Abstract: The present invention provides pluripotent corneal stem cells from limbal biopsies, cultured ex vivo, and isolated and purified by magnetic affinity cell sorting (MACS). These cells possess multilineage differentiation potential and self-renewing capability. They could be propagated in culture, where they continuously produce corneal epithelial cells and other cell lineages from ecotodermal origin, neurons, skin mesodermal origin; osteoblasts, chondrocytes, skeletal muscle cells, adipocytes, cardiomyocytes, endodermal origin, beta islet cells and hepatocytes, and endothelial cells. This data indicates that self-renewing multipotent stem cells persists in limbus of the cornea and that such cells can be induced to become cells of other organs of all lineages. The mutipotential capacity of these cells, their easy isolation and culture as well as their high ex vivo proliferation capacity makes these cells a promising therapeutic tool. Hence, these pluripotent stem cells may provide new insight into therapy of various degenerative diseases.
FORM 2
THE PATENTS ACT, 1970 (39 of 1970)
COMPLETE SPECIFICATION SECTION 10
Pluripoten Stem Cells From Corneal Limbus for
regenerative therapy an intro method of producing a problem of embbronic
RELIANCE LIFE SCIENCES PVT.LTD. an Indian Company having its Registered office at Chitrakoot, 2nd Floor, Shree Ram Mills Compound, Ganpath Rao Kadam Marg, Worli, Mumbai - 400 013, Maharashtra, India.
The following specification particularly describes the nature of this invention and the manner in which it is performed:
orgn 240/mum/2004
19-09-2005
TITLE:
Self-renewing Embryonic like Pluripotent Stem Cells From Corneal Limbus for use in regenerative therapy and method of producing the same.
FIELD OF INVENTION:
The present invention relates to cell replacement therapy with stem cells. More specifically, the present invention relates to isolation of embryonic like pluripotent stem cells from corneal limbus tissuefor use in regenerative medicines. The present invention also describes a culture methodology of embryonic-like pluripotent stem cells isolated from limbal tissue and its differentiation into various committed lineages.
BACKGROUND OF INVENTION
Stem cells are responsible for cellular replacement and tissue regeneration throughout life. Cellular development is accomplished through cellular proliferation; lineage commitment and lineage progression, resulting in the formation of differentiated cell types. This process begins with the embryonic stage when the cells are totipotent and continues through out adult life. As the development progress, the cells proliferate and form three main lineages. They are ectoderm, mesoderm and endoderm. Ectoderm can form the epidermis of the skin, the sense organs, nervous system and spinal cord where as, mesoderm can form smooth muscle, connective tissues, blood vessels, heart, blood cells and bone marrow, reproductive organ, excretory system, striated muscles and skeletal muscles. On the other hand, endoderm can form epithelial linings of respiratory and gastrointestinal tract, pharynx, esophagus, stomach, intestine and other associated organs.
Majority of the cells progress throughout the developmental process differentiation, but a few cells leave this pathway to become reserve stem cells that provide for the continual
2
maintenance and repair of the organs. These reserve stem cells also include some progenitor stem cells and some pluripotent stem cells. Progenitor stem cells although have self-replicating capability but have limited life span and limited to particular lineages. On the contrary, pluripotent stem cells are uncommitted. They are self-renewal and can differentiate into several committed lineages.
Embryonic stem cells (ES cells) are pluripotent cell derived from the inner cell mass of the blastocyst that can be propagated indefinitely in an undifferentiated state. Embryonic stem (ES) cells are taken from the very early stages of embryo development and can give rise to all of the cells of the human body, except placenta and other supportive tissues in the womb. All human beings start their lives from a single cell, called the zygote , which is formed after fertilization. The zygote divides and forms two cells; each of those cells divides again, and so on. Pretty soon, about five days after conception, there is hollow ball of about 150 cells called the blastocyt .The blastocyst is smaller than a grain of sand and contains two types of cells, the trophoblast and the inner cell mass.JEmbryonic stem cells are the cells that make up the inner cell mass. As embryonic stem cells can form all cell types in an adult, they are referred to as pluripotent stem cells. ES cells differentiate into all cell lineages in vivo and differentiate into many cell types in vitro. ES cells have been isolated from humans (Thomson et al, 1998. Embryonic stem, cell lines derived from human blastocysts. Science 282: 1145-1147, Gearhart J, Science 282, 1061-62 (1998)]j.
Adult stem cells are tissue specific stem cells and not pluripotent and are found in the tissues of a fully developed child or adult and can produce a limited number of cell types. Stem cells can also be found in very small numbers in various tissues in the adult body, including haemopoietic (Weissman IL. 2000. Translating stem and progenitor cell biology to the clinic: barrier and opportunity. Science 287:1442-1446), neural (Gage FH, 2000. Mammalian neural stem cells. Science 287, 1433-1438), gastrointestinal (Potten C. 1998. Stem cells in gastrointestinal epithelium: numbers, characteristics and death. Phil Trans R. Soc Lond B. 353:821-830), epidermal (Watt F. 1997. Epidermal stem cell: markers patterning and the control of stem cell fate. Phil Trans. R. Soc. Lond. B.
3
353:831), hepatic (Alison M and SarrafC. 1998. Hepatic stem cells. J. Hepatol 29:678-683), and mesenchymal stem cells (Pittenger et al, 1999. Multilineage potential of adult human mesenchymal stem cells. 284:143-147)., bone marrow stem cells that are found in the marrow of the bone and they give rise to all specialized blood cell types. Adult stem cells have not yet been identified in all vital organs. In some tissues like the brain, although stem cells exist, they are not very active, and thus do not readily respond to cell injury or damage. Scientists are now also exploring ways in which they can induce the stem cells already present to grow and make the right cell types to replace the damaged ones. Questions have been raised about the usefulness of adult stem cells in research and treatment, especially as compared to pluripotent stem cells derived from embryos or fetal tissue. Indeed, there is enormous potential for research using such cells. Human adult stem cells have been isolated from tissues such as blood, brain, intestine, skin, and muscle. Furthermore, some adult stem cells have been shown to be more "plastic" than first thought - that is, some of these stem cells appear to be capable of developing into different kinds of cells than first predicted.
Some studies have suggested that adult stem cells are very versatile and can develop into many different cell types. However, other studies have concluded that adult stem cells are only able to develop into a limited number of cell types related to the tissue that the stem cells originally came from. Although a wealth of information on adult stem cells has already accumulated, scientists still do not understand their specific properties well. Research continues with the hope of one day being able to use these cells to restore or replace damaged tissues or organs.
Compared with ES cells, tissue-specific stem cells as they normally are called as adult stem cells have less self-renewal ability and, although they differentiate into multiple lineages, they are not pluripotent.
There is, however, considerable evidence that adult stem cells may have limited potential compared to pluripotent stem cells derived from embryos or fetal tissue. Human adult stem cells have not yet been isolated from all cell and tissue types, and they have not been shown to be capable of developing into all of the different cell and tissue types of
4
the body. Furthermore, adult stem cells are difficult to obtain, since they are often present in only minute quantities. They are difficult to isolate and purify, and their numbers appear to decrease with age. Moreover, adult stem cells may have more DNA damage, and they appear to have a shorter life span than pluripotent stem cells.
Recently it has become clear that adult mammalian bone marrow contains not one but two ostensibly discrete population of adult stem cells. The first and by far the most fully characterized are the hematopoetic stem cells responsible for maintaining lifelong production of blood cells. The biological characteristics and properties of the second marrow resident population of stem cells, variously termed as bone marrow stromal cells or mesenchymal stem cells are not well understood. However, they were found to have pluripotent properties. These new types of stem cells have been identified from few organs that have capability of self-renewal, are pluripotent and have multi-lineage differentiation potential. Recently, pluripotent cells have been isolated from adult bone marrow (Jiang et al., 2002. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 41-48), liver (Nakauchi et al., 2003 US patent application number 20030186439 ) and mouse inner ear (Li and Heller. 2003 Pluripotent stem cells form the adult mouse inner ear. Nat Med 9: 1293-1299), amniotic fluid (Prusa et al, 2003. Oct-4 expressing cells in human amniotic fluid: New source for stem cell research Human Reproduction 18: 1489-1493). Pluripotent stem cells have also been recently described in many tissues such as skeletal muscle, brain, intestinal epithelium (Howell et al, 2003. Pluripotent stem cells identified in multiple murine tissues. Ann. NY. Acd. Set 996:158-173.).
While these prior art references report the various sources of pluripotent stem cells, none of these cells have shown the characteristics of embryonic like stem cells unlike the bresent invention. Also, these reports unlike the present invention show the pluripotent stem cells differentiate into few lineages. The scientists of the present invention have been successful in its mission of isolating a source of pluripotent embryonic like stem pell, that is safest, easiest and most efficient way of isolating them from corneal limbus
5
tissue. The present invention obviates the problems associated with the conventional sources of isolating the pluripotent stem cells.
The scientists of the present invention have for the first time shown that corneal limbal tissue has also two discrete populations of adult stem cells. The first and by far the mosl fully characterized are the limbal stem cells responsible for maintaining corneal integrity and other has similar characteristics and properties embryonic-like pluripotent stem cells. This is one of the novel features of the present invention in addition to other novel {features of the invention which is discussed in the later portion of the specification.
It is known that stem cells present in corneoscleral limbus has enormous capacity to participate in the dynamic equilibrium of the corneal surface and replace superficial epithelial cells that are shed and sloughed off during eye-blinking.
The normal ocular surface is covered by cornea. Limbal and conjuctival epithelial cells , together with a stable pre-ocular tear film maintain its integrity. Severe damage to the limbal stem cells from chemical or thermal burns, the Steven-Johnson syndrome, ocular cicatrical pemphigoid, contact lenses, severe microbial infection or multiple surgical procedures or cryotherapy in the limbal region, may lead to loss of the corneal and limbal epithelial cells. Disease that destroy limbal epithelial cells can lead to limbal stem cell deficiency and cause photophobia and reduced vision (Anderson DF, Ellies P, Pires RTF, Tseng SCG, 2001. Br J. Opthalmol. 85:567-575).
The cornea is a transparent and avascular tissue and is located at the outer surface of the anterior eye. It provides protection from environmental insult, and allows for the efficient transmission of light into the eye. The cornea is comprised of two main compartments; the anterior non-cornified stratified squamous epithelial layer and the underlying substantia propria. The human cornea harbors three cell types; the corneal epithelial cells, the stromal keratocytes (corneal fibroblast) and underlying layer of stromal associated corneal endothelial cells.
6
Corneal epithelium is a cellular multiplayer, five to seven cells thick which covers the anterior surface of the cornea. It serves to protect the corneal interior from ingress by external agents, and supports the tear film via interactions with mucins on the front surface of the most superficial epithelial cells (Kinosita S, Adachi W, Sotozono C, Nishida K, Yokoi N, Quantock AJ, Okubo K (2001). Characteristics of the ocular surface epithelium. Prog. Ret. Eye Res. 20:639-673.). Ordinarily, a natural turnover of corneal epithelial cells takes place in which superficial epithelial cells are shed from the epithelial surface and replaced by those from below (Thoft RA, Friend J. (1983) The XYZ hypothesis of corneal epithelial maintenance. Invest. Ophthalmol. Vis. Sci 24:1442-1443.). In turn, basal epithelial cells, migrating inward from the periphery, replenish the population of deeper corneal epithelial cells.
The first pointer towards the existence of such slow-cycling cells in the corneal epithelium was provided in the 1980 (Schermer A, Galvin S, Sun TT (1986) Differentiation-related expression of a major 64 K corneal keratin in vivo and in culture suggests limbal location of corneal epithelial stem cells. J cell Biol. 103:49-62; Cotsarelis G, Cheng SZ, Dong G, Sun TT, Lavker RM (1989) Existence of slow-cycling limbal epithelial basal cells that can be preferentially stimulated to proliferate: implications on epithelial stem cells. Cell 57:201-209). Stem cell with their high proliferative capacity, are clearly crucial for maintenance of a viable ocular surface because they provide an unbroken supply of corneal epithelial cells with the appropriate phenotype (Tseng, 1996)., LiDQ., Comparison of protein kinase C subtype expression between normal and aniridic human ocular surfaces: implication for limbal stem cell dysfunction in aniridia. Cornea, March., 15(2):168-178. Chemical burn or other form of inflammatory eye disease may damage this supply process that result in abnormal corneal surface, which cannot normalize without the re-introduction of a source of stem cells (Tseng et al., 1999;). Reconstruction of the conjunctival and corneal surface. Transplantation of amoinitc membrane, Optha;mologe, Dec; 95(12):805-813,. Henderson TR et.al; Identifying the origin of single corneal cells by DNA finger printing :Part II- Application to limbal allografting. Cornea, May 20(4): 404-407
8
Earlier it was known that P-63 is a specific marker for human corneal stem cells. However, this marker also express in other epithelial cells such as skin. Therefore, there is no specific marker for corneal limbal stem cells. Although P-63 expression has been shown to be principally limited to basal limbal region in human corneas, contrary to this, in mouse expression of this transcription factor was both maximum in paracentral cornea rather than limbus (Moore et al., 2002) The corneal epithelial stem cell. DNA and Cell Biology, May., 21 (5-6): 443-451. Currently, there is no definitive stem cell marker for limbal epithelial stem cells exist. Therefore, further research and better stem cell markers are required to ascertain long-term survival of graft.
