Recombinant lubricin molocolet and uses thereof. Novel recombinnat lubricin molecules and their cros lubricants,and adhesive agents and/or intra-articular supplement for e.g. syaovial joints. meniscus. tendon, periontum, perticudinon andpleora, are provide.
1. An isolated recombinant protein comprising SEQ ID NOS: 9, 13, 17, 11 or 25.
2. An isolated recombinant protein comprising SEQ ID NO: 26 linked to N-1 repeat(s) of SEQ ID NO: 27, where N equals an integer from 3 through 25
3. The protein as claimed in claim 2, where N equals an integer from 5 through 25.
4. The protein as claimed in claim 2, where N equals an integer from 10 through 25.
5. An isolated recombinant protein comprising SEQ ID NO: 26 plus SEQ ID NO: 28 plus [N-2 repeat(s) of SEQ ID NO: 27] plus SEQ ID NO: 29. where N equals an integer from 10 through 25.
6. An isolated recombinant polynucleotide comprising a nucleic acid sequence encoding the protein as claimed in claim 1.
7. An isolated recombinant polynucleotide comprising a nucleic acid sequence encoding the protein as claimed in claim 2.
8. An isolated recombinant polynucleotide comprising a nucleic acid sequence encoding the protein as claimed in claim 3.
9. An isolated recombinant polynucleotide comprising a nucleic acid sequence encoding the protein as claimed in claim 4.
10. An isolated recombinant polynucleotide comprising a nucleic acid sequence encoding the protein as claimed in claim 5.
11. An isolated recombinant protein comprising SEQ ID NOS: 7, 11, 15, 19 or 23.
12. An isolated recombinant polynucleotide comprising a nucleic acid sequence encoding the protein as claimed in claim 11.
13. The polynucleotide as claimed in claim 6 wherein the polynucleotide comprises SEQ ID NOS: 8, 12, 16, 20 or 24.
14. The polynucleotide as claimed in claim 12 wherein the polynucleotide comprises SEQ ID NOS: 6, 10, 14, 18 or 22.
15. An isolated recombinant polynucleotide comprising a polynucleotide having at least 80% identity to SEQ ID NOS: 6, 10, 14, 18 or 22 over the entire length of the sequence.
16. The polynucleotide as claimed in claim 15 comprising a polynucleotide having at least 90% identity.
17. The polynucleotide as claimed in claim 15 comprising a polynucleotide having at least 95% identity.
18. The polynucleotide as claimed in claim 15 comprising a polynucleotide having at least 99% identity.
19. The protein as claimed in claims 1 or 2 wherein the protein is O-linkdd with ß-( 1- 3)-Gal-GaINac.
20. A composition comprising a therapeuiically effective amount of a protein as claimed in claim 19 in a pharmaceutically acceptable carrier.
21. The composition as claimed in claim 20 additionally comprising hya1uronan or hylan.
22. A compostiion for treating a tissue of a subject.
23. The composition as claimed in claim 22 wherein the tissue is selected from the group consisting of cartilage, synovium. meniscus, tendon. peritoneum, pericardium, and pleura.
24. The composition as claimed in claim 23 wherein the tissue is cartilage.
25. The composition as claimed in claim 22 wherein the subject is selected from the group consisting of a mouse, a rat, a cat, a dog, a horse and a human.
26. The composition as claimed in claim 25 wherein the subject is a human.
27. An expression "ector comprising the polynucleotide as claimed in claims 6 or 7 operably linked to an expression control sequence.
28. A method of producing recombinant protein comprising: growing cells transformed with the expression vector as claimed in claim 27 in liquid culture media; and collecting recombinant protein from the media.
29. The method as claimed in claim 28, wherein the collecting protein comprises: concentraiing the protein by filtering the media through a membrane: collecting the retained protein from the membrane; and solubilizing the collected protein in a buffered salt solution containing L-arginine hydrochloride ranging in concentration from 0.1 to 2.0 M.
30. The method as claimed in claim 29 wherein the L-arginine hydrochloride concentraiion is 0.5 M.
31. An isolated antibody specific for a protein as claimed in claims 1 or 2. Recombinant lubricin molocolet and uses thereof. Novel recombinnat lubricin molecules and their cros lubricants, and adhesive agents and/or intra-articular supplement for e.g. syaovial joints. meniscus. tendon, periontum, perticudinon and pleora, are provide.
WO 2005/016130 PCT/US2004/026508
DESCRIPTION
RECOMBINANT LUBRlCIN MOLECULES AND USES THEREOF
[001] The invention relates to novel recombinant lubricin molecules and their
uses as lubricants, anti-adhesive agents and/or intrft-articular supplements for, e,g,
synovial joints, meniscus, tendon, peritoneum, peticardium and pleura.
BACKGROUND OF THE INVENTION
[002] Optimal functionality of synovial joints is dependent upon extremely low
coefficients of friction between articulating tissues. Normally, a contiguous, well-
lubricated surface is maintained on articular cartilage. During osteoarthritis (OA),
however, reduced lubrication contributes to cartilage matrix degradation and fibrillation;
these in turn contribute to joint dysfunction and pain. Reduced lubrication also leads to
joint dysfunction and pain in other forms of arthritic including rheumatoid arthritis (RA).
[003] For other tissues (eg., tendons), a lubricated surface also contributes to
optimal functionality. In addition to requiring a lubricated surface, normal tendon
function requites the prevention of cellular adhesion to tendon surfaces. In flexor tendon
injury and repair, for example, the formation of tendon adhesions is the moat common
complication.
[004] Native lubricin protein is related to megakaryocyte stimulating factor
(MSP) prectusor protein. PRG4 (proteoglycan 4) is the name for MSF that has been
accepted for the UCL/HGNC/HUGO Human Gene Nomenclature database. PRG4 protein
(i.e., the MSF precursor protein) is described m US6433142 and US20O20137894 (all
patents and patent applications cited in this document are incorporated by reference in
their entirety). Polypeptide encoded by exon 6 of fes PRG4 gene is heavily glycosylated'
and appears necessary for a PRG4-relatcd protein to serve as a labdcant, e.g., between
surfaces of articular cartilage.
[005] Studies indicate that PRG4 glycoprotem is also synthesized by the intimal
synoviocytes that line tendon sheaths; it is highly likely that the glycoprotein also
originates from tenocytss (Rees et al,, 2002). The glycoprotein is prominently present in
fibrocartitaginous regions of tradon. In a manner complementary to its synovial-fluid
function, the glycoprotein may play an important cytoprotective role for tendons by
WO 2005/016130 PCT/US2004/026508
2
preventing cellular adhesion to tendon surfaces, as well as by providing tubrication during
normal tendon function
[006] Exon 6 of the PRG4 (also called lubricin") gene encodes approximately
76-78 repeats of KEPAPTT-similar sequences and 6 repeats of XXTTTX-like sequences.
5 Varying the number of comparable repeal sequences in recombinant lubricin proteins
according to the present invention allows for development of improved biotherapeutics for
enhancing lubrication in joints and for countering undesired adhesion between tissues.
SUMMARY OF THE INVENTION
[007] The present invention rebates to novel recombinanl lubricin molccules and
10 their use as lubricants, anti-adhesive agents and/or intra-articular supplements.
[008] In order to optimize expression parameters and investigate the functional
necessity of all approximately 76-78 KEPAPTT-similar sequences, lubricin expression
constructs were designed which enabled the synthesis of recombinant lubricin proteins
with varying degrees of O-linked oligosaceharide substitution. This is accomplished by
15 incorporating variable numbers of the KEPAPTT-like sequences into a "core" cDNA
construct comprised of exons 1 through 5, 5 - and 3'-flanking regions of exon 6, and exons
7 through 12. Iterative insertion of "synthetic cDNA cassettes" encoding multiple
KEPAPTT-like sequences facilitates the generation of recombiant lubricin constructs of
different sizes. The initial focus of these studies was on construct PRG4-Lub;l
20 (containing DNA of "synthetic cDNA cassette 1" (SEQ ID NO: 1), which encodes four
KEPAPTT sequences).
[009] The recombinant lubriccin proteins of the present invention share primary
structure with several isoforms of native human lubricin (see US6743774,
US20040072741, and WO0064930), Amoog charactetized isoforms, each, isoform differs
25 in the composition of PRG4 gene exons that encode the isoform's primary structure. For
examplet exons 1 through 12 of the PRG4 gene encode the V0 isoform, which represents
the full-length isoform, while exons 1 througb 4 and 6 through 12 encode the VI isoform,
which lacks only a segment encoded by exon 5. Exons 1 through 3 and 6 through 12
encode the V2 isoform, which lacks segments encoded by exans 4 and 5. Finally, exons 1,
30 3, and 6 through 12 encode the V3 isoform, which lacks segments encoded by exons 2, 4,
WO 2005/016130 PCT/US2004/026508
3
and 5. Other isoforms likely exist, and some related mutant proteins have been described
(seeUS20020086824).
[010] In particular, the present invention provides recombinant lubricin protein
comprising repetitive KJEPAFTT-like sequences. In preferred embodiments, the invention
5 provides isolated protein comprising SEQ ID NOS: 9, 13, 17, 21 or 25, The invention
provides in related embodiments isolated protein comprising SEQ ID NOS: 7, 11, 15, 19
or 23. In further related embodiments, the invention provides isolated polycucteotide
comprising nucleic acid sequence encoding recombinant lubricin protein. In preferred
embodiments, the invention provides isolated polynucleotide comprising nucleic acid
10 sequence encoding the protein. In further related embodiments, the invention provides
isolated polynucleotide having at least 80%, 85%, 90%, 93%, 97%, 98% or 99% identity
to SEQ ID NOS: 6, 10, 14, 18 or 22 over the entire length of the sequence.
