally” when used in reference to any
element; including a process step e.g. applying pressure; it is intended to mean that the
reaction is performed in added pressure conditions, or alternatively, the reaction is performed
30 at atmospheric pressure without applying any added pressure on reaction. Both alternatives
are intended to be within the scope of the present invention
The product obtained from the process as depicted in Scheme-(I) or (II) is isolated from the
reaction mixture, and corresponds to any of the steps involving biphasic separation,
18
PI External
separation of organic phase, filtration, evaporation of solvent, cooling, precipitation, washing
and drying.
In an embodiment the 2,6-DHBD enzyme is immobilized.
In the context of the present invention, the term “immobilized”, when used in reference to
any element; including a process step or a product 5 e.g. immobilized enzyme; is intended to
mean the immobilization of the enzyme on an appropriate inert support material. The method
of formation of immobilized enzyme may comprises grafting, physical adsorption, ion-pair
formation, and entrapment.
10 In yet another embodiment, the present invention relates to the use of an immobilized enzyme
as a catalyst for carboxylation reactions; wherein the immobilized enzyme is repeatedly used
for hydrogenation reactions without any activation and the enzyme is produced by
incorporation of the recombinant pET-30a(+) into the host cell such as Escherichia coli.
15 The foregoing definitions provided herein for the terminologies used in the present disclosure
are for illustrative purpose only and in no manner limit the scope of the present invention
disclosed in the present disclosure.
As used herein, the terms "comprises", "comprising", "includes", "including", “consisting” or
20 any other variation thereof, are intended to cover a non-exclusive inclusion, subject to any
limitation explicitly indicated. For example, a process or method that comprises a list of
elements is not necessarily limited to only those elements but may include other elements not
expressly listed or inherent to such process or method.
25 Also, the indefinite articles "a" and "an" preceding an element or component of the present
invention are intended to be nonrestrictive regarding the number of instances (i.e.
occurrences) of the element or component. Therefore "a" or "an" should be read to include
one or at least one, and the singular word form of the element or component also includes the
plural unless the number is obviously meant to be singular.
30
The specification herein and the various features and advantageous details thereof are
explained with reference to the non-limiting examples in the description. Descriptions of
19
PI External
well-known components and processing techniques are omitted so as to not unnecessarily
obscure the embodiments herein. The examples used herein are intended merely to facilitate
an understanding of ways in which the specification herein may be practiced and to further
enable those of skilled in the art to practice the specification herein. Accordingly, the
examples should not be c 5 onstrued as limiting the scope of the specification herein.
Any discussion of documents, acts, materials, devices, articles and the like that has been
included in this specification is solely for the purpose of providing a context for the
disclosure. It is not to be taken as an admission that any or all of these matters form a part of
10 the prior art base or were common general knowledge in the field relevant to the disclosure as
it existed anywhere before the priority date of this application.
The numerical values mentioned in the description and the foregoing claims though might
form a critical part of the present invention of the present disclosure, any deviation from such
15 numerical values shall still fall within the scope of the present disclosure if that deviation
follows the same scientific principle as that of the present invention disclosed in the present
disclosure.
The invention is further illustrated by the following examples which are provided to be
20 exemplary of the invention, and do not limit the scope of the invention. While the present
invention has been described in terms of its specific embodiments, certain modifications and
equivalents will be apparent to those skilled in the art and are intended to be included within
the scope of the present invention.
25 General procedure:
1. Production of enzyme: 2,6-dihydroxy benzoic acid decarboxylase:
wherein the enzyme is produced by incorporation of the recombinant pET-30a(+) into the
host cell such as Escherichia coli.
30 The 2,6-dihydroxybenzoic acid (DHBA) decarboxylase gene from Agrobacterium
tumefaciens was amplified using designed primers and 2,6-DHBA decarboxylase gene from
Rhizobium sporomusa (2,6-DHBD Rs) was synthesized at genscript. The genes were ligated
suitably into a pET vector specifically pET30a (+). The obtained plasmids were transformed
to an E. coli host specifically BL21 (DE3) for over expression.
20
PI External
The over expression of enzyme was performed as follows:
The pre-inoculum was prepared in a 50 mL medium containing Tryptone, sodium chloride,
and yeast extract supplemented with appropriate antibiotics such as kanamycin (20-
80μg/mL). The pre-inoculum was inoculated 5 and incubated at 37℃ for 16 h in an incubatory
shaker. About 0.5-1% v/v of the pre-inoculum was inoculated into 400 mL medium of above
said media composition and incubated in an incubatory shaker until an optical density (OD
600) of 0.6-1.0 was reached. About 0.25-1 mM Isopropyl β- D-1-thiogalactopyranoside
(IPTG) was added for induction and the cells were incubated at 25℃ for 12 to 18 h in an
10 incubatory shaker. The culture was harvested by centrifugation at 5000 – 8000 rpm for 10
min to obtain a cell pellet which was used for carboxylation of resorcinol.
2. Preparation of compound (Z)
3.
15
Recombinant E. coli whole cells (10 g) were re-suspended in a phosphate buffer (100 mL, 50
mM, pH 8.0) supplemented with MgCl2 5-10 mM. To the cell suspension 100 g/L of
compound A, 1-5 equivalent of carbonate source were added. The product formed was
precipitated by adding a suitable quaternary ammonium salt. The product was harvested after
20 completion of the reaction. The reaction mixture was acidified with concentrated
hydrochloric acid (HCl) and extracted twice with organic solvent. The organic layer was
dried over anhydrous sodium sulfate and the solvent was evaporated under reduced pressure
to obtain the desired compound (Z).
25 Examples:
Example-1: Production of enzyme: 2,6-dihydroxy benzoic acid decarboxylase
21
PI External
The overexpression of enzyme was performed as follows:
For pre-inoculum, 50 mL Luria Bertani medium supplemented with appropriate antibiotics
[kanamycin (50 μg/mL)] 2,6-DHBD were inoculated and incubated at 37℃ and 180 rpm for
16 h to obtain pre-inoculum. 1% v/v of the pre-inoculum culture was inoculated into 400 mL
Luria Bertani medium 5 containing kanamycin (50 μg/mL) until an optical densistydensity (OD
600) of 0.6-1.0 was reached. Then 1nM IPTG was added for induction and the cells were left
overnight at 20℃ and 120 rpm. The culture was harvested by centrifugation at 5,000 – 8,000
rpm for 10 min to obtain a cell pellet which was used for carboxylation.
Example-2: Preparation of 2,6-dihydroxy benzoic acid (Z1)
10
Carboxylation of resorcinol: Recombinant E. coli whole cells (10 g) were re-suspended in
phosphate buffer (100 mL, 50 mM) and MgCl2 10 mM. Resorcinol (50 g/l) sodium
bicarbonate (5 Eq.) and tetrabutyl ammonium bromide (TBAB) (1 Eq.) were added to the resuspended
cells and incubated under shaking at 30℃ and pH 8 for 24 h. The reaction mixture
15 was acidified with hydrochloric acid (HCl) and extracted with ethyl acetate (EtOAc). The
organic layer was dried over anhydrous sodium sulfate and the solvent was evaporated under
reduced pressure to obtain 2,6-dihydroxy benzoic acid (yield of 80%, and purity of 99%
(HPLC)).