In order to find out appropriate stem cell marker for limbal epithelial stem cells, we checked a panel of stem cell markers, during which, we identified a population of pluripotent stem cells in the limbal cultures on the amniotic membrane, the origin of which was traced and pluripotency of which was revealed. These cells behave similar to embryonic stem cells, due to their multipotential differentiation capacity. These cells have the ability to form embryoid like bodies (ELBs), and can differentiate into the three germ layers. Hence, we provide a novel method of producing diverse cell types, thus minimizing dependence on human embryonic stem cells. In the present invention, we have for the first time shown that corneal limbal tissue has another population of stem cells other than P-63 positive stem cells, they are not only pluripotent but have capability of self-renewal and can be differentiated into various lineages for use in regenerative therapy.
These unique pluripotent characteristics make these stem cells very promising for supplying cells to treat debilitating diseases like Alzheimer's disease, cancer, Parkinson's disease, type-1 diabetes, spinal cord injury, stroke, burns, heart disease, osteoarthritis and rheumatoid arthritis. Today, donated organs and tissues are often used to replace those that are diseased or destroyed. Unfortunately, the number of people needing transplants far exceeds the number of organs available. Stem cells offer the potential for supplying cells and tissues, which can be used to treat these various diseases. This potential benefit is responsible for the huge amount of interest in stem cell research. The establishment of human pluripotent stem cell lines represents a major step forward in the understanding of human biology. These unique cells have captured the interest of
9
scientists and the public, particularly patients and their advocates. Although such research promises new treatments and, possibly even cures for many debilitating diseases and injuries, including Parkinson's disease, diabetes, heart disease, multiple sclerosis, burns and spinal cord injuries, there are ethical issues related to this and the research need due consideration. Recently, human pluripotent stem cells have been isolated from two sources: the inner cell mass of human embryos at the blastocyst stage and from fetal tissue obtained from terminated pregnancies. Because these cells are capable of limitless division and self-renewal, they can be maintained indefinitely in tissue culture, making them a vital resource for research.
The inventors of the present invention have targeted human corneal limbal tissue as an alternate source of pluripotent stem cells as opposed to other sources as known in the art. The advantage of targeting human corneal limbal tissue as an alternate source of pluripotent stem cells of the present invention is the following:
1. It is easy to obtain the cells from the corneal limbal tissue and requires minor surgery for obtaining the same.
2. It can be propagated up to 100 population doublings without loosing any sternness.
3. It can be differentiated into almost all the lineages of the tissue.
4. Autologous therapy is possible and therefore tissue graft rejection problem is eliminated.
5. It is non-embryonic and hence there are no such ethical issues.
6. Issue of nuclear cloning for therapeutic cloning is also eliminated.
OBJECTS OF THE INVENTION
It is the object of the invention to isolate pluripotent embryonic-like stem cells, derived from adult limbal tissue of eye. The cells are not lineage-committed cells and may be committed to the all the three lineages such as ectoderm, mesoderm and endoderm. It is the object of the invention to provide new population of stem cells derived from corneal limbal tissue that are pluripotent cells, capable of self-renewing and capable of differentiation to cells of all the three lineages such as ectoderm, mesoderm and endoderm. In the present invention, pluripotent embryonic-like stem cells could be able to differentiate into various lineage cell types such as neurons, hepatocytes,
10
cardiomyocytes, beta-islet cells, chondrocytes, adipocytes, osteoblast, myocytes and the like.
It is still an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that develop embryoid like bodies and are able to differentiate into three main lineages such as ectoderm, mesoderm and endoderm.
It is an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that can differentiate into various terminally differentiated cells such as neurons, hepatocytes, cardiomyocytes, beta-islet cells, chondrocytes, adipocytes, osteoblast, myocytes and the like.
It is an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that can directly differentiate into ectoderm, mesoderm and endoderm without the formation of embryoid like bodies.
It is an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that can differentiate into various terminally differentiated cells such as neurons, hepatocytes, cardiomyocytes, beta-islet cells, chondrocytes, adipocytes, osteoblast, myocytes and the like.
It is an object of the present invention to provide a population of pluripotent stem cells having the characteristics ofenibryonic stem cells .Thus they are embryonic like stem cells and isolated from non-embryonic human adult cells or tissue that are capable of self-renewal and has a capacity to differentiate into all the three lineages such as ectoderm, mesoderm and endoderm.
It is an object of the present invention, to provide ex-vivo expansion of corneal epithelial limbal cells obtained by using specific culture conditions. In this specific culture conditions, medium is capable of supporting the proliferation of pluripotent stem cells.
10
It is still an object of the present invention to isolate the pluripotent embryonic like stem cells using MACS that are responsible for maintaining self-renewal capacity.
It is an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that are SSEA-4 positive from limbal cells indicating that they have embryonic stem cell like characteristics.
It is still an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that are CD 73, CD 105, positive indicating that they are of stromal origin.
It is still an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that are CD 34, CD 45, CD 133, CD 106, CD lie, CD 123 and HLA-DR negative indicating that they are not from haematopoietic lineage.
It is still an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that are CD 14 negative however, about 46% of the cells are CD 117 (stem cell factor) and 53% of the cells are CD 54 positive.
It is still an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that are CD 31 positive indicating the expression of PECAM-1.
It is still an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that are positive for OCT-4, Nanog, Rex-1, and TDGF markers. These genes are found to be down regulated upon differentiation.
It is still an object of the present invention to provide a population of isolated pluripotent stem cells with high telomerase activity and normal karyotyping even after 100 population doublings.
11
It is still an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells that can be used for therapeutic pugy sesyfor the treatment of various pathological and cellular dysfunctional diseases, not limited to Alzheimer's disease, cancer, Parkinson's disease, type-1 diabetes, spinal cord injury, stroke, burns, heart disease^osteoarthritis and rheumatoid arthritis.
It is still an object of the present invention to further provide a population of isolated fPluripotent embryonic-like stem cells containing cultures with a medium capable of supporting the proliferation of said stem cells and maintaining the sternness up to 100 population doublings or more.
It is still an object of the present invention to further provide a population of isolated pluripotent embryonic-like stem cells that may maintain high telomerase activity up to 100 population doublings.
It is still an object of the present invention to provide a population of isolated pluripotent embryonic like stem cells with normal karytyging_ during culture and passaging up to 100 population doublings.
SUMMARY OF THE INVENTION
The present invention relates to pluripotent embryonic-like stem cells derived from corneal limbal tissue, having the capacity for self-renewal with the ability to differentiation into cells of all the three lineages such as ectoderm, mesoderm and endoderm.
The present invention further relates to a method of producing a_£opulation_of pluripotent stem cells having the characteristics of embryonic stem cells. Hence they are termed as embryonic like stem cells and are isolated from non-embryonic human adult cells or tissue that are capable of self-renewal and has a capacity to differentiate into all the three lineages such as ectoderm, mesoderm and endoderm. Upon differentiation, they
12.
clusters similar to that of embryoid bodies and also express molecular markers for ectoderm, mesoderm and endoderm and subsequently differentiate into variety of cell types, which include neuronal cells, corneal cells osteoblasts, chondrocytes, adipocytes, cardiomyocytes, myocytes, hepatocytes, and beta-islet cells. This multi-potential capability, easy isolation and culture, and high ex vivo proliferation capacity make these cells a promising therapeutic tool.
The present invention, further relates to ex-vivo expansion of corneal epithelial cells by using specific culture conditions. In this specific culture conditions, medium is capable of supporting the proliferation of pluripotent stem cells using methods well known to those of skill in the art such as magnetic affinity cell sorting (MACS) or fluorescence activated cell sorting (FACS) and the like.
In accordance with the present invention there is provided a process for the culture of corneal limbal epithelial cells in a specific medium for 21 days and subjected to isolation of pluripotent embryonic like stem cells. In particular a, method of producing of pluripotent embryonic-like stem cells comprises the following steps.
1. culturing the corneal limbal biopsy obtained from donor, which is of non-embryonic origin on tissue culture biocoated plates;
2. expanding these corneal limbal cells invitro on an extra-cellular matrix;
3. dissociating these limbal cells with trypsin EDTA for 30 minutes or dispase solutions for 24 hours at 4 °C to give the single cell suspension after 21 days of culture;
4. sorting these pluripotent embryonic like stem cell using fluorescence activated cell sorting (FACS) technique or Magnetic affinity cell sorting (MACS);
5. differentiating pluripotent embryonic like stem cells into various lineages using differentiating agents;
6. characterising differentiated pluripotent embryonic like stem cells using flow cytometry,; molecular analysis and cellular analysis;
14
7. analysing further these pluripotent embryonic like stem cells using karyotyping and telomerase activity tests.
8. maintaining the pluripotent embryonic stem cells containing cultures in the medium capable of supporting proliferation and sternness;
9. cryo-preserving pluripotent embryonic like stem cells in 10% dimethyl sulfoxide (DMSO) or liquid nitrogen and;
10. maintaining the cryopreserved pluripotent embryonic stem cells containing cultures in the medium capable of supporting proliferation and sternness:
11. thawing the cryopreserved pluripotent embryonic like stem cells to room temperature when required, for retaining the pluripotency and differentiation potential.
The above process can alternatively be performed by replacing step (1) to step (4) of the above method by the following steps:
1. culturing the corneal limbal biopsy obtained from donor, which is of non-embryonic origin on tissue culture biocoated plates
2. culturing of these limbal cells for 21 days on extra-cellular matrix;
3. dissociating these limbal cells with trypsin EDTA for 30 minutes or dispase solutions for 24 hours at 4 °C to give a single cell suspension;
4. expanding these corneal limbal cells in vitro on an appropriate extra-cellular matrix;
The invention provides methods for obtaining ex-vivo expanded limbal tissue having at least one-property characteristics of a pluripotent embryonic like stem cells. The method comprises preparing a suspension comprising a population of cells from a tissue, selecting a pluripotent embryonic like stem cells from a cell suspension having at least cellular marker characteristics of pluripotent embryonic-like stem cells, and proliferating said pluripotent embryonic like stem cells.
The invention also provide culturing conditions of pluripotent embryonic-like stem cells in a medium, which maintains the stem cells as a lineage uncommitted cells.
15
The invention also provides culture conditions with specific factors necessary for maintaining the pluripotency of embryonic-like stem cells and characterizing genes so expressed that is responsible for maintaining pluripotency or self-renewal capacity and characterisation of the genes expressed therein.
In one aspect of the present invention, the pluripotent embryonic like stem cells so isolated are SSEA-4 positive from limbal cells indicating that they have embryonic stem cell like characteristics.
In another aspect of the present invention, the pluripotent embryonic like stem cells so isolated are CD 73, CD 105, positive indicating that they are of stromal origin. In another aspect of the present invention, the pluripotent embryonic like stem cells so isolated are CD 34, CD 45, CD 133, CD 106, CD lie, CD 123 and HLA-DR negative indicating that they are not from haematopoietic lineage.
In another aspect of the present invention, the pluripotent embryonic like stem cells so isolated are CD 14 negative however, about 46% of the cells are CD 117 (stem cell factor) and 53% of the cells are CD 54 positive.
In another aspect of the present invention, the pluripotent embryonic like stem cells so isolated are CD 31 positive indicating the expression of PEC AM-1. In another aspect of the present invention, the pluripotent embryonic like stem cells so isolated using MACS are expressing genes that are responsible for maintaining self-renewal capacity.
In yet another aspect of the present invention, the genes that are expressed in the pluripotent embryonic like stem cells so isolated are positive for OCT- 4, Nanog, Rex-1, and TDGF markers. These genes are found to be down regulated upon differentiation. In another aspect of the present invention, the pluripotent like stem cells so isolated show high telomerase activity and normal karyotyping even after 100 population doublings. In another aspect of the present invention, the pluripotent embryonic like stem cells so isolated develop embryoid like bodies and are able to differentiate into three main lineages such as ectoderm, mesoderm and endoderm.
In another aspect of the present invention, the pluripotent embryonic like stem cells develop embryoid like bodies and able to differentiate into committed cells either of ectodermal, mesodermal or endodermal origin. In the present invention, pluripotent
16
embryonic-like stem cells could be able to differentiate into various terminally differentiated cells such as neurons, hepatocytes, cardiomyocytes, beta-islet cells, chondrocytes, adipocytes, osteoblast, myocytes and the like.
In another aspect of the present invention, the pluripotent embryonic like stem cells so isolated can be directly differentiated into neuronal cells, without the formation of embryoid like bodies.
In a further aspect of the present invention, isolated pluripotent embryonic like stem cells
can be used for therapeutic purposes for the treatment of various pathological and cellular
dysfunctional diseases not limited to Alzheimer's disease, cancer, Parkinson's disease,
type-1 diabetes, spinal cord injury, stroke, burns, heart disease, osteoarthritis and
rheumatoid arthritis.
It is still further aspect of the present invention to provide a population of isolated
Pluripotent embryonic-like stem cells containing cultures with a medium capable of
supporting the proliferation of said stem cells and maintaining the sternness up to 100
population doublings or more.
It is still further aspect of the present invention to provide a population of isolated
pluripotent embryonic-like stem cells that may maintain high telomerase activity up to
100 population doublings.
It is still further aspect of the present invention to provide a population of isolated
pluripotent embryonic like stem cells with normal karyotyping during culture and
passaging up to 100 population doublings.
The present invention novel source of deriving pluripotent stem cells from corneal
epithelial stem cells, capable of self-renewing and capable of differentiation to cells of all
the three lineages such as ectoderm, mesoderm and endoderm has the following
advantages:
1. Pluripotent self-renewal, embryonic like stem cells of the present invention are from adult human corneal limbal tissue.
17
2. Pluripotent embryonic like stem cells of the present invention are from non-embryonic non-fetal human tissues, thus having no ethicaj_and-retigions concern.