[011] In related aspects, the present invention also provides an isolated protein
comprising SEQ ID NO: 26 joined to (N minus 2) reptat(s) of SEQ ID NO: 27, where N
15 equals an integer from 3 through 200. In further related embodiments, the present
invention provides an isolated protein comprising SEQ ID NO: 26 plus SEQ ID NO 28
plus [(N minus 2) repear(s) of SEQ ID NO: 27] plus SEQ ID NO: 29, where N equals an
integer from 3 through 200. ln embodiments of the related aspects of the invention noted
in this paragraph, more preferably N equals an integer from 5 through 50. and even more
20 preferably N equals an integer from 10 through 30.
WO 2005/016130 PCT/US2004/026508
4
WO 2005/016130 PCT/US2004/026508
5
[013] The invention also provides in related embodiments a composition
comprising a therapeutically effective amount of a recombinant hibticin protean in a
pharmateutideally acceptable carrier. In some exnbodments, the composition, additionally
comprises hyaluronan or hylan.
5 [014] The invention further provides a method of treating a subject comprising;
obtaining a. recombinant labricin protein composition; and administering said composition
to a tissue of the subject. In related eatbodiments of this method of the invention, the
tissue is selected from, the group consisting of cartilage, synovium, meniscus, tendon,
peritoneum, pericardium, and pleura. In further related embodiments of this method of the
10 invention, the method additionally comprises a step selected from the group consisting of:
providing an anesthetic to the subject; providing an anti-inflammatory drug to the subject;
providing an antibiotic to the subject; aspirating fluid from the subject; washing tissue of
the subject; and imaging tissue of the subject. In other related embodiments, the subject is
selected from the group consisting of a mouse, a rat, a cat, a dog, a horse, and a human.
WO 2005/016130 PCT/US2004/026508
6
[015] In other embodiments, the invention also provides an expression vector
comprising a polynucleotide encoding a recombmant lubricin protein wherein the
polynucleotide is operably linked to an expression control sequence. In related
ombodiments, the invention provides a method of producing recombinam lubricin protein
5 comprising: growing cells transformed with the expression vector in liquid culture media;
and collecting recombinant lubricin protein from the media. The collecting protein step
may further comprise: concentrating the protein by filtering the media through a
membrane; collecting the retained protein from the membrane; and solubilising the
collected protein in a buffered salt solution containing L-arginiae hydtrabloride ranging in
10 concentration from 0.1 to 2.0 M.
[016] In another related embodiment, the invention provides isolated antibody
specific for a recombinant lubricin protein.
[017] Other features and advantages of the invention will be apparent from the
following description of preferred embodiments thereof, and from the claims.
15 DETAILED DESCRIPTION OF THE INVENTION
[018] The base DNA construct utilized in generating recombinant lubricin
proteins may include variable arrangements of sequences 5T and 31 of exon 6 of the PKG4
gene, For example, the base DKA construct may include variable arrangements of
sequences encoding somatomedin B-lite domains (exons 2 through 4) or hemopexin-like
20 domains (exons 7 through 9).
[019] Embodiments of the base DNA construct having various extra
arrangements 3 of exoa 6 may include base DNA constructs that include only exon 7, 8,
9, 10,11, or 12 individual or exon pairs (7 and 8), (7 and 9), (7 and 10), (7 and 11), (7
and 12), (8 and 9), (8 and 10), (8 and 11), (8 and 12), (9 and 10), (9 and 11), (9 and 12),
25 (10 and 11), (10 and 12), or (11 and 12), or exon triplets (7, 8 and 9), (7, 8 and 10), (7, 8,
and 11) (7, 8, and 12), (7,9 and 10) (7,9 end 11), (7, 5 and 12), (7,10 and 11), (7,10 and
12), (7, 11 and 12), (8, 9 and 10), (8, 9 and 11), (8, 9 and 12), (8, 10 and 11), (8, 10 and
12), (8, 11 and 12), (9,10 and 11), (9, 10 and 12), (9, 11 and 12), or (10,11 and 12), or
exon quadruplets (7, 8, 9 and 10), (7, 8,9 and 11), (7, 8, 9 and 12), (7, 8, 10 and 11) (7, 8,
30 10 and 12), (7, 8, 11 and 12) (7, 9. 10 and 11), (7. 9, 10 and 12), (7,9,11 and 12), (7, 10,
11 and 12), (8, 9, 10 and 11), (8, 9,10 and 12), (8, 9, 11 and 12), (8,10,11 and 12), or (9,
WO 2005/016130 PCT/US2004/026508
7
10, 11 and 12), or exon quintcts (7, 8,9, 10 and 11), (7, 8, 9, 10 and 12), (7, 8, 9.11 and
12), (7, 8,10,11 and 12), (7, 9, 10, 11 and 12), or(8, 9,10,11 and 12), or extra sextet (7,
8,9, 10, 11 and 12).
[020] In addition, embodiments of the case ON A construct having various exon
5 arrangements 51 of exon 6 may include base DNA conducts that include only exon 1, 2,
3,4, or 5 individually, or own. pairs (1 and 2), (1 and 1), (1 and 4), (1 and 5), (2 and 3), (2
and 4), (2 and 5), (3 and 4). (3 and 5). or (4 and 5), or exon triplets (1, 2 and 3), (1, 2 and
4), (1, 2 and 5), (1, 3 and 4). (l, 3 and 5), (1, 4 and 5), (2, 3 and 4), (2, 3 and 5), (2,4 and
5). or (3, 4 and 5), or exon quadruplets (1, 2, 3 and 4), (1, 2. 3 and 5), (1,2,4 and 5), (l, 3,
10 4 and 5), or (2,3, 4 and 5) or exon quintets (1, 2, 3, 4 and 5).
[021] The present invention also encompasses proteins encoded by base DKA
constructs, i.e., wherein part or all of exon 6 sequence-encoded polypeptide is deleted and
no amino acids cnaoded by inserts from synthetic cDNA cassettes have beoa added.
[022] The present invention also encompasses polynucleotides that are
15 homologous to the specific embodiments outlined herein, e.g., having at least 80% 85%,
90%, 95%, 97%, 98% or 99% seqnence identity to the specified DNA sequences. The
invention further includes polynucleotides having nucleic acid sequence capable of
hybridizing over the length of a functional domain to the complement of the specified
DNA sequences undet high stringency conditions. The invention also includes proteins
20 encoded by these homologous or hybridizing polynucleotides.
[023] In order to delineate more clearty embodiments of the present invention,
the following defimitions are provided.
[024] Definitions, the phrase "repetitive KEPAPTT-like sequence" means an
amino acid sequence having at least 90%, 93 %, 95%, 96%, 97%, 98%, 99% or higher
25 identity to: (a) sequence nAPTTPKEPAPTTTKSAPTTPKEPAPTTTKEPAPTTPKBPAPTTTK"
(SEQ ID NO: 26; 45 amino acids) and having at least one O-linked substitutioni (b)
sequeacc "KEPAPTTTKEPAPTTTKSAPTTPKEFAPTTP" (SEQ ED NO: 27; 31 amino acids)
and having at least one O-linked substitution; or (c) seqnence
"EPAPTTKSAPTTPKEPAPTTP" (SEQ ID NO; 28; 22 amino acids) and having at least one
WO 2005/016130 PCT/US2004/026508
8
O-linked substitution. A repetitive KEPAPTT-like sequence may preferably have two,
three, four of more O-linked substitutions.
[025] While there exist a number of methods to measure identity between two
polynucleotide or polypeptide sequence, the term "identity" is well known to skilled
5 artisans and has a definite meaning with respect to a given specified method. Sequence
identity described herein is measured using the BLAST 2 SEQUENCES tool available
through NCBI (http//www.ncbi.nim.nih.gov/blast/: see also Tanisova and Madden
(1999). For amino acid sequences, the parameters used arc expect = 1000; ward size = 2;
filter off; and other parameters set to default values. These same parameters are used for
10 nucleic acid sequences, except word size = 8. Default values for amino acid sequence
comparisons are-: Malrix = BLOSUM62 open gap = 11; extension kap = I penalties; and
gap x dropoff = 50. Default values for nucleic acid sequence comparisons are: reward for
a match = 1; penalty for a mismatch = -2; strand option = both strands; open gap = 5;
extenaion gap = 2 penaldes; and gap x drppoff- 50.
15 [026] An G-linked substitution of recombinant lubricin may be a substitution
with, the lubricating oligosaccharide 8-(l-3)-Gal-GaINac, or with other moieties, including
artificial or naturall-occurring carbohydrate moieties (such as keratan sulfate or
chondroitin sulfate). In some embodiments, the O-linked substitution may be with
moieties that contribute to a capacity of recombinant lubricin to act as a carrier of surface
20 active phospholipid (SAPL) or surfactants (Hills, 2002). Percent glycosylation or
substitution is determined by weight (dry weight).
[027] High stringency conditions, when used in reference to DNA:DNA
hybridization, comprise conditions equivalent to binding or hybridization at 42ºC in a
solution consisting of 5X SSPE (43.8 g/l NaCl, 6.9 g/1 NaH3PO4 H2O and 1.85 g/l EDTA,
25 pH adjusted to 7.4 with NaOH), 0-5% SDS, 5X Denhardt's reagent and 100 mg/ml
denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE,
1.0% SDS at 42ºC when a probe of about 500 nucleotides in length is employed.
[028] Polypeptides or other compounds described herein are said to be "isolated"
when they are within preparations that are at least 50% by weight (dry weight) the
30 compound of interest. Polypeptides or other compounds described herein are said to be
"substantially pure" when they are within preparations that are at least 30% by weight (dry
WO 2005/016130 PCT/US2004/026508
9
weight) the compound of interest. Polypeptides or other compounds described heroin are
said to be "homogeneous" when they arc within preparations that are at least 95% and
preferably 99%, by weight (dry weight) the compound of interest Purity is measured by
reducing polyacrylamide gel electrophoresis and enhanced coomassic blue staining,
5 followed by optical density traces of bands (ie, with protein purity being measured
through optical densitometry).