WE CLAIM:
1. An improved process for the preparation of an aromatic hydroxy compound (Z), using a
decarboxylase enzyme as a catalyst;
5 ,
wherein D is a carbocycle, heterocycle, aryl, heteroaryl, aromatic or hetero-aromatic
ring, mono or bicyclic aromatic, mono or bicyclic hetero-aromatic;
n= 1-5;
comprising the step of contacting the decarboxylase enzyme with the substrate (A),
10 represented by the formula:
wherein, D and n are as described above;
in the presence of a carbonate ion source or a carbon dioxide (CO2) source and a suitable
solvent; wherein said enzyme is produced by incorporation of the recombinant pET-30
15 into the host cell.
.
2. The process as claimed in claim 1, wherein the D represent phenyl ring.
3. The process as claimed in claim 1, wherein said compound of formula Z is Z1 or a salt
thereof:
23
PI External
4. The process as claimed in claim 1, wherein said compound of formula A is A1 or a salt
thereof;
.
5. The process as claimed in claim 1, wherein said process 5 is a process for the synthesis of
compound of formula Z1 or a salt thereof:
comprising the step of contacting the decarboxylase enzyme with the substrate (A1),
.
10 in the presence of a carbonate ion source or a carbon dioxide (CO2) source; wherein said
enzyme is produced by incorporation of the recombinant pET-30 into the host cell.
6. The process as claimed in claim 1, wherein said enzyme is produced by incorporation of
the recombinant pET-30 into the host cell such as Escherichia coli.
7. The process as claimed in claim 1, wherein said process may optionally be carried out in
15 the presence of a suitable buffer as sodium hydrogen phosphates (NaH2PO4, Na2HPO4),
potassium hydrogen phosphates (KH2PO4, K2HPO4), potassium bicarbonate (KHCO3),
24
PI External
ammonium carbonate (NH4CO3), ammonium bicarbonate (NH4HCO3), sodium
bicarbonate (NaHCO3), sodiumbisulphite (NaHSO3), ammonium chloride (NH4Cl).
8. The process as claimed in claim 1, wherein said carbonate ion source or said carbon
dioxide (CO2) source is selected from carbon dioxide gas (CO2), potassium bicarbonate
(KHCO3), ammonium carbonate (NH4CO3), 5 ammonium bicarbonate (NH4HCO3),
sodium bicarbonate (NaHCO3), potassium carbonate (K2CO3) or sodium carbonate
(Na2CO3).
9. The process as claimed in claim 1, wherein said suitable solvent is selected from the
group consisting of protic solvents, polar aprotic solvents and nonpolar solvents,
10 including aromatic hydrocarbons, chlorinated hydrocarbons, ethers, aliphatic
hydrocarbons, alcohols, esters, ketones, amides, water or mixtures thereof.
10. The process as claimed in claim 1, wherein the product formed was precipitated by
adding suitable quaternary ammonium salts.
11. The process as claimed in claim 9, wherein said suitable quaternary ammonium salt is
15 selected from tetra-butyl ammonium bromide, tetra-butyl ammonium chloride, tetrabutyl
ammonium fluoride, dodecyltrimethyl ammonium chloride, or
tetrabutylammonium hydrogensulfate.
12. The process as claimed in claim 1, wherein yield of said aromatic hydroxy compound (Z)
is in the range of 60 to 98%.
20 13. The process as claimed in claim 1, wherein purity of said aromatic hydroxy compound
(Z) is in the range of 90 to 99%.