3. Pluripotent embryonic like stem cells of the present invention have the capability to differentiate into the cells of ectoderm, mesoderm and endoderm origin.
4. Pluripotent embryonic like stem cells of the present invention can be used for the treatment of various debilitating diseases.
5. Pluripotent embryonic like stem cells of the present invention thus can be isolated from the patiejn limib Tissues, propagated, and transferred back to patient after appropriate differentiation as a autologous therapy, thus the acceptability of tissue will be high and rejection problem will be minimal.
BRIEF DESCRIPTION OF DRAWINGS:
The following figures, which are in the form of photographs are part of the present specification and are incorporated to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to these figures in combination with the detailed description presented herein.
Fig 1: This figure shows characterization of Limbal composite grafts. Fig (a) shows H & E staining of Limbal composite graft (whole mount); Fig (b) shows Limbal composite grafts showing positive immunofluoresence for SSEA-4; Fig (c) shows RT-PCR analysis of expression of pluripotent stem cell markers in Limbal composite grafts (LCG). Fig (d) shows Isolation of SSEA-4 positive cells (63%) by MACS.
Fig 2: This figure shows phase contrast micrographic pictures (10X). Fig (a) shows PI5 ELSC's; Fig (b) shows ELSC's in 4 days of suspension culture forming embryoid like bodies (ELBs); and Fig (d) shows initiation of differentiation from the ELB's.
17 17
Fig 3: This figure shows hnmunophenotyping of ELSCs. ELSCs cultured for 20 passages were labelled with FITC-coupled antibodies against SSEA-4, CD105, CD73, CD54 (all positive), CD45, CD34, CD 123, CD 133, CD 123 and HLA-DR (all negative) which emphasizes that the ELSCs maintains the sternness upto passage 20 and are not hematopoetic in origin. Cells were analysed using FACS-calibur.
Fig 4: This figure shows P13 Passage of ELSCs maintains a normal karyotype. Karyotyping was performed using the CYTOVISION software.
Fig 5: This figure shows the gene profiling of undifferentiated stem cell markers like Oct-4, Nanog, Rexl and TDGFlin 5, 10, 15 and 20 passages of the reported pluripotent stem cells. The expression of these markers for " sternness" are compared to the same in hEF and NTERA cells which are used as negative and positive controls respectively. GAPDH, a housekeeping gene is uniformly expressed in all samples which establishes the fact that equal amount of RNA was used for all RT-PCR reactions.
Fig 6: This figure shows the gene expression pattern of undifferentiated stem cell markers like Oct-4, Nanog, Rexl and TDGF1 in the ELSCs (UD) and cells collected on 2d, 4d, 8d, 12d and 14d of embryoid like body formation. In this experiment hEF cells are used as negative control. Again, the uniform expression of the housekeeping gene, GAPDH in all the samples indicates the amount of RNA used for RT-PCR to be quantitatively equal.
Fig 7: This figure shows the gene expression pattern of an unique set of different lineage markers like NFH and Keratin ( Neuroectoderm ), Cardiac-Actin ( Mesoderm ) along with AFP and albumin ( Endoderm ), in the ELSCs (UD) and cells collected on 2d, 4d, 8d, 12d and 14d of ELBs. Here, we have used (-)RT product as negative control and suitable positive controls in different PCR reactions, viz: Fetal-brain tissue extract for neuroectodermal lineage, Fetal-heart tissue extract for mesodermal lineage and Fetal-liver tissue extract for endodermal lineage.
Fig 8: This figure shows the gene expression pattern of another set of markers like PECAM ( Endothelial), Collagen I and KGF( Stromal cell )and p63 ( Corneal epithelial
18
stem cell marker) in ELSCs (UD) and cells collected on 2d, 4d, 8d, 12d and 14d of ELBs. We have used (-)RT product as negative control and suitable positive controls in different PCR reactions, viz: Fetal-heart tissue extract for endothelial lineage, hEF cells for Stromal cell markers and limbal tissue extract for corneal epithelial stem cell marker.
Fig 9: This figure shows Immunological characterization of neurons generated from ELSCs through formation of ELBs (10X). Neuronal cells showing positive (green) Immunofluoresence for various neuronal markers viz. BetaHI Tubulin, NFH, Oligodendrocyte, Glutamate, GABA, TH and Serotonin with and without nuclear staining (DAPI).
Fig 10: This figure shows functional characterization of cells from different lineages. Figure (a) shows initaitaion of differentiation from ELBs; Figure (b) shows Von Kossa staining of 17 day osteoblasts showing abundunt calcium deposits in form of deep brown bodies; Figure (c) shows Alcian Blue staining of 17 day chondrocytes showing sulfated proteoglycan deposits; Figure (d) shows Oil Red-0 staining of 12 day adipocytes showing abundunt deposits of lipid droplets; Figure (e) shows immunological characterization of 21 day hepatocytes (oval shaped) using anti-CK18 antibody, showing positive green fluorosence; Figure (f) shows 14 day Pancreatic Beta-islet cell showing positive green immunofluoresence after staining with anti-PDX-1 antibody.
Fig 11: This figure shows RT-PCR analysis for expression of cardiomyocyte specific markers in ELSCs and differentiated cells from ELBs. Cardiac- actin and Na-Ca-Exchanger is comprehensively expressed in the differentiated cells. Here, GAPDH is used as a positive control.
Table 1 provides the details of the molecular markers used for gene expression profiling of the embryoid like bodies at different stages.
Table 2 shows the levels of gene expression for an exclusive set of pluripotent stem cell markers with the P5, P10, P15 and P20 passages of reported embryonic like stem cells. NTERA and hEF cells were used as positive and negative controls.
19
Table 3 shows the gene expression profiling of the array of pluripotent stem cell markers with the undifferentiated cells (UD), 2d, 4d, 8d, 12d and 14d of embryoid like bodies compared to the negative control (hEF), in a tabular form with proper quantitative details.
Table 4 This table shows the gene expression profiling of an unique set of a variety of lineage markers with the undifferentiated cells (UD), 2d, 4d, 8d, 12d and 14d of embryoid like bodies compared to the negative control (hEF), in a tabulated manner with intricate details on the quantitative expression pattern.
if
Table 5 This table provides the details of antibodies and their working dilutions.
Table 6 This table gives the details of the primers used for the molecular characterization.
DETAILED DESCRIPTION:
Other embodiment of the invention will be apparent from the description that follows:
Definitions:
As used herein the term "pluripotent embryonic like stem cells" refer to a cell that is not derived from inner cell mass of blastocyst stage embryo and are capable of self-regeneration and capable of differentiation to cells of all the three lineages such as ectoderm, mesoderm and endoderm. The pluripotent embryonic like stem cells in the present invention are lineage uncommitted means they are not committed to particular germ lineage such as ectoderm, mesoderm and endoderm.
As used herein the term "limbal cells" are the cells from limbus of the eye. Limbus contain majority of the stem cells that help in natural turnover of corneal epithelial cells
20
in which superficial epithelial cells are shed from the epithelial surface and replaced by those from limbus.
As used herein the term "Pluripotent cells" refer to a cells that have complete differential plasticity. That means the cells have a capacity to develop into any of the mammalian organ cells. A pluripotent cells can be self-renewing and can remain dormant or quiescent within the tissue.
As used herein the term "embryoid like bodies" refer to an aggregation of differentiated or undifferentiated pluripotent embryonic-like stem cells surrounded by primitive endoderm generated in suspension culture. Embryoid like bodies contain cells of all three lineages that are ectoderm, mesoderm and endoderm. Mouse embryonic stem cells have been studied for approximately 20 years. When mouse stem cells are placed in culture, they develop into 'embryoid like bodies' containing cells characteristic of the three primitive layers of the embryo: endoderm, mesoderm, and ectoderm. In the embryo, each of these layers gives rise to a different set of tissues.
About six years ago, primate (rhesus monkey) embryonic stem cells were isolated. These stem cells did not readily develop into mature embryoid like bodies, so it was uncertain how useful human stem cells would be. However the results have shown that human embryonic stem cells behave in culture like mouse embryonic stem cells. In mature human embryoid like bodies, it is possible to discern cells bearing markers of various cell types: neuronal cells, haematopoietic cells, liver cells, cardiac muscle cells. Some cells appearing in mature embryoid like bodies behave functionally like differentiated cells. For example, active cardiac muscle cells can cause an embryoid body to pulsate. The aim is thus to control embryonic stem cell differentiation so that we obtain the cell types we need to treat specific conditions. In the present invention, pluripotent embryonic-like stem cells also develop similar kind of embryoid like bodies as developed by human embryonic stem cells.
21
As used herein the term "differentiation" refers to as a process whereby undifferentiated embryonic stem cells acquire a state where cells are more specialized and has characteristics of special tissues. These special tissues show the expression of tissue specific proteins by using tissue specific antibodies.
As used herein the term "growth factor" refers to as proteins that bind to receptors on the cell surface with the primary result of activating cellular proliferation and differentiation. Many growth factors are quite versatile, stimulating cellular division in numerous different cell types, while others are specific to particular cell types. In the present invention growth factors used are specific to pluripotent embryonic-like stem cells and its differentiation into various lineages such as neurons, hepatocytes, cardiomyocytes, beta-islet, chondocytes, osteoblast, myocytes and the like.
DETAIL DESCRIPTION OF THE INVENTION:
The scientists of the present invention have discovered the pluripotent embryonic like stem cells derived from limbus of the cornea. The present invention provides for the first time, the isolation of pluripotent embryonic-like stem cells from corneal epithelial limbal cells, capable of self-renewing and capable of differentiation into the cells of all the three lineages such as ectoderm, mesoderm and endoderm. To the knowledge of the scientist there has been no public report of such a source of pluripotent embryonic-like stem cells derived from corneal epithelial limbal cells, having the capacity of self-renewal and capable of differentiating into the cells of all the three lineages such as ectoderm, mesoderm and endoderm.
The present invention provides a method of producing a population of pluripotent embryonic like stem cells of non embryonic origin derived from adult human tissue.
According to the method of the present invention, embryonic like stem cells are isolated from a limbal tissue. Approval of Institutional Ethics Committee has been sought before initiating the project. Consent of each donor has been taken. Small limbjjjbiopsy of 2-3
22
mm is removed surgically from superior or temporal quadrant of the corneal surface from donor' s_eye. The biopsy thus excised is then immediately put in 2 ml of transport medium in transport vial and transported to the main cGMP laboratory for the further processing. Limbal biopsy is washed several times preferably 4-5 times with the washing medium and put for enzymatic digestion. Here, enzymatic digestion is carried out by treatment with either dispase or trypsin-EDTA. Single cell suspension is achieved and then seeded on the tissue culture grade plastic_dish.
Alternatively, the explants are subjected to dry incubation for 5 minutes on the biocoated tissue culture plate. The explants are placed in a circular fashion on the tissue culture dish with small drop (200 jul) of culture medium for 2hrs at room temperature, so that they stick to the bio-coated tissue culture surface. Next day, 2 ml of medium is gently added and incubated for 4-5 days at 37°C in C02 incubator with alternate day change of medium. The medium used for culture of limbal cells is DMEM:F-12 (1:1) supplemented with the growth factors. The growth factors used for the culture are selected from the group of EGF, basic FGF, LIF, insulin, sodium selenite, human transferrin, and human Leukemia inhibitory factor (hLIF) and the like or the combinations thereof.
Alternatively, the limbal culture can be carried out on extra-cellular matrices from the group consisting of matrigel, fibronectin, laminin, Platelet derived growth factor (PDGF), or collagen IV alone, human amniotic membrane or the like or in combination thereof, preferably human amniotic membrane.
Pluripotent embryonic like stem cells obtained in accordance with the methods of the present invention may include pluripotent cells that are self-renewing, lineage uncommitted and remain quiescent within the limbal tissue.
In the preferred embodiments, cells cultured on the bio-coated dish or on amniotic membrane are trypsinized with trypsin-EDTA and pluripotent embryonic-like stem cells are isolated using methods well known to those of such in the art, such as magnetic affinity cell sorting (MACS), fluorescence activated cell sorting (FACS) or the like.
23
By the present invention, cells are characterized for limbal stem cell markers and found P-63_positive. The present invention thus, provides that the populations of stem cells are mixed population of limbal stem cell and pluripotent embryonic-like stem cells.
The present invention also provides a method of isolating mixed population of stem cells from limbal tissues. In one aspect of the embodiment, the two populations are physically mixed. In another aspect of embodiment the mixed population of stem cells are treated with cytokines and growth factors so as to proliferate them. In another aspect of invention, one population of stem cells is P-63 positive and another population is pluripotent embryonic-like stem cells. Pluripotent embryonic like stem cells are_SSEA-4 positive and separated and isolated by MACS. Thus, pure populations of SSEA-4 positive cells were obtained from mixed population of stem cells.
Pluripotent embryonic-like stem cells isolated from the limbal cultured cells are viable. Limbal epithelial cells are sorted using stem cell surface markers such as stage specific embryonic antigen marker-4 (SSEA-4) using MACS yielding_about 40-70% of the pluripotent embryonic-like stem cells from the total cultured cells.
In the preferred embodiments, SSEA-4 positive cells are then cultured on extra-cellular matrix coated petri dishes. The extra-cellular matrices are matrigel or fibronectin, laminin, Platelet derived growth factor (PDGF), and collagen IV or the like or the combinations thereof.
The SSEA-4 positive cells are cultured in DMEM:F-12 medium supplemented with either singly or in combination of growth factors selected from EGF, basic FGF, LIF, insulin, transferrin, sodium selenite and fibronectin. SSEA-4 positive cells are serially passaged for 100 population doublings and frozen for further use without any loss of differential potential. Telomerase activity was detected till the last passage.