[029] "Pyogen-free'' means fire of fever causing contaminants, including
endotoxin. Measurement of contaminants is to be performed by the applicable standard
teast set by the U.S, Food and Drug Administration.
10 [030] As used herein, the term "therapeutically effective amount" means the total
amount of each active component of the relevant pharmaceutical composition or method
that is sufficient to show a meaningful patient benefit, i.e., treatment, healing, prevention
or amelioration of the relevant medical condition, or an increase in rate of treatment,
healing, prevention or amelioration of such conditions. When applied to an individual
15 active ingredient, administered alone, the term refers to that ingredient alone. When
applied to 4 combination, the term refers to combined amount of the active ingredients
that result in the therapentic effect, whether administered in combination, serially or
simultaneously.
[031] Embodiments of the present invention may be used as intra-articular
10 supplements. Intra-articular supplemeutation with compounds not derived from. Lubricin
has been practiced as a joint therapy. For example, "viscosupplementation" with
polymeric hyaluronan (HA) and higher molecular weight hylans (such as SYKVTSOâ
elastoviscous fluid "Hylan G-F 20"-distributed by WYETR® Phamaceuticals) is used
clinically to treat OA-associaied knee pain. This viscosupplementation has shown
25 significant therapeutic value, particularly in reducing -weight-bearing pain in patients
(Wobig et al., 1998).
[032] Hylan G-F 20 is generated by cross-linking several HA molecules obtained
from rooster or chicken combs. Viscosupplementation with Hylan G-F 20 can be
significantly more efficacious for alleviating pain than viscosupplementation with lower
30 molecular weight HA (Wobig et al, 1999), In addition, relieving pain by
viscosupplemeniation with Hylan G-F 20 may be particularly preferable to administration
WO 2005/016130 PCT/US2004/026508
10
of NSAlDs for those patients who do not tolerate NSAIDs (e.g., in patients with a high
risk of gastrointestinal complications; Espallargues and Fons, 2003). Though Hylan G-F
20 viscosupplementation is a safe and well-tolerated therapy that provides a short-term
(i.e., until 3-6 months posttreatment) decrease in pain symptoms while improving joint
5 function, the therapy may not significantly forcstall the eventual need for knee
replacement in OA patients (Espallargues and Pona, 2003).
EXAMPLE 1: CLONING OF RECOMBINANT LUBRICIN
[033] Constructs, In some embodiments, the base DNA construct for the
generation of recombinant lubricin molecules is composed of the Met codon (ATG)
10 through the BssHIl restriction site (G^CGCGC) of SEQ ID NO: 6 (i,c, base nos. I through
1123) ami the BspEl restriction site (T^CCGGA) through the stop codon (TAA) of SEQ ID
NO: I (i.e. base nos. 1269 through 2946), These sequences, i.e., base nos, 1 tnnough 1123
and 1269 through 2946 of SEQ ID NO: 6 encode amino acids MI through S373 (encoded
by exons 1 through 5 and approximately 174 flanking S'-codons of exon 6) and E848
15 through P1404 (encoded by approximately 293 flanking 3'-codons of exon 6 and exons 7
through 14) of native full-length lubricin (i.e., PRG4). The portion of exon 6 absent from
the base DNA construct corresponds to DNA sequence encoding amino acids A374
through P847 of native PRG4 (474 amiao acids absent out of approximately 940 amino
acids encoded by exon 6). This absent amino acid sequence is rich in KBPAPTT-like
20 ecquencss.
[034] DNA sequence of synthetic cDKA cassette-1 (SEQ ID MO: 1) is added
BssHlllBspEl to the base construct to make the recombinant PRG4-Lub: 1 cDNA construct
(SEQ ID NO: 6). SEQ ID NO: 6 is composed of the Lub:l DNA insert (SEQ ID NO: 8;
which encodes the 51 amino acids of SEQ ID NO: 9 with its four KEPAPTT sequences)
25 between PNA encoding amino acids Ml through S373 and DNA encoding E848 through
P1404 rf native PRG4. In other words, in place of A374 through P847 (474 amino acids)
of native PRG4, the recombinant lubricin PRG4-LUB:1 includes 51 amino acids that form
four perfect KEPAPTT sequences and appioximately three imperfect KEPAFTT
sequences.
30 [035] DNA sequence of synthetic cDMA cassette-2 (SEQ ID NO: 3] is added
Bsu36llBspEI to the PRG4-Lub:l construct to make the PRG4-Lub:2 cDNA construct
WO 2005/016130 PCT/US2004/026508
11
(SEQ ID NO: 10). The FRG4-Lub:l cDNA construct has one Bstt36I restriction. site
(CC^TNAGG. i.e, CC^TAGG-, base nOS. 1225 through 1231 of SEQ ID NO: 6). When
(synthetic eDNA caesette-2 is added to the PRG4-Lub:l cDNA construct, this Bsu361 site
is destroyed, but synthetic cassetted contains another internal BsuB6I restriction site
5 (CC^TNAGG, ie. CC^TAAGG; base nOS. 92 through 98 of SEQ ID NO; 3). Consequently, a
PRG4-Lub:N+1 construct can be made by adding synthetic cDNA cassetto-2
Bsu36llBspEI to the previous PRG4-Lub:N construct at this internal Bsu36I restriction site
provided by synthetic cDNA cassette-2.
[036] The cDNA cassettes ore synthesized as single stranded oligomicleotides
10 and hybridized together to produce a double stranded DNA fragment with sticky ends.
This is why the terminal Bssll7, Bsu36l, and BspEl sites appear incomplete. In synthetic
cDNA cassette-1 (SEQ ID NO: 1), a sequence bounded by remnant flanking BssHll
(G^CGCGC) and BspEl (T^CCGGA) restriction sites includes an internal Bsu36l restriction
site (CC^TNAGG, ie.,(CC^TNAGG); the restriction sites are underlined below:
15 CGCGCCCACAACTCCAAAAGAGCCCGCACCTACCACGACAAAGTCAGCTCCTACTACGCCCA
AAGAGCCAGCGCCGACGACTACTAAAGAACCGGCACCCACCACGCCTAAGGAGCCAGCTCCT
ACTACAACGAAACCGGCACCAACCACTCCGG
[037] SBQ ID NO: 2, which is a translation of SBQ ID NO: 1, includes four
KEPAPTT sequeaccs that are perfect matches (highlighted below):
20 I A P T T P X B P A P T T TSSAPTT P
CGCGCCCACAACTCCAAAAGAGCCCGCACCTACACGACAAAGTCAGCTCCTACTACGCCC
21 K K P _A P P T T K G P _A P T__ T P K_ S P _A
AAAGAGCCAGCGCCGACGACTACTAAAGAACCGGCACCCACCACGCCTAAGGAGCCAGCT
25
41 PTTTKPAPTTP
CCTACTACAACGAACCGGCACCAACCACTCCGG
[038] Synthetic cDNA cassette-2 (SEQ ID NO; 3) similarly has a remnant 5-
30 terminal Bsu36I restriction site (i.e., CC^TNAGG, evidenced only by the TAA sequence), a
3T-terminal remnant BspEl restriction she (T^CCGGA), and an internal Bsu36I restriction
site (CC^TNAGG); the restriction sites are uaderlined below;
TAAGAACCAGCCCCTAGTACGACAAAGGAGCCTGCACCCACAACCACCGAAGAGCGACCCA
CAACACCAAAGGAGCCGGCCCCACGACTTCCTAAGGAACCCAAACCGGCACCAACCACTCCG
35 G
WO 2005/016130 PCT/US2004/026508
12
[039] SEQ ID NO; 4, which is a translation of SEQ ID NO: 3, includes three
KEPAPTT sequences that are perfect malcnes (highlighted below):
1 K L P _ _A P __T T T K E_P A_P T_ T T K S A P
TAAAGAACCAGCCCCTACTACGACAAAGGAGCCTGCACCCACAACCACGAAGAGCGCACCC
5
21 T T P K E P A P T T PKEPKFAPTT
ACAACACCAAACGAGCCGGCCCCTACGATCCTAAGGAACCCAAACCGGCAGCACCAACCACT
41 P
10 CCGG
[040] The recombinant PRG4-Lub;l cDNA. construct (SEQ ID NO: 6) in
pTmed2 vector (constrict plus vector equals SEQ ID NO: 5) is flanked by Sall (G^CGAC;
base nos. 1027 through 1032 of SEQ ID NO: 5) and Noll (GC^GGCCGC; base nos. 3984
15 through 3991 of SEQ ID NO: 5) restriction sites. The Sall site incorporates a modified
Kozak translation initiation sequence (CCCACC; base nos. 1032 through 1037 of SEQ ID
NO: 5) before the translation start codon ATG (base nos. 1038 through 1040 of SEQ ID
NO: 5). Herween the BssHII (G^CGCCC; base nos. 2155 through 2160 of SEQ ID NO: 5)
and BspEJ (T^CCCGA; base nos. 2306 through 2311 of SEQ ID NO: 5) restriction sites is
20 found the internal Bsu36l cloning ate (CCTNAGG. i,e, CC^TAAGG; base nos. 2262
through 2268 of SEQ ID NO: 5).
[041] The PRG4-Lub:l cDKA construct (SEQ CO NO; 6) is traslated into the
PRG4-LUB:1 protein (SEQ ID NO: 7), The insert between S373 and E425 (i.e., E848 of
native PRG4) of the entire PRG4-LUB:! protein (SEQ ID NO: 7) is the 51 amino adds of
25 SEQ ID NO: 9. These are translated from the Lub:l DNA insert (SEQ ID NO: 8) and
include four perfect KEPAPTT sequences. Between the BssHll restriction site (G^CGCGC;
base nos. 1118 through 1123 of SEQ ID NO; 6) and the BspEI restriction site (T^CCGGA;
base nos. 1269 through 1274 of SEQ ID NO: 6) is found the intenal Bsu36I cloning site
(CC^TNAGG, i.e, CC^TAAGG; base nos, 1225 through 1231 of SEQ ID NO: 6).