Documents

Application Documents

# Name Date
1 202217055279.pdf 2022-09-27
2 202217055279-TRANSLATIOIN OF PRIOIRTY DOCUMENTS ETC. [27-09-2022(online)].pdf 2022-09-27
3 202217055279-STATEMENT OF UNDERTAKING (FORM 3) [27-09-2022(online)].pdf 2022-09-27
4 202217055279-Sequence Listing in txt [27-09-2022(online)].txt 2022-09-27
5 202217055279-Sequence Listing in PDF [27-09-2022(online)].pdf 2022-09-27
6 202217055279-PRIORITY DOCUMENTS [27-09-2022(online)].pdf 2022-09-27
7 202217055279-NOTIFICATION OF INT. APPLN. NO. & FILING DATE (PCT-RO-105-PCT Pamphlet) [27-09-2022(online)].pdf 2022-09-27
8 202217055279-FORM 1 [27-09-2022(online)].pdf 2022-09-27
9 202217055279-DECLARATION OF INVENTORSHIP (FORM 5) [27-09-2022(online)].pdf 2022-09-27
10 202217055279-COMPLETE SPECIFICATION [27-09-2022(online)].pdf 2022-09-27
11 202217055279-FORM-26 [25-11-2022(online)].pdf 2022-11-25
12 202217055279-FORM 3 [24-02-2023(online)].pdf 2023-02-24
13 202217055279-Proof of Right [20-03-2023(online)].pdf 2023-03-20
14 202217055279-FORM 18 [30-01-2024(online)].pdf 2024-01-30
15 202217055279-FER.pdf 2025-10-07

Search Strategy

1 202217055279_SearchStrategyNew_E_SearchHistoryENZYMEE_06-10-2025.pdf