24
Pluripotent embryonic-like stem cells containing cultures may further provide that the medium used for the culture is capable of supporting the proliferation of said stem cells and maintaining the sternness up to 100 population doublings or more.
In another embodiment, pluripotent embryonic-like stem cells may further provide that the cells maintain high telomerase activity up to 100 population doublings.
In another embodiment, pluripotent embryonic like stem cells also shows normal karyotyping during culture and passaging up to 100 population doublings.
As disclosed above, the pluripotent embryonic like stem cells of the present invention are SSEA-4 positive, but negative for CD 34, CD 45 and CD 14 markers and found positive for CD 73 and CD 105.
In the present invention, the pluripotent embryonic like stem cells so isolated are also checked for CD34, CD45, CD133, CD106, CDllc, CD123 and HLA-DR and found negative.
In the present invention, the pluripotent embryonic like stem cells so isolated are CD 14 negative however, about 46% of the cells are CD117 (stem cell factor) and 53% of the cells are CD54 positive.
According to the present invention, populations of pluripotent embryonic-like stem cells are positive for OCT-4, Nanog, TDGF, UTX-1, FGF-4, Sox 2, Rex 1 and all other markers for undifferentiated cells.
Preferred embryonic-like stem cells obtained by the method of the invention are identified for CD 73 and CD 105, SSEA-3, SSEA-1 markers and they are positive for CD73 and CD105, SSEA-3 but negative for SSEA-1. Such cell surface markers are routinely determined at every passage according to methods well known in the art. For example, fluorescent activated cell sorting (FACS) and immunofluorescence.
25
In another embodiment of the present invention, the pluripotent embryonic like stem cells so isolated are CD 31 positive indicating the expression of PECAM-1.
In another embodiment, isolated pluripotent embryonic-like stem cells are identified and characterized by embryoid like bodies formation and capable of differentiation to cells of ectodermal, mesodermal and endodermal lineages.
In the preferred embodiment, pluripotent embryonic like stem cells obtained by this method of the present invention are identified for differentiated cells after forming embryoid like bodies and are capable of showing ectoderm, mesoderm and endoderm origin gene expression.
The embryonic-like stem cells obtained by the methods of the present invention are induced to differentiate along specific cell lineages. That includes the cells lineages like neurons, cardiomyocytes, endothelial cells, hepatocytes, beta-islet cells, chondrocytes, adipocytes, osteaoblast, myocytes and hematopoietic cells and the like.
In the present invention differentiation agents used for inducing differentiation of pluripotent embryonic-like stem cells are either, acidic FGF, basic FGF, PDGF, insulin, retinoic acid, transferrin, Insulin-transferrin-selenious acid (ITS), dexamethasone, sodium butyrate, DMSO, NGF, Cytosine beta-d-Arabino Furanoside (Ara C), GDNF, TGF-p3, ascorbic acid, N-acetyl Cysteine, dibutaryl cyclic AMP, Neurturin, TGF-pl, IGF-I, IGF-II, EGF, BMP-2, p glycerophosphate, ascorbic acid 2 phosphate, 5-Aza-deoxy-cytidine, oncostatin, HGF, progesterone, nicotinamide or the like or the combination thereof.
In the present invention, extra-cellular matrices used for inducing differentiation of pluripotent embryonic-like stem cells are matrigel, laminin, collagen-IV, poly-L-lysine, gelatin, poly-L-ornithin, fibronectin or the like or the combination thereof.
26
In the present invention, media used for inducing differentiation of pluripotent embryonic like stem cells are either, DMEM, DMEM-F-12, MCDB, Neurobasal medium, neurturin, B-27 or the like or the combination thereof.
In the present invention, differentiated cells are determined by accomplished methods well known in the art. For example, determination of differentiated cells is accomplished either by flow cytometry, immunochemistry, gene expression by molecular markers using RT-PCR, HPLC.
In one embodiment, pluripotent embryonic-like stem cells are induced to differentiate into neurons. Pluripotent embryonic-like stem cells are differentiated into embryoid like bodies for 4-14 days and later embryoid like bodies are induced to differentiate into neurons by culturing into neurobasal medium supplemented with B-27, N2, insulin-transferrin and selenite in the presence of retinoic acid, basic FGF, Ara C.
In another embodiment, pluripotent embryonic-like stem cells are induced to differentiate into hepatocytes by inducing pluripotent embryonic-like stem cells into embryoid like bodies for 4-14 days. Embryoid like bodies are differentiated into hepatocytes by inducing with acidic FGF, basic FGF, HGF, oncostatin, dexamethasone, insulin, transferrin- selenious acid (ITS), DMSO, 5-azacytidine, sodium butyrate or the like or the combination thereof.
In another embodiment, pluripotent embryonic-like stem cells are differentiated into cardiomyocytes by differentiating from 4-14 days of embryoid like bodies with TGF-f} 1, IGF-I, IGF-II, BMP-4, basic FGF, FGF-4, PDGF-BB, 5-aza-deoxycytidine, insulin, EGF, or the like or the combination thereof..
In another embodiment, pluripotent embryonic-like stem cells are differentiated into beta-islet cells either directly or by differentiating from 4-14 days of embryoid like bodies with N2,B27,nicotinamide, basic FGF, TGF-pl, or the like or the combination thereof.
27
In another embodiment, pluripotent embryonic like stem cells either differentiate directly or differentiate from 4-14 days of embryoid like bodies to chondrocytes by inducing them with TGFp3, ascorbic acid 2 phosphate, or the like or the combination thereof.
In another embodiment, pluripotent embryonic like stem cells either differentiate directly or differentiate from 4-14 days of embryoid like bodies to Osteoblast by inducing them with dexamethasone, (3- glycerophosphate, and ascorbic acid 2 phosphate, hydrocortisone or the like or the combinations thereof.
In another embodiment, pluripotent embryonic like stem cells either differentiate directly or differentiate from 4-14 days of embryoid like bodies to adipocytes by inducing them with dexamethasone, isobutylmethylxanthine (H3MX), indomethacin, and insulin or the like or the combinations thereof.
In another embodiment, pluripotent embryonic like stem cells either differentiate directly or differentiate from 4-14 days of embryoid like bodies to myocytes with 5-Azacytidine.
In another embodiment, pluripotent embryonic like stem cells either differentiate directly or differentiate from 4-14 days of embryoid like bodies to myocytes withPDGF-BB.
The present invention also provides a method of cryopreservation of pluripotent embryonic like stem cells in 10% dimethyl sulfoxide (DMSO).
The present invention also provides a method of long-term storage of the cultured cells in the liquid nitrogen.
The present invention also provides the possibilities for therapeutics and diagnostic use of the pluripotent embryonic like stem cells due to the fact that the pluripotent embryonic like stem cells are isolated from non-embryonic tissues and from adult human tissues that are capable of self-renewal and self-regeneration and differentiate into any of the germ lineages such as ectoderm, mesoderm and endoderm.
28
The present invention thus, contemplates the use of pluripotent embryonic stem cells for cell based therapies. As reported in the literature, the ability to regenerate human tissues that are substantially damaged due to diseases or injury is reduced significantly in adult.
Therefore, in the present invention following four prong strategies have been adopted:
1. Collection of the limbus from corneal region and culture limbal cells on appropriate extra-cellular matrix.
2. Isolation of the pluripotent embryonic-like stem cells
3. Differentiation of the pluripotent embryonic-like stem cells into particular lineage
4. Transplantation of the terminally differentiated cell lineage into the patient's organ.
Pluripotent embryonic-like stem cells of the present invention may be induced to differentiate into particular cell lineages either, in vitro and in vivo where pluripotent embryonic-like stem cells may be injected directly into damaged organ for the repair of injury. Such injury may be due to various disorders for example neuro-degenerative diseases, myocardial infarction, diabetes etc. Neuro-degenerative diseases includes stroke, spinal cord injury, Parkinson's disease, Alzheimer disease, multiple sclerosis and the like..
As mentioned above, the pluripotent embryonic-like stem cells of the present invention is derived from the corneal limbus and has unique capability to differentiate into the cells of all the three germ cell lineages such as ectoderm, mesoderm and endoderm. The capability for such differentiation either, in vitro or in vivo may be utilized in transplantation as cell replacement therapy or tissue regeneration.
29
Stem cells for screening bioactive molecules of therapeutic potential:
Another aspect of the present invention provides differentiated cells preferably neuronal cells, corneal cells, osteoblasts, chrondocytes, adipocytes, beta-islet, cardiomyocyte, hepatocyte, from human corneolimbal stem cells that can be used to screen the various biological active molecules present in the plant, plant-based extracts, and synthetic sources. The screening method can be used to develop drug molecules for various diseases, preferebly but not limited to Parkinson's diseases, Alzheimer's disease, Huntington disease, heart, diabetes, liver disease, and muscle diseases.
The cell lines derived from the present invention can be used for generating both polyclonal and monoclonal antibodies of both research and therapeutic potential, preferably for generating humanized monoclonal antibodies for the treatment of various diseases and disoders.
The differentiated cells, prefereably neuronal cells, beta-islets, cardiomyocyte, hepatocyte, corneal cells, osteoblasts, chrondocytes, adipocytes from human corneolimbal stem cells can be used for generating human body organs by 3-D reconstruction, preferably the human brain can be reconstructed by 3-D culturing of the neurons derive from human corneolimbal stem cells. Similarly, other human body organs or parts such as liver, heart, eye, ear etc can be designed and reconstructed from the pluripotent corneolimbal stem cells.
The cell lines derived by the present invention can be used as a carrier vehicle for various therapetically active molecules or genes to be delivered at various sites of human body, prefereably the cells can genetically manipulated as per the requirement and can be delivered to the target site with precise location for gene therapy.
In particular and non-limiting examples, these pluripotent embryonic-like stem cells may be useful as a cell source by deriving endoderm lineages for gastrointestinal tract, stomach, intestine, esophagus, salivary gland, lung, liver, respiratory tract and the like..
30
These cells are also useful as a cell source by deriving ectoderm lineages for skin, neurons, spinal cord, brain cells etc. These cells are also useful as a cell source by deriving mesoderm lineages for heart, blood cells, blood vessels, myocardium, bone marrow, striated muscles, skeletal muscles, reproductive organs and kidney and renal cells.
The present invention also provides the possibility of using pluripotent embryonic-like stem cells and its unique capability to differentiate into the cells of all the three lineages such as ectoderm, mesoderm and endoderm and their further differentiation into various lineages for pharmaceutical interventions and for human based cell assays for drug discovery and drug testing.
EXAMPLES:
The following example is intended to illustrate the invention but do not limit the scope thereof.
In the following example, inventors of the present invention are able to show that pluripotent embryonic-like stem cells derived from limbus can differentiate into various lineages.
EXAMPLE-1
COLLECTION OF LIMBAL BIOPSY:
Institutional Review Board approval was obtained before initiation of the procedure. Informed consent was also obtained from each patients and donors, and all human subject were treated according to the Helsinki Accord. 2-3 mm of limbal biopsy of the donor eye is collected surgically from superior or temporal quadrants of the corneal surface by lamemmar keratectomy as these two loci are found to be rich in stem cells. Biopsy thus excised is then immediately put in the 2-ml transport vial having transport medium in it.
31
Limbal biopsy is taken from the donor's healthy eye and transported to the laboratory in the transport medium that consists of Dulbecco's modified Eagles Medium (DMEM) and Ham's F-12 (DMEM:F-12; 1:1) and supplemented with 5% fetal bovine serum (FBS) or 5% human serum collected from cord blood, dimethyl sulphoxide (DMSO) 0.5%, recombinant human epidermal growth factor (rhEGF) 2 ng/ml, insulin 5 transferrin 5 sodium selenite 5 hydrocortisone 0.5 ug/ml, cholera toxin A
0.1 nmol/1, gentamycin 50 and amphotericin B 1.25 Blood sample from
each donor is collected and transported along with limbal biopsy to centrally located cGMP facility. Blood sample is immediately sent for infectious disease diagnostic tests. Infectious diseases diagnostic tests includes, Hepatitis B virus (HBV), Hepatitis C virus (HCV), Syphillis and CMV.
EXAMPLE-2
PREPARATION OF EXTRA-CELLULAR MATRIX:
In the present invention suitable extra-cellular carrier matrices such matrigel, human amniotic membrane, fibrinogen, PDGF, laminin, EGF, collagen V or human amniotic membrane was treated with attachment factors such as laminin, collagen V, PDGF, EGF, fibrinogen singly or in combinations and growth factors such as epidermal growth factor (EGF), insulin-like growth factor-1 (IGF-1), insulin singly or in combinations. However, extra-cellular matrix carrier is preferably matrigel.
Preparation of Matrigel Coated Plates:
To prepare Matrigel aliquots, Matrigel was slowly thawed at 4°C overnight to avoid the formation of gel. After complete thawing, 10 ml of cold knockout DMEM was added to the bottle containing 10 ml Matrigel. Mixture was then kept on ice and mixed well.Mixture was then aliquoted and stored in -20°C until use for coating the plates.
For coating the plates, Matrigel aliquot was slowly thawed at 4°C for atleast 2 h to avoid the formation of a gel. Matrigel aliquot was diluted 1: 15 in cold knockout DMEM. 1 ml of Matrigel solution was then added to each plate to coat 35 mm or 60 mm plates. Plates were incubated for 1-2 h at room temperature or at least overnight at 4°C. Matrigel was removed before use, and the plates were washed with knockout DMEM and ready for seeding the cells.