30 [042] As in the recombinani PRG4-Lub:l construct in pTmed2 vector, the
recombinant PKG4-Lub:2 cDNA constroct (SEQ ID NO: 10) in pTmed2 vector is flanked
by Sall (G^TCGAC) and Netl (GC^GGCCGC) restriction sites; the Soll site incorporates a
modified Kozak translation initiation sequence (CCCACC) before the translation start codon
ATG (base nos. 1 through 3 of SEQ ID WO: 10). Similarly, the reoombinant PRG4-Lub:3
WO 2005/016130 PCT/US2004/026508
13
cDNA construct (SEQ ID NO: 14), the recombinant PRG4-Lub:4 cDNA construct (SEQ
ID NO; 18). and the recombinant PRG4-Lub:5 cDNA construct (SEQ ID NO: 22) in
pTmed2 vector are each flanked by Sall (G^TCGAC) and Noil (GC^GGCCGC) restriction
sites; the Sall site incorporates a modified Kozak translation initiation sequence (CCCACC)
5 before the translation start codon ATG (base nos. 1 through 3 of SEQ ID NOS; 14, 18, and
22, respectively).
[043] Within the PRG4-Lub:2 cDNA construct, the internal Bsu36l cloning site
(CC^TNAGG, i.e., CC^TAAGG; base nos. 1318 through 1324 of SEQ ID NO: 10) is found
between the BssHll(G^CGCGC; base nos. 1118 through 1123) and BspEI (T^GCGGA; base
10 nos. 1347 through 1352) restriction sites. The PRO4-Lub:2 construct (SEQ ID NO: 10) is
translated into the PRG4-LUB:2 protein (SEQ ID NO: 11). The insert between S373 and
E451 (i.e.. E848 of native PRG4) of the entire PRG4-LUB:2 protein (SEQ ID NO: 11) is
the 77 amino acids of SEQ ID NO: 13. These are translated from the Lub:2 DNA insert
(SEQ ID NO; 12). In place of A374 through P847 (474 amino acids) of native PRG4, the
15 77 amino acids of the recombinant lubricin PRG4-LUB:2 form six perfect KEPAPTT
sequeaces and approximately four imperfect KRPAPTT sequences.
[044] Within the PRG4-Lub;3 cDNA construct, the internal Bsu361 cloning site
(CC^TNAGG, i.e., CC^TAAGG; base nos. 1411 through 1417 of SEQ ID NO: 14) is found
between BssHll (G^CGCGC; base nos, 1118 through 1123) and BspEI (T^CCGGA; base nos,
20 1440 through 1445) restriction sites. The PRG4-Lub:3 construct (SEQ ID NO: 14) is
translated into the PRG4-LUB:3 protein (SEQ ID NO: 15). The insert between S373 and
E482 (i.e,, E848 of native PRG4) of the entire PRG4-LUB:3 protein (SEQ ID NO: 15) is
the 108 amino acids of SEQ ID NO: 17. These are translated from the Lub:3 DNA insert
(SFQ ID NO; 16). In place of A374 through PB47 (474 amino acids) of native PRG4, the
25 108 amino acids af the recombinant lubricin PRG4-LUB:3 fbnn nine perfect KEPAPTT
sequences and approximately five imperfect KEPAPTT sequences.
[045] Within the PRG4-Lub:4 cDNA construct, the internal Bsu36I cloning site
(CC^TNAGG. i.e., CC^TAAGG; base nos. 1504 through 1510 of SEQ ID NO: 18) is found
between BssHll(G^CGCGC; base nos. 1118 through 1123) and BspEI (T^CCGGA; base nos.
30 1533 through 1538) restriction sites. The PRG4-Lub:4 construct (SEQ ID NO: 18) is
translated into the PRG4-LUB:4 protein (SEQ ID NO: 19). The insert between S373 and
WO 2005/016130 PCT/US2004/026508
14
E513 (it, E848 of native PRG4) of the entire PRG4-LUB:4 protein (SEQ ID NO; 19) is
the \39 amino acids of SEQ ID NO; 21 These are translated from the Lub:4 DNA insert
(SEQ ID NO:20). In place of A374 through PS47 (474 amino acids) of native PRG4, the
139 amino acids of the rccombinant lubricin PRG4-LUB:4 form twelve perfect KEPAPTT
5 scquences and approximately aix imperfect KEPAPTT scquences.
[046] Within the PRG4-Lub;5 cDNA construct, the internal Bsu36l cloning site
(CC^TNAGG, i.e., CC^TAAGG; base nos. 1597 through 1603 of SEQ ID NO: 22) is found
between BssHll (G^CGCGC; base nos. 1118 through 1123) and BspEl (T^CCGGA; base nos,
1626 through 1631) restriction sites. The PRG4-Lub:5 construct (SEQ ID NO; 22) is
10 translated into the PRG4-LUB:5 protein (SEQ ID NO: 23). The insert between 5373 and
E544 (i.e., E848 of native PRG4) of the entire PRG4-LUB:5 protoin (SEQ ID NO: 23) is
the 170 amino acids of SEQ ID NO: 25. These are traslated from the Lub:S DHA insert
(SEQ ID NO:24). In place of A374 through P847 (474 amino acids) of native PRG4, the
170 amino acids of the recombinant lubricin PRG4-LUB:5 form fifteen perfect KEPAPTT
15 sequences and approximately seven imperfect KEPAFTT sequences.
[047] Importantly, the process of inserting the synthetic cDNA cassette-2 can be
iterated indefinitely. Each iteration results in the addition of three perfect KEPAFTT
sequences. Just as recombinant lubricins PRG4-LUB:2 through PRG4-LUB:5 are
constructed in this way through the use of insert sequences, recombinant lubricins PRG4-
20 LUB:6 through PRG4-LUB;N are constructed. Table 2 provides a summary of
BssHllBspEl insert sequences.
WO 2005/016130 PCT/US2004/026508
15
[049] Although we have exemplified the base IDNA construct with full-length
PRG4 containing all 12 exons (minus a central portion of exon 6), splice variants of PRG4
WO 2005/016130 PCT/US2004/026508
16
may also be employed, depending an the various activities and lengin. desired.
Additionally, different restrictions enzymes may be employed in an analogous strategy,
providing that their location is conveniently located within nucleic acid sequence encoding
PRG4 protein. In other embodiments, the base DNA construct lacks native exon 6
5 sequence, but includes one or more of exon 1 through CXOn 5 sequences or of exon 7
through exon 12 sequences of the native PRG4 gene. In other embodiments, the base
DMA construct is identical to a recombinant MSF sequences described in US6433142 or
U520020137804 except that part or all of the sequences of exon 6 are absent.
[050] The invention provides cDNA constructs encoding recombinant lubricins
10 that are cloned into SatI (G^TCGAC; base nos. 1027 through 1012 of SEQ ID NO: 5) and
Notl (GC^GGCCGC: base nos- 3984 through 3991 of SEQ ID NO: 5) restriction sites in the
eucaryotic expression vector pTmed2 as a preferred embodiment (e.g., recombinant
PRG4-Lub:l cDNA construct in pTtaed2 expression vector is located in SEQ ID NO; 5 at
base nos, 1038 though 3983). The Sail site incorporates the first base of a modified Kozak
15 translation initiation sequence (CCCACC; base no, 1032 of SEQ ID NO: 5) before the
methionine start codon (ATG; base nos. 1038 through 1040 of SEQ ID NO: 5), Other
embodiments of the invention include other restriction site combinations and other
expression vectors,
[051] In a preferred embodiment, the interative process makes use of the
20 synthetic cDNA cassette-1 (SEQ 3D NO:1) in expression vector pTmed2, which is
flanked by the restriction sites for BssHll (G^CGCGC) and BspEI (T^CCGCA), and the
synthetic cDNA cassette-1, which includes an internal Bsu36l restriction site (CC^TNAGG.
i.e., CC^TAAGG; base nos. 107 to 113 of SEQ ID NO: 1). For the iterative generation of
recombinant lubricin constructs containing KEPAPTT-like sequences in this preferred
25 embodiment, synthetic cDNA cassette-2 (SEQ ID NO: 3) is inserted between the Bsu36I
and BspEI sites of the recombinant construct Syndetic cDNA cassette-2 (SEQ ID NO: 3)
is flanked by a modified remnant Bsu361 site (TAAAG) and a remnant BspEI (ACTCCGGG)
site. It also includes an internal Bsu36I site (CC^TNAGG, i.e., CC^TAAGG; base nos. 92
through 98 of SEQ ID NO: 3). Upon cloning synthetic cDNA cassettc-2 into the Bsu36I
30 and BspEI sites of a recombinant lubricin construct, the Bsu36l cloning sine of the original
construct is destroyed leaving one unique Bsu36I cloning site in the new construct.
WO 2005/016130 PCT/US2004/026508
17
[052] In this preferred embodiment, the amino acid sequence "APTTPKEPAPTT
TXSAPTTPKEAPTTTKEPAPTTPKEPAPTTtK (SEQ ID NO: 26: 45 amino acids) remains
a part of each PRG4-LDB:N protein (whene N = an integer of 1 or more). In addition, the
amino acid sequence "KEPAPTTTKEPAPTTTKSAPTTPKEPAPTTP" (SEQ ID NO: 27; 31
5 ammo acids) is encoded by the DNA insert that becomes part of each PRG4-Lub:N+l
cDNA construct through the addition of synthetic cDNA cassctte-2 Bsu36llBspEI to a
PRG4-Lub:N cDNA construct For PRG4-LUB;N protein where N is an integer greater
than or equal to 3, the amino acid sequence "EPAPTTTKSAPTTPXEPAPTTP" (SEQ ID NO:
28; 22 amino acids) joins SEQ ID NO: 26 to (N minus 2) repcats of SEQ ID NO; 27 in
10 preferred embodiments. Futhemore, the amino acid sequence "KEPAPAPTTP" (SEQ ID
NO; 19; 10 amino acids) immediately follows the lest insert repeat of SEQ ID NO; 27 in
preferred embodiments of the PRG4-LUB:N protein where N is an integer greater than or
equal to 2.