Preparation of Amniotic Membrane:
In the present invention, human placental membrane is collected from elective cesarean operation and transported to the laboratory in the transport medium. The transport medium consists of Dulbecco's phosphate buffered saline (DPBS) supplemented with penicillin and streptomycin 50 unit/ml, neomycin 100 and amphotericin B 2.5
Hg/ml. Placental membrane is transported to the laboratory within 3 hours of surgery. Blood samples from each donor is collected and sent for infectious disease diagnostic test.
Placenta is then washed with washing medium so as to remove the mucus and blood clots. Washing medium composed of Dulbecco's phosphate buffered saline (DPBS) is supplemented with penicillin and streptomycin 50 unit/ml, neomycin 100 and
amphotericin B 2.5 Placental tissue is then cut off from the amniotic membrane
using sterile scissors. Amniotic membrane is washed thoroughly at least 7 times to remove all the blood clots from it. Chorion is peeled off from the amniotic membrane with the blunt forceps. Epithelial side is then washed 5 times with the washing medium. Amniotic membrane is then stuck on to the sterile nitrocellulose membrane with epithelial side up. Mounted placenta on nitrocellulose membrane is cut in to 5 cm x 5 cm area and each of them are placed in a cryo-vials filled with the freezing medium. Freezing medium consists of 50% glycerol in DMEM. Entire batch of placenta is then stored at -80°C. Sterility, mycoplasma and endotoxin of each batch of processed placenta is checked before using it for limbal culture.
33
For culture of limbal cells, amniotic membrane is thawed at room temperature for 20 minutes. Amniotic membrane is then removed carefully from nitrocellulose membrane without tearing the surface with the help of blunt forceps. Amniotic membrane is then placed on sterile glass slide in a 100 mm petri plate. 1-1.5 ml of trypsin is then added to cover amniotic membrane and incubated at 37°C for 30 minutes. Epithelial layer of the placenta is then scraped off with the help of cell scrapper under sterile aseptic conditions. Amniotic membrane is then washed 3 times with washing solution. In the present invention, processed and treated amniotic membrane that is used as a extra-cellular carrier matrix, is placed in the culture insert having 0.4 uM track-etched polyethylene terephthalate (PET) membrane. Processed human amniotic membrane is fastened to the cell culture insert membrane using either number 10 Ethilon non-absorbent suture. In the present invention, processed and treated amniotic membrane that is used as a extra¬cellular matrix, alternately is placed on the culture insert from outside after removing 0.4 uM track-etched polyethylene terephthalate (PET) membrane by surgical blade and fitted with medical grade silicon O ring so as to fasten the amniotic membrane to the cell culture insert.
Amniotic membrane is spread in such a way that the denuded epithelial side faces the inner side of the insert and stromal side faces out of the insert. Amniotic membrane is streched uniformly and O-ring is then inserted from the bottom to hold the amniotic membrane securely. Alternately we can also suture the amniotic membrane to the basement membrane of the insert. Entire set-up in culture medium in a 6-well dish is then incubated for at least 2 hours. After 2-hours, entire culture medium is then removed and pre coated with laminin, fibrinogen or collagen TV alone or in combination. Amniotic membrane is then washed two times with culture medium and again incubated in culture medium for 30 minutes. Amniotic membrane is then ready for culturing limbal stem cells.
34.
EXAMPLE-3
CULTURING AND CHARACTERISING LIMBAL CELLS:
Location of Stem Cells:
It has been observed that any tissue undergoing repairs have connective or stromal tissue compartment, and also has resident population of mesenchymal stem cells. Corneal limbus has essentially two types of cells and segregated into two zones and that is based on stem cell population. The top layer of limbus has corneal epithelial stem cells and at basal layer there is stromal cells. Top layer of the limbus are essentially corneal epithelial stem cells and are P-63 positive and basal layer is all stroma and has predominantly pluripotent embryonic-like stem cells. We have found such pluripotent embryonic-like stem cells for the first time in the limbus and they are predominant to the tune of 70%.
Culturing of limbal tissue
Limbal biopsies were washed several times with culture medium. Biopsies were then trimmed of any sclera and conjunctiva tissues and cut into 6-7 pieces. Entire limbal biopsy tissue pieces were then cultured on matrigel coated plates. Alternatively, biopsies were enzymatically treated. Enzymatic treatment were either given by 0.25% trypsin-EDTA for 30 minutes or by dispase overnight at 4°C. Epithelial layer was removed using blunt forceps and entire epithelial layer and stromal cells were cultured separately on Matrigel coated 35 mm plate in the culture medium. Single cell suspension of these cells is also used on several occasions without any compromising in culture quality. Culture medium consists of Dulbecco's modified Eagles Medium (DMEM) and F-12 (DMEM:F-12; 1:1) and is supplemented with 10% knock out serum or 10% heat inactivated human serum collected from cord blood, dimethyl sulphoxide (DMSO) 0.5%, recombinant human epidermal growth factor (rhEGF) 2 ng/ml, insulin 5 ng/ml, transferrin 5 (ig/ml, sodium selenite 5 u-g/ml, hydrocortisone 0.5 [ig/ml, basic fibroblast growth factor (bFGF) 4 rig/ml, human leukemia inhibitory factor (hLIF) 10 r|g/ml, gentamycin 50 ug/ml and
35
amphotericin B 1.25 ug/ml. Entire culture is carried out at 37 C in an atmosphere of 5% C02 in air for 7-21 days or till the cells get confluent. Medium is changed every alternate day.
Characterization of limbal cells:
The limbal cells were characterised by showing positive (green) immunofluoresence to SSEA -4 antibody as well as by Flow cytometry. Molecular characterizarion was done by RT-PCR analysis which shows positive signals for OCT-4, Nanog and Rex-1, which establishes the pluripotency of the limbal cells at this stage. (Fig 1)
EXAMPLE-4
ISOLATION OF PLURIPOTENT STEM CELLS:
After 7-21 days of limbal cell culture, the cells are subjected to magnetic affinity cell sorting (MACS). Cells are dispersed with 0.05% trypsin-EDTA. The action of the trypsin is neutralized by adding an equal amount of culture medium that contained trypsin inhibitor or fetal calf serum. The cells are pipetted out into single cell suspension. Cells are counted using hemocytometer and resuspended per 107 cells in 200 JLXI of PBS. Cells are then cultured for 30 min. at 4°C with 1 .1 of primary antibody SSEA-4. The cells are washed twice to remove unbound antibody. 20 ul of secondary antibody beads is added to 200 jxl of cell suspension and mixed well and incubated at 4°C for 20 minutes. Cells are then washed three times with PBS so as to wash out unbound secondary antibody. Cell suspension is then passed through magnetic column (Meltiny). Negative fraction is collected first. Column is washed again twice with PBS. Column is then removed from the magnet and positive fraction is collected. Positive fraction of the cells are washed twice and seeded on extra-cellular matrix carrier in culture medium. Here extracellular matrix carrier is preferably matrigel coated plates. Here culture medium is Dulbecco's modified Eagles Medium (DMEM) and F-12 (DMEM:F-Ti; 1:1) and supplemented with 10% knock out serum or 10% heat inactivated human.serum collected from cord blood,
36
dimethyl sulphoxide (DMSO) 0.5%/recombinant human epidermal, growth-iactor (rhEGF) 2 ng/ml, insulin 5 ug/ml, transferrin 5 ug/ml, sodium selenite 5 ug/ml, gentamycin 50 ug/ml and amphotericin B 1.25 ug/ml, Leukemia inhibitory factor 10ng/ml and basic FGF 4rjg/ml. Cells are cultured for an additional one week at 37°C in C02 incubator until it gets confluent^.
After getting confluent, the cells are dissociated and re-plated on fresh bio-coated tissue culture dishes at the rate of 1:3. The limbal cells are then expanded and serially passaged. The limbal cells are serially passaged up to 100 population doublings.
EXAMPLES
ANALYSIS OF PLURIPOTENT EMBRYONIC-LIKE STEM CELLS:
Pluripotent embryonic-like stem cells derived from limbal tissue are characterized for its undifferentiated status. Stem cells are analyzed by flow cytometry, immunofluorescence and molecular analysis for different stem cell markers. Karyotyping and telomerase activity was also analyzed at various passages.
Flow Cytometric Analysis:
Very few surface markers related to pluripotent stem cells are known. We analyzed the cell surface cluster differentiation (CD) markers and stage specific embryonic antigen (SSEA) that is usually expressed on pluripotent embryonic stem cells. Analysis was carried out after every passage. We analyzed SSEA-1, SSEA-3, SSEA-4, CDllc, CD14, CD34, CD45, CD54, CD73, CD105, CD106, CD123, CD133, SCF, HLA-DR. by flow cytometry.
Antibodies to stage specific embryonic antigen (SSEA) 1, 3, and 4 and cluster differentiation (CD) markers have been used in conjunction with flow cytometry. Pluripotent embryonic-like stem cells were trypsinized after expansion. The cells were
37
then centrifuged and resuspended in wash buffer at the concentration of 1 x 106 /ml. Wash buffer consists of phosphate buffer supplemented with 1% fetal bovine serum. lxlO5 cells were incubated with SSEA-1, SSEA-3, SSEA-4, CDllc, CD14, CD34, CD45, CD54, CD73, CD105, CD106, CD117, CD123, CD133, HLA-DR antibody conjugated with either fluorescein isothiocyanate (FITC) or phycoerythrin (PE). The cells were incubated in the dark for 1 hour at 4°C. The cells were washed 3-4 times with wash buffer and resuspended in 500 ul of wash buffer. Flow cytometry was performed on a FACS Calibure (Becton-Dickinson). Cells were identified by light scatter. Logarithmic fluorescence was evaluated on 10,000 gated events. Analysis was performed using CELL QUEST software (Becton Dickinson). The control samples were used for adjusting the background fluorescence. The percent positivity was determined with respect to the control tube events. Results are summarized in the Table -1 given below:
Table 1: Results of the various stem cell markers analyzed for pluripotent embryonic-like stem cells by flow cytometry
SI. No Markers Results % Cells positive
1 SSEA-4 Positive 98%
2 CDllc Negative 0%
3 CD14 Negative 0%
4 CD34 Negative 0%
5 CD45 Negative 0%
6 CD54 Positive 51%
7 CD73 Positive 98%
8 CD 105 Positive 98%
9 CD 106 Negative 0%
10 CD117 Positive 44%
11 CD123 Negative 0%
12 CD133 Negative 0%
13 HLA-DR Negative 0%
14 CD-31 Positive 98%
38
Pluripotent embryonic-like stem cells were positive for SSEA-3 and SSEA-4 that is a stage specific embryonic antigen usually express on pluripotent human embryonic stem cells derived from inner cell mass. Expression of SSEA-3 and SSEA-4 in limbal tissue derived pluripotent embryonic stem cells was similar to that of human embryonic stem cells. Expression of SSEA-1 however, was not observed in these cells. SSEA-1 usually express on mouse embryonic stem, cells. Pluripotent embryonic-like stem cells examined for cluster differentiation markers were negative for CD1 lc, CD 14, CD34, CD-45, CD106, CD123, CD133, and HLA-DR markers. Data demonstrate that the isolated stem cells from limbus are not hematopoietic origin since they are negative for CD34 and CD45 marker. Pluripotent embryonic-like stem cells were also negative for CD lie, CD14, CD106, CD123, CD133 and HLA-DR. These particular cell surface markers are only known to express on differentiated cells. This demonstrated that the present pluripotent embryonic-like stem cells are not having any differentiated lineages. (Fig 3). However, expression of CD73, and CD 105 shows that the cells are mesenchymal origin. Limbus tissue has two sets of cells. Upper layer is epithelial in nature and basement cells are stromal cells that contain mesenchymal and fibroblastic cells. Surprisingly these cells were also expressed CD54 marker that is known for endothelial marker. In order to substantiate this finding, our RT-PCR results are also showing the expression of PECAM gene. (Figure 8)
Molecular Analysis:
Array of unique sets of markers have been reported in these pluripotent embryonic stem cells. We analyzed the expression of pluripotent stem cell markers for Oct-4, Nanog, Rexl and TDGF1 genes. GAPDH gene was used as housekeeping gene. Conspicuous expression of all the undifferentiated markers were observed in the pluripotent embryonic-like stem cells at various passages. Undifferentiated markers however, gradually decrease on progression of differentiation (Table 2 & 3). The identity of the PCR products was confirmed by sequencing. Hence, these results clearly indicate that the cells isolated from limbal tissues are pluripotent and has potential embryonic stem cell¬like activity (Figs 5 & 6.).