[053] Because they form at least two KEPAPTT sequences, SEQ ID NO: 26,
15 SEQ ID NO: 27. and SBQ ID NO: 23 arc each designated herein to be a "repetitive
KEPAPTT-like sequence" (the N-terminus of SEQ ID 28 links to a K residue so that SEQ
ID NO: 28 forms two KEPAPTT sequences in PRG4-LUB;N proteins).
[054] Consequently, for recombinant lubricin protein PRG4-LUBN (where N
equals an integer of 1 or more), the PRG4-LUB;N protein comprises SEQ ID NO: 26 in a
20 preferred embodiment Furthermorer for recombinant lubricin protein PRG4-LUB;N
(where N equals an integer of 2 or more), the PRG4-LUB:N protein also comprises SEQ
ID NO: 27 in a preferred embodiment SEQ ID NO: 27 is repeated (N minus 1) times
within each PRG4-LUB:N protein in these preferred embodiments. In PRG4-LUB2., SEQ
ID NO: 26 and SEQ ID NO: 27 overtop (i.e, they share a KEPAPTT sequaence).
25 [055] In other preferred anbodiments where N is an integer greater than or equal
to 3 (e.g,, where N equals an integer from 3 through 200, or in more preferred
embodiments where N equals an integer from 5 through 50, or in even more preferred
embodiments where N equals an integer from 10 through 30), recombinant lubricin protein
comprises the 22 amino acids of SEQ ID NQ: 28 joining the N-terminal-oriented 45 amino
30 acids of SEQ ID NO: 26 to (N minus 2) repeat(s) of the 31 amino acids of SEQ ID NO:
WO 2005/016130 PCT/US2004/026508
18
27. where the 10 amino acids of SEQ ID NO: 29 are C-terminal to the last 31-amino-acid
repeat of SEQ ID NO: 27.
[056] Table 3. Sequence Frequencies in Preferred PRG4-LUB Proteins
[057] PRG4-LUB:N proteins in general have (3 times N) repeals of the
5 KBPAPTT sequence in preferred embodiments where N equals the number of repetitive
KEPAPTT like sequences. Recombinant lubricin PRG4-LUB:5 (having 3xN = 3x5 =
15 copies of the KEPAPTT sequence in preferred embodiments) is the largest recombinant
lubricin PRG4-LUB:N whose sequence is detailed herein. For recombinant lubricin of the
preset invention, however, the value N may be greater than 5, such as 7, 10, 12, 15, 20,
10 25,30,40, 50,100,150,200 or more.
[058] In particular, proteins PRG4-LUB:1, PRG4-LUB;2 PRG4-LUB;3 PRG4-
LUB;4, and PRG4-LUB:5 are detailed herein with 4, 6, 9, 12 and 15 perfect KEPAPTT
sequences, respectively. However, it is possible to add increasing numbers of KEPAPTT
sequences by continuing the iterative Lub:N insert procedure described herein. We have
15 provided detailed description for PRG4-LUB:N recombinant lubricins with relatively low
manbers of KEPAPTT or KEPAPTT-like sequences as compared with native
PRG4/lubricin protein because smaller proteins are easier to synthesize ami manipulate.
[059] It may also be desirable tn increase the number of KEPAPTT-like
sequences over that seen in native PRG4 ptotein. This can be accomplished either by
20 continuing the iterative Lub:N insert procedure described herein so that there are more
than 78 KEPAPTT-like sequences in the recombinant lubricin PRG4-LUB:N protein, or
WO 2005/016130 PCT/US2004/026508
19
by beginning with an intact PRG4 cDNA, rather than an exan 6-deleted or an exon 6-
diminished version of PRG4 cDNA. Thus any KEPAPTT-like sequences added will be in
excess of the number found in native PRG4 protein. Insert procedures used for the
generation of larger recombinant lubricin proteins from an intact PRG4 cDNA, as well as
5 insert procedures that use an exon 6-deleted or an exon 6-diminisbed version of PRG4
cDNA, arc encompassed within the invention.
EXAMPLE 2; EXPRESSION AND PURIFICATION OF 'LUB' PROTEIN
[060] PRG4-Lub:1 cDNA construct (SEQ ID MO: 6: containing synthetic cDNA
cassette-1 sequence) was expressed in a stably transfected, preadaptive CHO DUKX cell
10 line, purified from conditioned media, and solubilized in. PBS containing 500 mM L-
arginine bydrocaloride at follows.
[061] The PRG4-Lub:l cDNA construct was expressed in a stably traosfeotcd
CHO DUKX cell line and the conditioned media was collected. A two liter volume of this
conditioned madia was filter concentrated under compressed nitrogen ges (40 psi) uaing an
15 AMICON® M2000™ filtration unit fitted with cither a 10 kDa nominal molecolar weight
limit (NMWL), a 30 kDa NMWL or a 100 kDa NMWL PALL FILTRON® OMEGA™
disc membrane- Media was concentrated to approximately a 100 ml volume, which was
aspirated from the disc membrane. The disc membrano was then removed from the
AMTCON® M2000™ filtration unit The "mucinous" retemate, which had accumulated at
20 the surface of the disc membrane, was hervested using a cell scraper and transferred to
microcentrifuge tubes. The samples in the microcentrifuge rubes were centrifuged at
approximately 12,000 x. g for 10 minutes, and the aqueous snpematant was removed. The
remaining "lubricin-eniched" pellets were dissolved in phosphate buffered saline (PBS)
containing 500 mM L-arginine hydrocbloride. The L-arginine hydrochloride
25 concentraticm may range from 100 mM to 2.0 M.
[062] Using the above procedtue, PRG4-LUB:2 through PRG4-LUB:5
glyooproteins (and PRG4-LUB;N proteins Where N = a nonnegative integer of 6 or more,
as well as other glycoproteins containing KEPAPTT-like sequences) are harvested directly
from disc membranes, i.e., without pinification of the concentrate remaining above disc
30 membranes. That is, these recombinant hibricin glycoproteins are isolated directly from
disc membranes of 10 kDa NMWL, 30 kDa NMWL, or 100 kDa NMWL PALL
WO 2005/016130 PCT/US2004/026508
20
FILTRON® OMEGA™ filtration units, In some instances, these glycoproteins may also
be purified from the concentrate remaining above dise membranes through
chromatographic techniques or electrophoretic techniques or both. Recombinant lubricin
proteins and glycoprateins may also be purified using chrgmatography and other
5 techniques known in the art (as, for example, described in. US6433141 for MSF proteins;
see also: Deutscher, 1990; and Scopes, 1994),
EXAMPLE 3: IMMUWOHJSTOCHEMISTRY
[063] The cell source of lubricin in normal and osteoarthritic joints was further
investigated using immunohistochemical techniques. In addition, the practice of lubricin
10 on other tissue surfaces, including pleura, pericardium, peritoneum, and meninges, was
examined sccording to the following methods.
[064] Osteoarthritic cartilage and synovium were obtained by informed consent
from patients uadergoing knee replacement surgery. Other tissues examined were normal
human synovium and normal non-human primate (NHP) synovium, cartilage, pleura,
15 pericardium, peritoneum, meninges, brain, tendon, and ligaments, and canine normal and
osteoarthritic meaiiscus, cartilage, synovium, ligament, and tendons. Tissues were fixed in
4% paraformaldehyde immediately after harvest or following 34 hours incubation in
media without and with supplemental monenstn (5 mM). FOr immunohistochemical studies
the tissues were fixed in 4% paraformaldehyde for 24 hours and 6-8 micron paraffin
20 sections were obtained- A subset of tissues were frozen in optical coherence tomography
(OCT) freezing compound and cut at 5 to 10 micron intervals followed by acetone
fixation.
[065] Immnuohistochemical and immumoftuorescent analyses utilized a purified
polyclonal rabbit anti-buman lubricm antibody (Ah 06A10) geaerated by immumzation
25 with a truncated form of recombinant lubricin and purification on a protein A column.
CD 16 antibody (NEOMAKKERS®, Fremont CA) was used to Identify macrophages (Fey
receptor III). CD106/VCAM-1 antibody (NEOMARKERS®) was used to label flbroblasts
within cryostet sections. For control sections, an equivalent concentration of RlgG
(VECTOK LABS TM, CA), MlgGI (DARO®). and MIgGI, (DAKO®) was used
30 consecutively. The Dextian Technology System (ENVKSION+TM; DAKO®) was used to
visualize antibody binding and me sections were counterstained with Mayer's alum
WO 2005/016130 PCT/US2004/026508
21
hcmatoxylin, Immunofluorescence was performed using the above primary antibodies and
proted with secondary antibodies (Alexa Dyes MOLECULAR PROBES™, Oregon)
goat anti-rabbit Alexa dye at 546 nm and goat anti-mouse Alexa dye at 488 nm.
Fluorescent binding of the antibody was detected with a NIKON® fluorescent microscope.
5 [066] Lubricin was delected along the surfaces of normal and csteoarthritic
human articular cartilage and synovium. A thick layer of lubricin completely coated the
fibrillated osteoanthritic surface. CD106 immunofluoresccnce showed strong cell
membrane staining of the intirnal fibroblasta of the synovium; lubricin protein was also
visualzed as staining within syaovial cells. Double immunostaining for CD1064lubricin,
10 clearly showed co-localization within the intirnal fibroblasts of the synovium. CD16
staining of synovial macrophages demoostrated the presence of these cells throughout the
layem of the synovium, but there was no co-localization with lubricin,
[067] Staining of NHP and canine articular tissues (normal and OA) with the
lubricin antibody showed lubricin coaring the surface layer of the synovium, cartilage,
15 meniscus, and tendons. NHP cartilage also showed strong immunoreactivity not only in
the superficial zone cells but also the transitional zone cells without the addition of
monensin to increase intracellular stores of the glycoprotein Cells lining the peritoneum,
peticardium, and pleura also exhibited lubricin expression, though no immunoreactivity
was observed in the meninges or brain.
20 [068] In summary, both normal and osteoarthritic synovium, tendon, meniscus
and cartilage were coated by a substantial layer of lubricin. The glycoprotein is clearly
present on tissues within OA joints. Double-nnmunofluorescent staining of humen. OA
synovium demonstrated that the internal fibroblast synoviocytes were responsible for the
synthesis of lubricin.
25 [069] The localization of lubricin protein outside joint tissue has not been
previously described. A surface layor of lubricin was clearly demonstrated on hmg pleura,
pericardium, and peritoneum, Lubricin is reputed to have a lubricating function within the
synovial joint, but may have multiple roles including, but not limited to, lubrication and
anti-adbesive fimctions. in other tissues. Supplementation of these other tissues with
30 lubricin is a biotherapy encompassed within this invention.
WO 2005/016130 PCT/US2004/026508
22
EXAMPLE 4: RECOMBINANT LUBSlClN AS A MECHANICAL LUBRlCANT
[070] Rocambinant lubricin could be used as a Lubricant geneisily, e.g., with seals
and bearings and the like. For example, US39737S1 entitled "Self-lubricating seal,"
US4491331 entitled "Grooved mechanical face seal," US4560174 entitled "Multi lip seal,"
5 and US4973068 entitled "Differential surface roughness dynamic seals and bearings,"
each describe scals of varying designs, Recombinant tubricin could be used as a lubricant
with these seals.
[071] In particular reeombinant lubricin could be used as a lubricant for medical
devices, prostheses, and implants, particularly where a biocompatible lubricant is required,
10 In addition, the applications need not be medical, but could include applications in
envitonmeotally sensitive contexts where a biocompatible lubricant may be desirable.
EXAMPLE 5: RECOMBINANT LUBRICIN COMPOSITIONS
[072] A recombinant lubricin of the present invention may be used in a
phamaceutical composition when combined with a phamaceutically acceptable carrier.
15 Such a composition may also contain (in addition 10 protein and 8 carrier) diluents, fillers,
salts, buffers, stabilizers, solubillzets, and other materials well known in the art. The term
"pharmaceutically acceptable" means a non-loxic material that does not interfere with the
effectiveness of the biological activity of the active ingredient(s). The characteristics of the
carrier will depend on the route of administration. The pharmaceutical composition of the
20 invention may also contain cytokines, lymphokines, or other hematopoietic factors such as
M CSF, GM-CSF, TNF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11,
IL-12, IL-13, IL-14, IL-15, TNF1 TNF2,. G-CSF, Meg-CSF thrombopoietm, stern cell
factor, and erythropoietin. The phannaceutical composition may further contain other
agents which either enhance the activity of the protein, or complement its activity or use in
25 treatment Such additional factors and/or agents may be included in the pharmaceutical
composition to produce a synsrgistic effect with protein of the invention, or to minimize
side effects. Conversely, protein of the present invention may be included in formulations
of the particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-
thrombotic factor, or anti-inflamnatory agent to minimize side effects,
30 [073] Use of recombinant lubricin protoin for intra-articular supplementation in
combination with the previously described polymeric hyaluronan (HA) and higher
WO 2005/016130 PCT/US2004/026508
23
molecular weight hyisns is particularly prefentd. Other preferred combinations for use in
intra-articular supplementation include the use of reconabinant lubricin protein with
anesthetics (e.g., lidocaine), steroids (e.g., triamcinolone hexacetemide), or radioisotopts
(eg., yttrium). Other preferred combinations for use in intra-articular supplementation
5 may include autologous or heterologous cell preparations (eg,, of cultured chondrocytes,
synoviocytes, or stem ceils, whether autologously or hctcnilogously derived).
[074] A rocombinant lubricin of the present invention may be active in multimers
(e.g., heterodimcrs or homodimors) or complexes with itself or other proteins. As a result,
pharmaceutical compositions of the invention may comprise a protein of the invention in
10 such multimeric or completed form,
[075] A pharmaceutical composition of the invention may be in the form of a
complex of tbc rescombinant lubricin protein(s) of present invention along with protein or
peptide antigens. The protein aud'or peptide antigen will deliver a stimulatory signal to
both B and T lymphocytes. B lymphiscytes will respond to antigen through their surface
15 immunoglobulin receptor. T lymphocytes will respond to antigen through the T cell
receptor (TCR) following presentation of the antigen by MHC proteins. MHC and
structurally related proteins including those encoded by class I and class H MHC genea on
host ceils will serve to present the peptide antigen(s) to T lymphocytes. The antigen
componsits could also be supplied as purified MHO-peptide complexes alone or with co-
20 stimulatory molecules that can directly signal T cells. Alternatively antibodies able to bind
surface immunolgobulin and other molecules on B cells as well as antibodies able to bind
the TCR and other molecules on T cells can be combined with the pharmaceutical
composition of the invantion.
[076] A pharmaceutical composition of the invention may be in the form of a
25 liposonie in which protein of the present invention is combined, in addition to other
phannaceutically acceptable carriers, with amphrpathic agents such as lipids which exist in
aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in
aqueous solution. Suitable lipids for liposomal formulation include, without limitation,
monoglycerides, diglyocrides, suliatidcs, lysolecithin, phospholipids, saponin, bile acids,
30 and the like. Preparation of such liposomal formulations is within the level of skill in the
art, as disclosed, for example, in US4235871, US450172S, US4837028, and US4737323,
WO 2005/016130 PCT/US2004/026508
24
[077] In practicing the method of treatment or use of the present invention, a
therapeutically effective amount of protrin of the present invention is administered to a
subject (e.g,, a mammal) having a condition to be treated Protein of the present invention
may be administered in accordance with the method of the invention either alone or in
5 combination with other therapies such as treatments employing Cytolrines, lymphokines,
other homatopoictic factors, or cell-based supplements. When co-administered with, one or
more cytokincs, lymphokinea, other hematopoietic fetors, or cell-based supplements,
protein of the present invention may be administered either simultaneously with the
cylokine(s), lymphokinc(s), other hematopoictic factor(s), thrombolytic or anti-thrombotic
10 factors, or cell-based supplement, or sequentially. If administered sequentially, the
attending physician will decide on the appropriate sequence of administering protein of the
present invention in combination with c-ytokine(s), lymphokine(s), ether hematopoietic
factor(s). thrombolytic or anti-thrombotic factors, or cett-based supplement.
[078] Administration of protein of the present invention used in the
15 pharmaceutical composition or to practice the metthod of the present invention can be
carried out in a variety of conventional ways, such as cutaneous, subcutaneous,
intraperitoneal, parenteral or intravenous injection, or, in some instances, oral ingestion,
inhalation, topical application. Administration to a patient by injection, into joint tissue is
generally preferred (Schumacher, 2003).
20 [079] When a thorapeutically effective amount of protein of the present invention
is administered orally, protein of the present invention will be in the form of a tablet,
capsule, powder, solution or elixir. When administered in tablet form, the pharmaceutical
composition of the invention may additionally contain a solid carrier such as a gelatin or
an adjuvant. The tablet, capsule, and powder contain from about 5 to 95% protein of the
25 present invention, and preferably from about 25 to 90% protein of the present invention.
When administered in liquid form a liquid carrier such as water, petroleum, Oils of animal
or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils
may be added. The liquid form of the pharmaceutical composition may further contain
physiological saline solution, dextrose or other saccharide solution, or glycols such as
30 ethylenc glycot, propylene gtycol or polyethylene glycol. When administered in liquid
form, the pharmaceutical composition contains from about 0.5 to 90% by weight of
WO 2005/016130 PCT/US2004/026508
25
protein of the present invention, and preferably from about 1 to 50% protein of the present
invention.
[080] When a therapeutically effective amount of protein of the present invention
is administered by intravenous, cutaneous or subcutaneous injection, protein of the present
5 invention will be in the form of a pyrogen-free, parenterally acceptable aqueous solution,
The preparation of such parenteralty acceptable protein solutions, having due regard to
pH, isotonicity, stabtlity, and the like, is within the skill in the art. A preferred
pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should
contain in addition to protein of the present invention, an isotonic vehicle such as Sodium
10 Chloride Injection, Rigger's Injection, Dextrose Injection, Dextrose and Sodium Chloride
Injection, Lactatod Rinnger's Injection, or other vehicle as known in the art. The
pharmaceutical composition of the present invention may also contain stabilizers,
preservatives, buffers, antioxidants, or other additives known to those of skill in the art.
For example, injection in association with, or in combination with, lidocaine or other local
15 anesthetic, steroids or adrenocorticoids, HA and/or hylans, or radioisotopes are all
cncompassed within by the present invention.
[081] The amount of protein of the present invention in the pharmaceutical
composition of the present invention will depend upon the nature and seventy of the
condition being treated, and on the nature of prior treatments which the patient has
20 undergone. Ultimately, the attending physician will decide the amount of protein of the
present invention with which to treat each individual patient Initially, the attending
physician will administer low doses of protein of the present invention and observe the
patient's response. Larger doses of protein of the present invention may be administered
until the eptimal therapeutic effect is obtained for the patient, and at that point the dosage
25 is not increased further. It is contemplated that the various pharmaceutical compositions
used to practice the method of the present invention should contain about 0.01 mg to about
100 mg (preferably aboul 0.1 ng to about 10 mg, more preferably about 0.1 mg to about 1
mg) of protein of the present invention per kg body weight depending on the method of
administration and the exact therapeutic course implemented.