39
We also have performed the profiling of various genes for ectoderm, mesoderm and endodermal lineages like NFH and Keratin (Ectodermal lineage markers), cardiac- Actin (Mesodermal lineage) and AFP and Albumin ( Endodermal lineage markers). The differential expression of appropriate lineage markers in 2d, 4d, 8d, 12d and 14d embryoid like bodies establishes the ability of these cells to give rise to all three lineages (Figs 7& 8.). Expression of the some of the markers such as Keratin, KGF, Collagen-I and P 63 clearly shows that the cells are derived from limbal origin. Expression of P 63 markers also shows that the cells do have some population of corneal limbal stem cells (Table 4.). Table 2:
P5 P10 P15 P20 hEF NTERA
GAPDH ++ ++ ++ ++ ++ ++
Oct-4 + + ++ + - +++
Nanog ++ ++ ++ + - ++
Rex-1 ++ ++ ++ ++ ++- ++
TDGF ++ ++ ++ + - ++
Table 3:
UD EB2 EB4 EB8 EB12 EB14 hEF
GAPDH ++ ++ ++ ++ ++ ++ ++
Oct-4 ++ ++ - - - - +
Nanog ++ ++ ++ + + ++ +
Rex-1 ++ + - + - - +
TDGF1 ++ + + - - - -
40 ko
Table 4:
UD EB2 EB4 EB8 EB12 EB14 PC NC
NFH - - + ++ - - ++ -
Keratin ++ ++ - + ++ - ++ -
c-Actin - - - ++ ++ - +++ -
AFP - + - + - - ++ -
Albumin - - + + ++ - ++ -
PECAM ++ ++ ++ ++ ++ ++ ++ -
Coll + + + ++ ++ - ++ -
KGF ++ ++ + ++ ++ - + -
P63 ++ + + + - - - -
Cellular Analysis:
Pluripotent embryonic-like stem cells are further characterized for its pluripotency and undifferentiation status by cellular markers. Cellular markers used herein are SSEA-4, SSEA-3, SSEA-1, OCT-4, TRA-1-60, TRA-1-80, Alkaline phosphatase. In order to determine whether these genes are expressed by these cells, cells were collected 1, 2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 and subjected to imrnunofluoroscense. It was observed that strong expression of all the undifferentiated markers were observed on the undifferentiated pluripotent embryonic-like stem cells (Fig 5).
Telomerase Activity:
Cell extracts from passage 5, 10, 15, and 20 were prepared as per protocol, (see material and methods). After estimation of protein concentration, samples were placed in a thermocycler and PCR was performed as per protocol. After PCR, amplification, amplified products were denatured, and detected by ELISA. Proper positive and negative
41 ^1
controls provided in the kit were used, in every assay. Care was taken to remove inhibitors of taq polymerase, which otherwise results in a false negative result. High expression of telomerase activity was seen in all the 5 passages, indicative of high proliferative capacity of the pluripotent embryonic like stem cells.
Karyotyping:
Cells were karyotyped using a standard G-banding technique (Genetics Lab., Reliance Life Sciences Pvt. Ltd., Mumbai) and compared to published human karyotypes. Cells with 'normal karyotype' were obtained, which means that the cells at PI3 passage are euploid, wherein all human chromosomes are present and are not noticeably altered (Fig 4).
EXAMPLE-6
GENERATION OF EMBRYOID LIKE BODIES
Undifferentiated pluripotent embryonic-like stem cells are proliferated and expanded. This stage includes culturing embryonic-like stem cells in bacteriological plate having non-adhesive surface that prevents attachment and stimulate differentiation of embryonic-like stem cells. Embryonic-like stem cells are dissociated using brief exposure of 0.05% trypsin-EDTA and cultured in an appropriate media as a suspension culture. Appropriate media preferably contain DMEM:F-12 or knockout DMEM and supplemented with 10-20% fetal calf serum, cord blood serum or knockout serum replacement. In addition to that other supplements are also added such as- 2-mercaptoethanol, L-glutamine, insulin, human transferrin, sodium selenite, and without addition of bFGF and hLIF. hi this stage, the cells are incubated for about 4 days and media is changed every alternate day. The medium is changed every day by transferring the suspension of aggregates to a centrifuge tube and allowing the aggregates to settle down, aspirating the medium and replacing it with fresh medium. The aggregates and the fresh medium are returned to the culture dishes. At the end of the 4 days, embryoid like
42
bodies (Fig 2) are collected and spun down at low speed (1000 rpm, 5 min) and resuspended in embryonic stem cell medium.
EXAMPLE: 7
INDUCTION OF DIFFERENTIATION INTO NEURONS:
The embryoid like bodies are cultured until they reach sufficient size, for example 4-10 days, preferably 4 days old embryoid like bodies, are plated onto extracellular matrix coated plates, preferably poly-o-orinithin and laminin coated plates. The embryoid like bodies are then cultured under conditions to encourage further differentiation of the cells into neuronal or CNS precursors cells. For example, the embryoid like bodies are cultured in a serum-free defined expansion medium Preferably, the CNS expansion media comprises a minimal essential medium such as DMEM:F12, and is supplemented with neuronal inducing agents such as N2 and B27. The CNS expansion media also preferably includes growth factor, such as basic fibroblast growth factor (bFGF). Preferably, the neuronal cells are grown in the CNS expansion medium for 6 days.
The neuroprogenitor cells prepared according to the methods disclosed herein can be further differentiated into high proportions of mature neurons, for example glutamatergic, dopaminergic, serotonergic, and GABAergic neurons. The neuronal progenitor cells are grown in the differential medium containing Neurobasal-A medium, insulin (5-20 ug/ml), and transferrin (4-10 ug/ml), FGF-8 (10-50 ng/ml) and supplemented with Ara-C (10-50 ng/ml) and retinoic acid (20-80 ng/ml). The cells are grown in the differential medium for 12 days, with media change on every second day. In order to achieve, mature neuronal-like morphology, the differentiated neurons are grown in the differential medium supplemented with other neuronal growth factors such neurotrophin-3 and GDNF factors. For example the neurotrophin-3 (5-20 ug/ml) and GDNF (10-50 ug/ml) are added in the differential medium on the 6th day of differentiation to day 12 of differentiation.
43
Characterization of Neuronal Cells:
The differentiated neuronal cell types generated according to the present disclosure were evaluated both by the overall morphology of the cells, as well as the phenotypes identified by immunuflorescence. Immunuflorescence analysis was carried out at the end of differentiated stage, preferably 12 days after neuronal differentiation as disclosed in the above protocol. First, the isolated cells were grown in 2-well chamber slides, rinsed with PBS, and fixed for 10 minutes with 4 % paraformaledyde at room temperature. Next, the cells were permeabilized with 0.2 % Triton X-100 in PBS containing 1 % normal goat serum and blocked with 1 % bovine serum albumin (BAS) for 1 hr at room temperature. The cells were then incubated overnight at 4 degree Celsius with primary antibody (antibody dilution was made in 1 % BSA). The following primary antibodies were employed in the immunuflorescence investigation. Monoclonal GABA 1:200 (Chemicon Inc. USA); Glutamate 1:500 (Chemicon Inc. USA), Nestin 1:50 (Chemicon Inc. USA), Tyrosine hydroxylase 1:800 (Chemicon Inc. USA); B-tubulin HI 1: 500 (Chemicon Inc. USA), Serotonin 1:500 (Chemicon Inc. USA), Neurofilament 1:500 (Chemicon, USA), Oligodendrocytes 1:500 (Chemicon Inc. USA). After overnight incubation with primary antibody, the cells were washed with PBS and incubated with FITC labeled secondary antibody for one hour in a dark environment. The cells were then washed three times with PBS and covered with mounting media. The chamber slides were observed under fluorescence microscope to evaluate the immunoposiitve cells.
Results:
Immunuflorescence analysis of the neuronal cells derived from corneal stem cells revealed that high populations of cells were immunoposiitve to neuron-specific markers such as P-tubulin m and neurofilament. Of the total neuronal cells in the culture, majority of the neuronal cells stained with Glutamate, the marker for glutamatergic neurons, while small population of neurons were stained with GABA (marker for GABAergic neurons), Tyrosine hydroxylase (marker for dopaminergic neurons), and serotonin (marker for serotonergic neurons). In addition to neuronal cells, derived cells also stained with
44
oligodendrocytes antibodies, which is marker for oligodendrocytes. Morphologically, most of the neuronal cells were bipolar in appearance and having fine projections, while few of them were multipolar in appearance. Typically, mature neurons are identified by the presence of neurofilament like immunoreactivity.
Preferably, a high percentage of the neuroprogenitor cells differentiate into glutamatergic, GABAergic, dopaminergic, and serotonergic. Most of the derived neuronal cells are expressed neuronal-specific markers such as B-tubulin HI and neurofilament, which verified that derived neurons are indeed neurons (Fig 9).
The neuroprogenitor cells derived from corneal stem cells described herein (e.g., glutamatergic, GABAergic,, serotonergic, dopaminergic and as well as oligodendrocytes) may be utilized for various applications, such as therapeutic application, as well as in vitro and in vivo assessment and screening of various compounds such as small molecule drugs for their effects on the cells.
The neuronal cells can be used to treat or prevent various neurological or neurodegenerative disorders or diseases but limited to Parkinson's disease, Alzheimer's disease, Huntington's disease, Lewy body dementia, multiple sclerosis, cerebellar ataxia, progressive supranuclear palsy, spinal cord injury, amyotrophic lateral sclerosis (ALS), epilepsy, stroke, ischemia, injury or trauma to the nervous system, neurotoxic injury, and the like in which neurons or glial cells are injured or die in the central nervous system or spinal cord. Additionally, the neuronal cells derived from pluripotent corneal stem cells can also used in neurological disorders associated with cognition and psychology including but not limited to anxiety disorders, mood disorders, addition, obsessive-compulsive disorders (OCD), personality disorders, attention deficit disorder (ADD), attention deficit hyperactivity disorder (ADHD) and schizophrenia.
45
EXAMPLES
INDUCTION OF DIFFERENTIATION INTO HEPATOCYTES:
This example describes the induction of pluripotent embryonic-like stem cells derived from corneal limbus into hepatocytes.
The embryoid like bodies are cultured until they reach sufficient size, for example 4-14 days, preferably 4 days old embryoid like bodies, are plated onto extracellular matrix coated plates, preferably matrigel.coated plates. The embryoid like bodies are then cultured under conditions to encourage further differentiation of the cells into hepatocytes. For example, embryoid like bodies are cultured in DMEM supplemented with 10-15% knockout serum and in the presence of epidermal growth factor 10-100 ng/ml, hepatocyte growth factor (HGF) 5-50 ng/ml, basic FGF (5-20 r|g/ml), FGF-4 (5-50 r|g/ml) IL-6 (10-100 rjg/ml), acidic FGF(50-100 Tig/ml), human oncostatin (10-50 ng/ml), Insulin-transferrin-selenious acid (ITS) (IX), Dexamethasone (10-100riM), sodium butyrate (1-5 mM), DMSO (0.5-1%), 5 Azacytidine (l-10uM), These growth factors were added together or at different time points as early growth factors, mid- stage growth factors or late stage growth factors, and were kept for 20 days.
Characterization of Hepatocytes:
The differentiated cell types generated according to the present disclosure were examined by morphology of the cells by phase contrast microscopy and by hematoxylin - eosin staining, gene expression analysis by RT-PCR, immunological characterization by immunofluorescence, and functional characterisation by evidence of stored glycogen in the cells by periodic-acid-Schiff s staining (PAS). Analysis was carried out at the end of differentiated stage, preferably 20 days after hepatocyte differentiation as disclosed in the above protocol.
46
Immunological Characterisation by Immunofluorescence:
Undifferentiated and differentiated cells were fixed with paraformaldehyde (Sigma-Aldrich) for 20 min The cells were washed once with PBS and then fixed with 4% paraformaldehyde (freshly prepared) for 20 mins at room temp. After fixing, the cells were rinsed once with PBS at RT and then stored at 4 deg C or directly permeabilised with 0.2% Triton X-100 for 5 mins at room temperature for intracellular staining. After aspirating the fixative, cells were washed thrice for 5 mins each with PBS. The cells were then blocked with PBS containing 1% BSA for 1 hr at RT. They were given 2 washes with 1XPBS. The cells were incubated with primary antibody solution diluted in 1XPBS-1%BSA O/N at RT. The primary antibodies used were CK 18 (Chemicon, Inc, USA), albumin (Sigma, USA). Next, the cells were washed with 1XPBS thrice for 10 mins each on a rocker. The cells ere then incubated with secondary antibody dilution (containing a fluorescent label FITC) in 1XPBS-1% BSA at RT for 1 hr on a rocker. After giving three washes (5 mins each) with PBS, the cells were exposed to lmg/ml DAPI solution. Wash the cells properly twice for 5 mins each with 1XPBS. The slides were mounted with DPX mountant (Fig lOd).
Molecular Characterisation by RT-PCR Analysis:
Total RNA was extracted from the cell pellet by TRIzol method. 1 ug of RNA was then used for cDNA synthesis by reverse-transcription using reverse transcriptase (Invitrogen hie, USA), and oligo dT (Invitrogen Inc, USA) to prime the reaction . 2 ul of cDNA mixture was amplified using polymerase chain reaction using apprpriate primers. The primers used were albumin and AFP both indicative of early as well as mature hepatocyte formation.
47
EXAMPLE-9
INDUCTION OF DIFFERENTIATION INTO CARDIOMYOCYTES
This example elucidates the induction of pluripotent embryonic-like stem cells derived from corneal limbus into cardiomyocytes.
The embryoid like bodies are cultured in suspension drops until they reach adequate size with extensive blood islets; for example 4-14 days, preferably 4 days old embryoid like bodies, are plated onto matrigel (extra-cellular matrix) coated plates. The embryoid like bodies are then induced for further differentiation into cardiomyocytes. For example, embryoid like bodies are cultured in DMEM/F-12 (1:1) supplemented with 15% knockout serum and 100 mM L-glutamine; in the presence of epidermal growth factor 50 r|M, Transformation growth factor (TGF beta-3) 10 r|g/ml, basic FGF (50 r)g/ml), Platelet derived growth factor (PDGF-BB) 50 rig/ml. Insulin-transferrin-selenious acid (1XITS). 5-Azadeoxycitidine ( 5-10 r]M) which is a very well known cardiomyocyte inducing factor for human embryonic stem cells, is not effective in this case. These cardiotropic factors were added together or at different time points as early growth factors, mid-stage growth factors or late stage growth factors, and were kept for 21 days. The cultures were carefully monitored for contracting embryoid like bodies.