30 [082] If administered intravenously, the duration of intravenous therapy using a
pharmaceutical composition comprising recombinant lubricin of the present invention will
WO 2005/016130 PCT/US2004/026508
26
vary, depending on the severity of the disease being treated and the condition and potential
idiosyncratic response of each individual patient It is contemplated that the duration of
each application of the protein of the present invention may be in the range of 12 to 24
hours of continuous intravenous administration. Ultimately the attending physician will
5 decide on the appropriate duration of intravenous therapy using, the phamaceutical
composition of the present invention.
[083] For compositions of the present invention which are useful for bono,
cartilage, tendon or ligament therapy, the therapeutic method includes administering the
composition topically, systenistically , or locally as an implant or device. When
10 administered, the therapeutic composition for use in this invention is, of course, in a
pyrogen-free, physiologically acceptable form. Further, the composition may desirably be
encapsulated or injected in a viscous form for delivery to the site of bone, cartilage or
tissue damage. Topical administration may be suitable for in some wound healing and
tissue repair contexts. Therapeutically useful agents which may also optionally be
15 included in the composition as described above, may alternatively or additionally, be
administered simultaneously or sequentially with the composition, comprising recombinant
lubricin protein of the invention in the methods of the invention. Preferably the
composition would include a matrix capable of delivering the protein-containing
composition to the site of bone and/or cartilage damage, possibly capable of providing a
20 structure for the developing bone and cartilage, and optimally capable of being resorbed
into the body. Such matrices may be formed of materials presently in use for other
implanted medical applications.
[084] If a matrix is used, the choice of matrix material is based on
biocompatibility, biodegradability, mechanical properties, cosmetic appearance and
25 interface properties. The particular application of the compositions will define the
appropriate formulation. Potential matrices for the compositions may be biodegradable
and chemically defined calcium sulfate, tricalchinrphosphate, hydroxyapalite, polylactic
acid, polyglycolic acid and polyanbydrides. Other potential materials are biodegradable
and biologically well-defined, such as bons or dermal collagen. Further matrices are
30 comprised of pure proteins or extracellular matrix components. Other potential matrices
are nonbiodegradable and chemically defined, such as sintered hydroxapatite, bioglass,
WO 2005/016130 PCT/US2004/026508
27
aluminates, or other ceramics. Matrices may be comprised of combinations of any of the
above mentioned types of material, such as polylactic acid and hydroxyapatite or coliagen
and tricalciumphosphate. The bioceramics may be altered in composition, such as in
caltium-aluminate-phasphate and processing to alter pore size, particle size, particle
5 shape, and biodegradability.
[085] In further compositions, proteins of the invention may be combined with
other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or
tissue in question. These agents include various growth factors such as epidermal growth
factor (EGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-a
10 and TGF-b). and insulin-like growth fector (IGF)-
[086] The therapeutic compositions are also presently valuable for veterinary
applications. Particularly domestic animals such as cats and dogs, laboratory animals such
as mice and tats, as well as horses, is addition to humans, are particularly desired subjects
or patients for such treatment with recombinant tubrictn proteins of the present invention.
15 [087] The dosage regimen of a protein-containing pharmaceutical composition to
be used in tissue regeneration will be determined by the attending physician considering
various factors which modify the action of the proteins e,g., amount of tissue weight
desired to be formed, the site of damage, the condition of the damaged tissue, the size of a
wound, type of damaged tissue (e.g., cartilage or tendon), the patient's age, sex, and diet,
20 the severity of any infection, time of administration and other clinical factors. The dosage
may vary with the type of matrix used in the reconstitution and with inclusion of other
proteins in the pharmaceutical composition. For example, the addition of other known
growth facters, such as IGF I (insulin like growth factor I), to the feal composition, may
also effect the dosage. Progress can be monitored by periodic assessment of tissue/bone
25 growth and/or repair, for example, X-rays, histomorphometric determinations and
tetracycline labeling.
[088] Polynudeotides of the present invention can also be used for gene therapy,
Such polynucleotidss can be introduced either in vivo or ex vivo into cells for expression
in a subject (e.g., a mammal). Polynucleotides of the invention may also be administered
30 by other known methods for introduction of nucleic acid into a celll or organism
(including, without limitation, in the form of viral vectors or naked DNA).
WO 2005/016130 PCT/US2004/026508
28
[089] Cells may also be cultured ex vivo in the presence of nucleic acids or
proteins of the present invention in order to proliferate or to produce a desired effect an or
activity in such cells. Treated cells can then be introduced in vivo for therapeutic purposes.
EXAMPLE 6; ANTI-LUBRICIN ANTIBODIES
5 [090] Recombinant lubricin protein of the invention may also be used to
immunize animals to obtain polyclonal and monoclonal antibodies which specifically react
with the protein or, in some embodiments, its native counterparts. Such antibodies may be
obtained using either complete recombinant lubricin protein or fragments thereof as an
immunogen The peptide immunogens additionally may contain a cysteine residue at the
10 carboxyl terminus, and art conjugated to a hspten such as keyhole limpet hemocyanin
(KLH). Methods for synthesizing such peptides are known in the art (for example, as in
Merrifield, 1963; and Krstennsky et al., 1987), Monoclonal antibodies binding to
Tecombinant lubricin protein of the imvention may be useful diagnostic agents for the
immunodetection of related proteins. Neutralizing monoclonal antibodies binding to these
15 related proteins may also be useful therapeutics for both conditions associated with
lubricin or, in same cases, in the treatment of some forms of cancer where abnormal
expression of lubricun may be involved (e.g., in synoviomas).
[091] In addition to antibodies which are directed to the polypeptide core of a
recombinant lubricin. protein, an antibody directed to a sugar portion or to a glycoprotein
20 complex of recombinant lubricin protein is desirable. In order to generate antibodies
which bind to glycosylated recombinant lubricin (but not to a deglycosylated form), the
immupogen is preferably a glycopeptide, the amino acid sequence of which spans a highly
glycosylated portion of the recombinant lubricin, e.g., a repetitive KEPAPTT-Iike
sequence- Shorter glycopeptides, e.g., 8-15 amino acids in length, within the same highly
25 glycosylated region, are also used as immraogens. Methods of generating antibodies to
highly glycosylated biomolecules are known in the art (for example, as described by
Sehneerson et al., 1980),
EXAMPLE 7; RECOMBINANT LUBRICIN DELIVERY
[092] Standard methods for delivery of recombinant lubricin are used. For intia-
30 articular administration, recombinant lubricin. is detivered to the synovial cavity at a
concentration in the range of 20 - 500 mg in a volume of approximately 0.1 - 2 ml per
WO 2005/016130 PCT/US2004/026508
29
injection- For example, I ml of a recombinant lubririn at a concentration of 200 - 300
mg/ml is injected into a knee joint using a fine (e.g., 14 - 30 gauge, preferably 18 - 26
gauge) needle. The compositions of the invention are also useful for parenteral
administration, such as intravenous, subcutaneous, intramuscular, or intraperitoncal
5 administration, and, in preferred embodiments, onto the surfaces of the peritoneal,
pericardium, or pleura.
[093] Proper needle placemeat is critical for the efficacy of tecombinant lubricin
protein that is delivered by injection in joint therapies (Schumacher, 2003). Proper nccdle
placement may be facilitated through the use of ultrasound technology. Successful
10 injections are more common after successful aspiration of fluid is obtained. A supralateral
approach into the suprapaiellar pouch has been suggested to provide the most reliable
access to knee joint spate. In addition to administering recombinant lubricin by inira-
articular injection, nucleic acids encoding recombinant lubricin (e.g., in gene therapy
applications) may be administered to a synovial cavity by intra-articular injection.
15 [094] For prevention of surgical adhesions, recombinant lubricins described
herein are administered in the form of gel, foam, fiber or fabric A recombtnant lubricin
formulated in such a manner is placed over and between damaged or exposed tissue
interfaces in order to prevent adhesion formation between opposing surfaces. To be
effective, the gel or film must remain in place and prevent tissue contact for a long enough
20 time so that when the gel finally disperses and the tissues do come into contact, they will
no louger have a tendency to adhere. Reccvmbinant lubricin formulated for inhibition or
prevention of adhesion formation (e.g., in the form of a membrane, fabric, foam, or gel)
are evaluated for prevention of post-surgical adhesions in. a rat cecal abrasion model
(Goldberg et al, 1993). Compositions are placed around, surgically abraded rat ceca, and
25 compared to non-treated controls (animals whose ceca were abraded but did not receive
any treatment). A reduction in the amount of adhesion formation in the rat model in the
ptesence of rocombinant lubricin formulation compared to the amount in the absence of
the formulation indicates that the formulation is clinically effective to reduce tissue
adhesion formation. In contexts where tissue adhesion is desired (e.g., where healing of
30 cartilage fissures is desired), however, use of recombinant lubricin may be best avoided.
WO 2005/016130 PCT/US2004/026508
30
Providing lubrication to cartilage radices impairs cartilage-cartilage integration (Schaefer
et al,2004).