Molecular characterisation by RT-PCR:
Total RNA was extracted from the cell pellet by TRIzol method. 1 ug of RNA treated with Rnase-OUT ribonuclease inhibitor (Invitrogen Inc, USA) was used for cDNA synthesis by Reverse-transcription using reverse transcriptase (Invitrogen Inc, USA), and oligo dT (Invitrogen Inc, USA) to prime the reaction . 2 ul of cDNA mixture was amplified using polymerase chain reaction using appropriate primers. PCR primers were selected to distinguish between cDNA and genomic DNA by using individual primers specific for different exons. The primers used were GAPDH, Cardiac-actin Na-Ca exchanger; both indicative of adult cardiomyocyte (Fig 11).
48
EXAMPLE-10
INDUCTION OF DIFFERENTIATION INTO BETA-ISLET CELLS:
This example describes the induction of pluripotent embryonic-like stem cells derived from corneal limbus into beta-islet cells, either directly or by the formation of embryoid like bodies.
The embryoid like bodies are cultured until they reach sufficient size, for example 4-14 days, preferably 4 days old embryoid like bodies, are plated onto extracellular matrix coated plates, preferably matrigel. coated plates. The embryoid like bodies are then cultured under conditions to encourage further differentiation of the cells into beta-islet cells. For example, embryoid like bodies are cultured in DMEM supplemented with 10-15% knockout serum and N2 and B27 supplement, lOuM Forskolin and 10 uM cyclopamine. These growth factors were added and were kept for 12 days of differentiation.
Characterisation of pancreatic Beta-islet cells:
After 12 days of differentiation, molecular and immunological and characterisation was carried out to confirm the presence of pancreatic beta-islet cells. The genes for molecular characterisation were Insulin, Glucose transported, Glucagon, Nkx2.2 and Ngn 3. Antibodies used for immunological characterization were Insulin (Santacruz), Glucagon (Santacruz), PDX 1 (Santacruz), Ngn 3 (Chemicon) and Glucose Transporter 2 (Chemicon)
49
EXAMPLE-11
INDUCTION OF DIFFERENTIATION INTO CHONDROCYTES :
This example describes the induction of pluripotent embryonic-like stem cells derived from corneal limbus into chondrocytes, either directly or by the formation of embrryoid bodies. The following protocol is employed for inducing pluripotent embryonic-like stem cells into chondrocytes.
Pluripotent embryonic-like stem cells first differentiated into embryoid like bodies. Pluripotent embryonic-like stem cells are grown in media preferably containing DMEM:F-12 or knockout DMEM and supplemented with 10-20% fetal calf serum, cord blood serum or knockout serum replacement. In addition to that other supplements are also added such as 2-mercaptoethanol, L-glutamine, insulin, human transferrin, sodium selenite, and without addition of bFGF and hLIF. In this stage, the cells are incubated for about 4 to 14 days and media is changed every alternate day. Preferably 4 days old embryoid like bodies, are plated onto extracellular matrix coated plates, preferably matrigel.coated plates. The embryoid like bodies are then cultured under conditions to encourage further differentiation of the cells into chondrocytes. For example, embryoid like bodies are cultured in DMEM supplemented with 10-15% knockout serum and in the presence of TGF 3 (10-100 ng/ml) and ascorbic acid (0.01-0.05 mM), IX ITS, sodium pyruvate (l-5mM). These growth factors and were kept for 21 days for differentiation.
Characterisation of chondrocytes:
After differentiation for 21 days, development of chondrocytes were seen by staining with Alcian blue, which indicates the presence of glycogen deposits (Fig 10c).
50
EXAMPLE-12
INDUCTION OF DIFFERENTIATION INTO OSTEOBLASTS :
This example describes the induction of pluripotent embryonic-like stem cells derived from corneal limbus into osteoblasts, either directly or by the formation of embryoid like bodies.
The embryoid like bodies are cultured until they reach sufficient size, for example 4-14 days, preferably 4 days old embryoid like bodies, are plated onto extracellular matrix coated plates, preferably matrigel.coated plates. The embryoid like bodies are then cultured under conditions to encourage further differentiation of the cells into osteoblasts. For example, embryoid like bodies are cultured in DMEM supplemented with 10-15% fetal bovine serum and in the presence dexamethasone (10- 100 nM), glycerophosphate, (1-lOmM), ascorbic acid 2 phosphate ( O.lmM-O.SmM), BMP2 (l-10ng/ml), hydrocortisone (0.05-0. luM). Cells were cultured for 28 days.
Characterisation of osteoblasts:
After 28 days of differentiation, molecular and immunological and characterization was carried out to confirm the presence of osteoblasts. Calcium deposit was confirmed by Von Kossa staining. The genes for molecular characterization were BMP2, BMP4, osteopontin and PTH.
EXAMPLE-13
INDUCTION OF DIFFERENTIATION INTO MYOCYTES.
This example describes the induction of pluripotent embryonic-like stem cells derived from corneal limbus into myocytes.
51
The embryoid like bodies are cultured until they reach sufficient size, for example 4-14 days, preferably 4 days old embryoid like bodies, are plated onto extracellular matrix coated plates, preferably matrigel.coated plates. The embryoid like bodies are then cultured under conditions to encourage further differentiation of the cells into hepatocytes. For example, embryoid like bodies are cultured in DMEM supplemented with 10-15% knockout serum and in the presence of 5-Azacytidine (5-10 uM), PDGF-BB (10-50 ng/ml). These growth factors were added and were allowed to differentiate for 12 days.
Characterisation of myocytes:
After 12 days of differentiation, molecular and immunological and molecular characterization was carried out to confirm the presence of muscle cells. The genes for molecular characterization was Myogenin. Antibodies used were smooth muscle actin.
EXAMPLE-14
INDUCTION OF DIFFERENTIATION INTO ADIPOCYTES:
This example describes the induction of pluripotent embryonic-like stem cells derived from corneal limbus into adipocytes.
The embryoid like bodies are cultured until they reach sufficient size, for example 4-14 days; preferably 4 days old embryoid like bodies, are plated onto extracellular matrix coated plates, preferably matrigel coated plates. The embryoid like bodies are then cultured under conditions to encourage further differentiation of the cells into adipocytes. For example, embryoid like bodies are cultured in DMEM supplemented with 10-15% knockout serum and in the presence of dexamethasone (luM-100 mM), isobutylmethylxanthine (BMX, 10-50 ng/ml), insulin ( 10-20 ng/ml), indomethac 2-20 mM), (IGF (10-100 ng/ml) These growth factors were added together and were kept for 14 days for differentiation.
52
Characterization of adipocytes:
After 14 days of differentiation, molecular, immunological and functional characterization was carried out to confirm the presence of adipocytes. Functional characterisation was performed by morphological examintaion of the accumulation of cytoplasmic lipid droplets.
EXAMPLE-15
INDUCTION OF DIFFERENTIATION INTO ENDOTHELIAL CELLS :
This example describes the induction of pluripotent embryonic-like stem cells derived from corneal limbus into oendothelial cells either directly or by the formation of embryoid like bodies.
The embryoid like bodies are cultured until they reach sufficient size, for example 4-14 days, preferably 4 days old embryoid like bodies, are plated onto extracellular matrix coated plates, preferably matrigel.coated plates. The embryoid like bodies are then cultured under conditions to encourage further differentiation of the cells into endothelial cells. For example, embryoid like bodies are cultured in DMEM supplemented with 10-15% knockout serum and in the presence of VEGF (20ng/ml), bFGF (50 ng/ml) and BMP-4 (1-10 ng/ml). These growth factors were added and were kept for 21 days of differentiation to achieve vascularization of the differentiated cells.
Characterization of endothelial cells:
After 21 days of differentiation, molecular and immunological characterization was carried out to confirm the presence of endothelial cells. The genes for molecular characterisation were PEC AM and AC 133.
53
METHODS AND RESULTS
PROTEIN EXPRESSION BY IMMUNOFLOURESCENCE:
The undifferentiated status of the pluripotent embryonic-like stem cells and differentiated lineages can be judged by their overall morphology and phenotype and was analyzed by immunoflourescence.
Immunoflourescence analysis was carried out at every five passage of pluripotent embryonic-like stem cells and after derivation of specific lineages at various time points of differentiation. Immunofluorescence was carried out using standard protocols.
The cells grown in 2 well chamber slides are rinsed with PBS and fixed for 10 min with 4% paraformaldehyde at room temperature. Then the cells are permeabilised with 0.2 % triton x-100 in PBS, blocked with 1% bovine serum albumin/PBS and incubated with the primary antibody (antibody dilution was made in 1% BSA/TBS) is carried out overnight at 4°C. The details of the antibodies (from Chemicon, Santacruz and Sigma) analysis are given in the Table 5.
Table: 5
Sl.No
Antibodies markers Dilutions
1 Bin- tubulin 1:500
2 NFH 1:500
3 GABA 1:200
4 Glutamate 1:500
5 TH 1:800
6 Oligodendrocyte 1;500
7 Serotonin 1:500
8 CK 18 1:200
9 Albumin 1:200
10 Myocyte actin 1:250
54
11
SSEA-4
1:100
12 P63 1:150
Then the cells are incubated with FITC labeled secondary antibody. The chamber slides are observed under the fluorescence microscope to evaluate the immunopositive areas.
The expression of key antigens increased with incubation time in differentiation medium.
GENE EXPRESSION PROFILE
In order to determine whether the pluripotent stem cell markers are transcribed by these cells, total RNA of pluripotent embryonic stem cells were isolated at every passages, for example passage 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 & 20 by TRIzol method (Gibco-BRL). 1 ug of RNA treated with Rnase-OUT ribonuclease inhibitor (Invitrogen Inc, USA) was used for cDNA synthesis by Reverse-transcription using reverse transcriptase (Invitrogen Inc, USA), and oligo dT (Invitrogen Inc, USA) to prime the reaction. 2 ul of cDNA was amplified by polymerase chain reaction using Abgene 2X PCR master mix and appropriate primers. PCR primers were selected to distinguish between cDNA and genomic DNA by using individual primers specific for different exons (Table 6.). The conditions for thermal cycler (ABI Biosystems 9700 ) are as follows: 94 deg C, 1 min; 94 deg C, 30 sec; desired Tm deg C, 45 sec; 72 deg C, I min; 72 deg C, 5 mins and final hold at 4 deg C.
Table 6 :
Gene Primer sequence Annealing
temp
(DegC) Expecte
d Product size (bp) Function
GAPDH 5'-TGAAGGTCGGAGTCAACGGATTTGGT-
3' 5 '-CATGTGGGCCATGAGGTCCACCAC-3' 60 890 Housekeeping gene
Oct-4 5'-CGRGAAGCTGGAGAAGGAGAAGCTG-3' 5 '-CAAGGGCCGCAGCTTACACATGTTC-3' 58 247 Undiffere-ntaited
transcription
factor
Nanog 5 '-CCTCCTCCATGGATCTGCTTATTCA-3' 52 262 Do
55
5' -C AGGTCTTC ACCTGTTTGT AGCTGAG-3'
Rexl 5 '-GCGTACGCAAATTAAAGTCCAGA-3' 5'-CAGCATCCTAAACAGCTCGCAGAAT-3' 56 306 Do
TDGF1 5 '-GCCCGCTTCTCTTACAGTGTGATT-3' 5 '-TAGTACGTGCAGACGGTGGTAGTTCT-3' 55 499 Undifferentia-ted marker
NFH 5 '-TGAACACAGACGCTATGCGCTC AG-3' 5'-CACCTTTATGTGAGTGGACACAGAG-3' 58 400 Neuroecto-dermal lineage marker
Keratin 5 '-AGGAAATCATCTCAGGAGGAAGGGC-3' 5' - AAAGCACAGATCTTCGGGAGCT ACC-3' 56 780 Ectodermal lineage marker
Cardiac-Actin 5 '-TCTATGAGGGCTACGCTTTG-3' 5'-CCTGACTGGAAGGTAGATGG-3' 50 630 Mesodermal lineage marker
AFP 5 '-AGAACCTGTCACAAGCTGTG-3' 5' -GACAGC AAGCTGAGGATGTC-3' 50 680 Endodermal lineage marker
Albumin 5 '-CCTTTGGCACAATGAAGTGGGTAACC-
3' 5 '-C AGCAGTC AGCCATTTC ACC ATAGG-3' 58 450 Do
PECAM 5'-GTCATGGCCGTCGAGTA -3' 5' -CTCCTCGGCATCTTGCTGAA-3' 50 260 Endothelial lineage marker
Collage nl 5'-CCATCCAAACCACTGAAACC -3' 5'-TGACGAGACCAAGAACTG-3' 55 600 Stromal cell marker
KGF 5'-GATACTGACATGGATCCTGCC -3' 5'-CACAATTCCAACTGCCACTG-3' 55 300 Do
P63 5'-CAGACTCAATTTAGTGAG-3' 5 '-AGCTCATGGTTGGGGCAC-3' 48 550 Corneal
epidermal stem
cell marker
Telomerase Activity:
This assay is designed for the highly sensitive qualitative detection of telomerase activity in the cell pellet. The activity was assayed by telomeric repeat amplification protocol (TRAP) and detected by photometric enzyme immunoassay. Passage P5, P10, PI5, and P20 were checked for detection of telomerase activity in the cell pellet. All passages expressed high levels of telomerase activity, as indicated by the assay.
Telomerase PCR ELISA was done according to manufacturer's protocol (Roche Molecular Biochemicals). The telomerase PCR ELISA allows highly specific amplification of telomerase mediated elongation products combined with non-radioactive detection following the ELISA protocol. In the first step, telomerase adds telomeric
56
repeats (TTAGGG) to the 3' end of the biotin-labeled synthetic primer. In the second step, these elongation products are amplified by PCR using primers generating PCR products with the telomerase specific six nucleotide increments. An aliquot of the PCR product is denatured and the hybridized to a digoxigenin -(DIG)-labeled, telomeric repeat-specific detection probe. The resulting product is immobilized via the biotin labeled primer to a strepatavidin-coated microliter plate. After detection with an antibody, which is conjugated to peroxidase, telomerase activity is detected by formation of a colored product.
Cell extracts from passage 5, 10, 15, and 20 were prepared. After estimation'of protein concentration, samples were placed in a thermocycler and PCR was performed as per protocol. After PCR, amplification, amplified products were denatured, and detected by ELISA. Proper positive and negative controls provided in the kit were used, in every assay. Care was taken to remove inhibitors of taq polymerase, which otherwise results in a false negative result. High expression of telomerase activity was seen in all the 5 passages, indicative of high proliferative capacity of the pluripotent embryonic like stem cells.
Flow cytometry :
The cells were dissociated from the plates using 0.25% trypsin -EDTA treatment for 2-3 minutes. These cells were passed through the 40 micron filter mesh to get rid of any clumps which may interfere with the staining. The cells were resuspended as lxl06cells/ml. lxlO5 cells/tube were added to control and test tubes. The respective antibody was added to each of the test tubes. The tubes were vortexed briefly and incubated for half an hour at room temperature. Fluorescein (FITC) labeled secondary antibody was added to all the tubes, control as well as the test tubes, and the tubes were incubated for 20 minutes at room temperature in dark. The cells were washed twice and resuspended in IX Phosphate buffered saline for flow cytometry. The samples were analyzed on FACS Calibur flow cytometer (Becton Dickenson). A total of 10,000 events
57
were acquired. The control samples were used for adjusting the background fluorescence. The percent positivity was determined with respect to the control tube events.
DISCUSSION:
We were able to isolate pluripotent cells from the limbus, despite being an adult tissue specific cell type and a non-embryonic source, its behavior was like embryonic like stem cells, capable of multipotent differentiation, and self-renewing capabilities. The cryopreservation of these cells for 30days had no effect on their percentage viability and pluripotency. Our findings have shown that the origin of our ELSCs is different from those reported earlier (Pittenger et al., 1999; Jiang et al., 2002; Toma et al, 1991; Li et al., 2003).
The role of the ELSCs in the eye is speculative. Moreover the factors that govern stem cell survival, migration, replication, plasticity are also not known. Recent reports indicate that the milieu or local microenvironment that a stem cell encounters governs it behavior or fate. To understand this, the cellular and molecular signaling between the local environments in which a stem cell resides needs to be minutely studied. In this context, the role of Wnt signaling pathway in maintenance of pluripotency in human ES cells has very recently been documented ( Sato et al, 2004). Are the ELSCs endogenous stem cells, which reside in the tissues and upon injury. Factors responsible for maintaining the 'sternness' of these ocular stem cells have not been determined. Though, the plasticity of the corneal stem cells has been recently published (Seigel et al., 2003). It is believed that both intrinsic as well as extrinsic stimuli are involved in the regulation and maintenance of the stem cell 'niche'. It is currently believed that this microenvironment maintains the stem cells in its undifferentiated state at rest, while at times of injury it supplies the necessary cytokine mediated or neural mediated signals, to enable recruitment of these cells for undergoing multiple cell divisions. As has been already reported there seems to be a close interaction of the epithelial layer with the stromal niche. We hypothesize that ELSCs are primarily present is the stroma and migrate towards the epithelial zone whenever required, and remain undifferentiated until required. Embryonic and adult
58
5?
epithelia from different locations can be differentiated in to an entirely different phenotype depending on the stromal population recombined.
Adult stem cell therapy holds a great promise for the treatment of regenerative diseases. Clinical trials using mesenchymal stem cells has given encouraging results (Horwitz et al., 1999) and this kind of therapy would definitely be more advantageous than ES cell therapy, which is confronted with a number of ethical issues. The next step in our research will be clonogenic selection and subsequent transplantation in animals to study in vivo engraftment and behavior of ELSCs. Though there is an acute need for further research on the comprehension of the molecular control, and concomitant developmental significance of these processes awaits further in vivo studies, the possibility of using theses ELSCs for tissue specific cell therapy opens exciting clinical perspectives.
One skilled in the art will appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned therein above. The instant invention has been shown and described herein in what is considered to be the most practical and preferred embodiment. It is recognized, that, departures may be made therefrom within the scope of the invention. It is to understood that the invention is not limited to the particulars disclosed and extends to all equivalents within the scope of the scope of the claims.
59
WE CLAIM
1. An in-vitro method of producing a population of pluripotent embryonic-like stem
cells for therapeutic purposes comprising of the following steps:
a. culruring the corneal limbal biopsy obtained from donor, which is of non-embryonic
origin on tissue culture biocoated plates;
b. expanding these corneal limbal cells invitro on an extra-cellular matrix;
c. dissociating these limbal cells with trypsin EDTA for 30 minutes or dispase solutions
for 24 hours at 4°C to give the single cell suspension after 21 days of culture;
d. sorting these pluripotent embryonic like stem cell using fluorescence activated cell
sorting (FACS) technique or Magnetic affinity cell sorting (MACS);
e. differentiating pluripotent embryonic like stem cells into various lineages using
differentiating agents;
f. characterising differentiated pluripotent embryonic like stem cells using flow
cytometry,; molecular analysis and cellular analysis;
g. analysing further these pluripotent embryonic like stem cells using karyotyping and
telomerase activity tests j
h. maintaining the pluripotent embryonic stem cells containing cultures in the medium
capable of supporting proliferation and sternness; i. cryo-preserving pluripotent embryonic like stem cells in 10% dimethyl sulfoxide
(DMSO) or liquid nitrogen and ; j. maintaining the cryopreserved pluripotent embryonic stem cells containing cultures in
the medium capable of supporting proliferation and sternness; k. thawing the cryopreserved pluripotent embryonic like stem cells to room temperature
when required, for retaining the pluripotency and differentiation potential.
2. The method as claimed in claiml, can alternatively be performed by replacing step (a)
to step (d) of the claim 1 by the following steps*.
62
a. culturing the corneal limbal biopsy obtained from donor, which is of non-
embryonic origin on tissue culture biocoated plates -
b. culturing of these limbal cells for 21 days on extra-cellular matrix;
c. dissociating these limbal cells with trypsin EDTA for 30 minutes or dispase
solutions for 24 hours at 4 °C to give a single cell suspension;
d. expanding these corneal limbal cells in vitro on an appropriate extra-cellular matrix.
3. The method as claimed in claim 1, wherein the pluripotent embryonic like stem cells
are derived from adult tissue of non -embryonic origin.
4. The method as claimed in claim 1, wherein the adult tissue is corneoscleral limbus.
5. The method as claimed in cl#irn 4, wherein the corneal epithelial stem cells are derived from corneoscleral limbus.
6. The method as claimed in claim 1, wherein extra-cellular matrices are selected from matrigel, human amniotic membrane, laminin, collagen-IV, poly-L-lysine, gelatin, poly-L-ormthin, fibronectin or combinations thereof.
7. A method as claimed in claims 1, wherein extra-cellular matrix is preferably matrigel.
8. The method as claimed in claims 1, wherein the culture medium is DMEM:F-12 (1:1) supplemented growth factors.
9. The method as claimed in claim 8, wherein the growth factors are selected from the group of EGF, basic FGF, insulin, sodium selenite, human transferrin, human Leukemia inhibitory factor (hLlF) or combinations thereof.
10. The method as claimed in claims 1, wherein the pluripotent embryonic like stem cells obtained are CD73, CD 105 positive.
63
11. The method as claimed in claims 1, wherein the pluripotent embryonic like stem cells obtained are CD34, CD45, CD133, CD106, CDllc, CD123, and CD14 negative.
12. The method as claimed in claims 1, wherein the pluripotent embryonic like stem cells obtained are HLA-DR negative.
13. The method as claimed in claims 1, wherein at least about 46% of the stem cells obtained are CD117 positive.
14. The method as claimed in claims 1, wherein at least about 53% of the stem cells obtained are CD54 positive.
15. The method as claimed in claims 1, wherein at least about 98% of the stem cells obtained are CD31 positive.
16. The method as claimed in claims 1, wherein the differentiating agents are selected
from the group of acidic FGF, basic FGF, PDGF, insulin, retinoic acid, transferrin, Insulin-transferrin-selenious acid (ITS), dexamethasone, sodium butyrate, DMSO, NGF, Cytosine beta-d-Arabino Furanoside (Ara C), GDNF, TGF-|33, ascorbic acid, N-acetyl Cysteine, dibutaryl cyclic AMP, Neurturin, TGF-pi, IGF-I, IGF-II, EGF, BMP-2, P glycerophosphate, ascorbic acid 2 phosphate, 5-Aza-deoxy-cytidine, oncostatin, HGF, progesterone, nicotinamide or combinations thereof.
17. The method as claimed in claims 1, wherein the pluripotent embryonic like stem cells are 98% SSEA-4 positive cells characterized using FACS technique.
18. The method as claimed in claims 1 , wherein the pluripotent embryonic like stem cells are characterized using molecular analysis technique with stem cell molecular surface markers, selected from group consisting of undifferentiated stem cell
64
markers such as OCT-4, Nanog, UTX-1, FGF-4, Rex-1, SOX-2 and combinations thereof.
19. The method as claimed in claims 1, wherein the pluripotent embryonic like stem cells are characterized using cellular analysis with cellular markers selected from SSEA-4, SSEA-3, SSEA-1, OCT_4, TRA-1-60, TRA-1-80, alkaline phosphate.
20. The method as claimed in claims 1, wherein the pluripotent embryonic like stem cells obtained are karyotypically normal cells.
21. The method as claimed in claim 20, wherein the normal karyotyping obtained are up
to 100 population doublings in culture.
22. The method as claimed in claims 1, wherein the pluripotent embryonic-like stem
cells containing cultures with a medium capable of supporting the proliferation of
said stem cells and maintaining the sternness up to 100 population doublings are obtained.
Dated this 26th day of February 2004.
For Reliance Life Sciences Pvt Ltd
K. V. Subramaniam
Sr Executive Vice President
65
| # | Name | Date |
|---|---|---|
| 1 | 240-mum-2004-form 5(26-02-2004).pdf | 2004-02-26 |
| 2 | 240-mum-2004-form 3(26-02-2004).pdf | 2004-02-26 |
| 3 | 240-mum-2004-form 19(26-02-2004).pdf | 2004-02-26 |
| 4 | 240-mum-2004-form 1(26-02-2004).pdf | 2004-02-26 |
| 5 | 240-mum-2004-correspondence(ipo)-(12-10-2004).pdf | 2004-10-12 |
| 6 | 240-mum-2004-petition under rule137(19-09-2005).pdf | 2005-09-19 |
| 7 | 240-mum-2004-form 3(19-09-2005).pdf | 2005-09-19 |
| 8 | 240-mum-2004-form 2(granted)-(19-09-2005).pdf | 2005-09-19 |
| 10 | 240-mum-2004-drawing(19-09-2005).pdf | 2005-09-19 |
| 11 | 240-mum-2004-correspondence(19-09-2005).pdf | 2005-09-19 |
| 12 | 240-mum-2004-claims(granted)-(19-09-2005).pdf | 2005-09-19 |
| 14 | 240-mum-2004-cancelled pages(19-09-2005).pdf | 2005-09-19 |
| 15 | abstract1.jpg | 2018-08-09 |
| 16 | 240-MUM-2004-SPECIFICATION(AMENDED)-(19-9-2005).pdf | 2018-08-09 |
| 17 | 240-MUM-2004-FORM 2(TITLE PAGE)-(GRANTED)-(17-3-2008).pdf | 2018-08-09 |
| 18 | 240-MUM-2004-FORM 2(TITLE PAGE)-(COMPLETE)-(26-2-2004).pdf | 2018-08-09 |
| 19 | 240-MUM-2004-FORM 2(GRANTED)-(17-3-2008).pdf | 2018-08-09 |
| 20 | 240-MUM-2004-FORM 2(COMPLETE)-(26-2-2004).pdf | 2018-08-09 |
| 21 | 240-MUM-2004-FORM 1(19-9-2005).pdf | 2018-08-09 |
| 22 | 240-MUM-2004-DRAWING(AMENDED)-(19-9-2005).pdf | 2018-08-09 |
| 23 | 240-MUM-2004-DESCRIPTION(GRANTED)-(17-3-2008).pdf | 2018-08-09 |
| 24 | 240-MUM-2004-DESCRIPTION(COMPLETE)-(26-2-2004).pdf | 2018-08-09 |
| 25 | 240-MUM-2004-CORRESPONDENCE(IPO)-(7-4-2008).pdf | 2018-08-09 |
| 26 | 240-MUM-2004-CLAIMS(GRANTED)-(17-3-2008).pdf | 2018-08-09 |
| 27 | 240-MUM-2004-CLAIMS(COMPLETE)-(26-2-2004).pdf | 2018-08-09 |
| 28 | 240-MUM-2004-ABSTRACT(GRANTED)-(17-3-2008).pdf | 2018-08-09 |
| 29 | 240-MUM-2004-ABSTRACT(26-2-2004).pdf | 2018-08-09 |