[095] Recombinant lubricins are also uased to coat artificial limbs and joints prior
to implantation into a mammal. For example, such devices may be dipped or bathed in a
5 solution of a recombinant lubricin, e.g., following methods described in US5709020 or
US5702456. Care should be exercised, however, in the in vivo use of recombinant
lubricin in providing lubrication near a prostheses. A marked upregulation in PRG4 gene
expression (i.e., MSF gene expression) has been reported to be associated with prosthesis
loosening; lubricin could disturb the tight interaction between bone and prosthesis and
10 thereby contribute to prosthesis loosening (Morawietz et al, 2003),
EXAMPLE 8: OA MODEL
[096] In order to assess the efficacy of intra-articular administration of lubricin
preparations, a murine model of osteoarthritis/cartilage erosion ia prepared. For surgical
induction of osteoarthrilis, mice are anesthetized with 250 mg/kg intraperitoneal
15 tribromoethanol (SIGMA® Chemical), and knees are prepsred for aseptic surgery, A
longitudinal incision medial to the patellar ligament is made, the joint capsule is opened,
and the meniscotibial ligament (anchoring the medial meniscus to the tibial plateau) is
identified. In a subset of animus, no further manipulation is performed, and this group is
considered sham operated. In the experimental group the medial meniscotibial ligament is
20 transected resulting in destabilization of the medial meniscus (DMM). In both sham and
DMM animals the joint capsule and subcutaneous layer are sutured closed separately and
the skin is closed by application of NEXABAND© S/C tissue adhesive (Abbott, North
Chicago, IL), Buprenorphine (BUPKENEX®; Recfcitt &. Coleman, Kingston-upon-HuIl,
UK) is administered pre- and post-opemtively,
25 [097] Recombinant lubriein preparations are administered by intra-articular
injection using a 30 gauge needle. Injections of 5—10 microliters per knee joint are
administered one week post surgery, Additional injections are optionally administered on
a weekly basis. Animals are sacrificed by carbon dioxide at 4 weeks post-operatively and
at 8 weeks post-operatively.
30 [098] In order to assess the progression and severity of osteoarthritis, intact knee
joints aie placed into 4% paraformaldehyde for 24 hours, then decalcified in
WO 2005/016130 PCT/US2004/026508
31
EDTA/polyvinylpyrrolidone for five days. joints are embedded in paraffin and 6-mm
fronts] sections obtained through the entire joint Slides are stained with Safranin O-fast
green and graded at 70-mm intervals through the joint using a modificatios of a semi-
quantitarive scoring system (Chambers el al, 2001) in which "0" = normal cartilage "0.S"
5 = loss of Safnmin O without structural changes; "1M = roughened articular surface and
small fibrillations; "2" = fibrillation down to the layer immediately below the superficial
layer and some loss of surface lamina; "3" = mild (<20%); "5" = moderate (20-30%); and
"6" = severe (>80%) loss of non-calcified cartilage. Scores of "4" (erosion to bone) are not
a feature of this model All quedrants of the joint (medial libial plalcau, medial femoral
10 condyle, laterl tibial plateau, and lateral femoral condylc) are scored separately, A
minimum of 12 levels are scored by blinded observers for each knee joint. Scores are
expressed as the maximum histologic score found in each joint or the summed bistologic
scores. The summed score represents the additive scores far each quadrant of the joint on
each histologic section through the joinl This method of analysis enables assessment of
15 seventy of lesions as well as the surface area of cartilage affected with OA-like lesions
(Glasson et al, 2004).
[099] References: (1) Chambers et al., 2001, Arthritis Rheum. 44: 1455-65; (2)
Deutscher, 1990, Methods in Enzymology, Vol. 182: Guide to Protein Purification,
Academic Press; (3) Espallargues and Pens, 2003, Int'l J. Tech. Assess. Health Care 19:
20 41-56; (4) Flannery et al., 1999, Biachem. Biophys. Res. Comm. 254: 535-41; (5) Glasson
et al, 2004. Arthritis Rheum. 50: 2547-58; (6) Goldberg et al., 1993, In: Gynecologic
Surgery and Adhesion Prevention, Willey-Liss, pp. 191-204; (7) Hills, 2002, J.
Rheumatology 29. 200-01; (8) Ikegawa et al, 2000, Cytogenet. Cell Genet. 90: 291-297;
(9) Jay et al, 2001, J. Orthopaedic Research 19: 677-87; (10) Jay et al, 2002,
25 Glycoconjugme Journal 18: 307-15; (11) Krstenansky et al., 1987, FEBS Lett. 211: 10-
16; (12) Marcelino et al, 1999, Nature Genetics 23: 319-322; (13) Meiberg et al., 1993,
Biology of Vitrvnectins and their Reeeptors, Pressner et al. (eds.): Elsevier Science
Publishers, pp, 45-53; (14) Merrifield, 1963, J. Amer, Chem. Soc. 85: 2149-54; (15)
Morewietz et al. 2003, Virchws Arch. 443: 57-66; (16) Rees et al., 2002, Matrix Biology
30 21: 593-602; (17) Schneerson et al, 1980, J. Exp. Med. 152; 561-76; (18) Scopes, 1994,
Protein Purification: Principles and Practice (3rd edition), Springer Verlag; (19) Schaefer
et al, 2004, Biorheology 41: 503 - 508; (20) Schumacher, 2003, Arthritis & Rhewnatistn
WO 2005/016130 PCT/US2004/026508
32
49: 413-20; (21) Tatusova and Madden, 1999, FEMS Micrabiol Lett. 174: 247-50; (22)
Wohig et al., 1998, Clin. Ther. 25: 410-23; aad (23) Wobig et al,, 1999, Clin. Ther. 21:
1549-62.
WO 2005/016130 PCT/US2004/026508
33
CLAIMS
WE CLAIM :
1. An isolated recombinant protein comprising SEQ ID NOS: 9, 13, 17, 11 or 25.
2. An isolated recombinant protein comprising SEQ ID NO: 26 linked to N-1
repeat(s) of SEQ ID NO: 27, where N equals an integer from 3 through 25
3. The protein as claimed in claim 2, where N equals an integer from 5 through 25.
4. The protein as claimed in claim 2, where N equals an integer from 10 through 25.
5. An isolated recombinant protein comprising SEQ ID NO: 26 plus SEQ ID NO: 28
plus [N-2 repeat(s) of SEQ ID NO: 27] plus SEQ ID NO: 29. where N equals an integer
from 10 through 25.
6. An isolated recombinant polynucleotide comprising a nucleic acid sequence
encoding the protein as claimed in claim 1.
7. An isolated recombinant polynucleotide comprising a nucleic acid sequence
encoding the protein as claimed in claim 2.
8. An isolated recombinant polynucleotide comprising a nucleic acid sequence
encoding the protein as claimed in claim 3.
9. An isolated recombinant polynucleotide comprising a nucleic acid sequence
encoding the protein as claimed in claim 4.
10. An isolated recombinant polynucleotide comprising a nucleic acid sequence
encoding the protein as claimed in claim 5.
11. An isolated recombinant protein comprising SEQ ID NOS: 7, 11, 15, 19 or 23.
12. An isolated recombinant polynucleotide comprising a nucleic acid sequence
encoding the protein as claimed in claim 11.
13. The polynucleotide as claimed in claim 6 wherein the polynucleotide comprises
SEQ ID NOS: 8, 12, 16, 20 or 24.
14. The polynucleotide as claimed in claim 12 wherein the polynucleotide comprises
SEQ ID NOS: 6, 10, 14, 18 or 22.
15. An isolated recombinant polynucleotide comprising a polynucleotide having at
least 80% identity to SEQ ID NOS: 6, 10, 14, 18 or 22 over the entire length of the
sequence.
16. The polynucleotide as claimed in claim 15 comprising a polynucleotide having at
least 90% identity.
17. The polynucleotide as claimed in claim 15 comprising a polynucleotide having at
least 95% identity.
18. The polynucleotide as claimed in claim 15 comprising a polynucleotide having at
least 99% identity.
19. The protein as claimed in claims 1 or 2 wherein the protein is O-linkdd with ß-( 1-
3)-Gal-GaINac.
20. A composition comprising a therapeuiically effective amount of a protein as
claimed in claim 19 in a pharmaceutically acceptable carrier.
21. The composition as claimed in claim 20 additionally comprising hya1uronan or
hylan.
22. A compostiion for treating a tissue of a subject.
23. The composition as claimed in claim 22 wherein the tissue is selected from the
group consisting of cartilage, synovium. meniscus, tendon. peritoneum, pericardium, and
pleura.
24. The composition as claimed in claim 23 wherein the tissue is cartilage.
25. The composition as claimed in claim 22 wherein the subject is selected from the
group consisting of a mouse, a rat, a cat, a dog, a horse and a human.
26. The composition as claimed in claim 25 wherein the subject is a human.
27. An expression "ector comprising the polynucleotide as claimed in claims 6 or 7
operably linked to an expression control sequence.
28. A method of producing recombinant protein comprising:
growing cells transformed with the expression vector as claimed in claim 27 in liquid
culture media; and collecting recombinant protein from the media.
29. The method as claimed in claim 28, wherein the collecting protein comprises:
concentraiing the protein by filtering the media through a membrane:
collecting the retained protein from the membrane; and
solubilizing the collected protein in a buffered salt solution containing L-arginine
hydrochloride ranging in concentration from 0.1 to 2.0 M.
30. The method as claimed in claim 29 wherein the L-arginine hydrochloride
concentraiion is 0.5 M.
31. An isolated antibody specific for a protein as claimed in claims 1 or 2.
Recombinant lubricin molocolet and uses thereof. Novel recombinnat lubricin molecules and their cros lubricants,
and adhesive agents and/or intra-articular supplement for e.g. syaovial joints. meniscus. tendon, periontum, perticudinon and
pleora, are provide.
| # | Name | Date |
|---|---|---|
| 1 | 535-kolnp-2006-sequence listing 1.1.pdf | 2011-10-06 |
| 2 | 535-kolnp-2006-reply to examination report 1.1.pdf | 2011-10-06 |
| 3 | 535-KOLNP-2006-PETITION UNDER RULE 137.pdf | 2011-10-06 |
| 4 | 535-KOLNP-2006-OTHERS.pdf | 2011-10-06 |
| 5 | 535-kolnp-2006-granted-specification 1.1.pdf | 2011-10-06 |
| 6 | 535-kolnp-2006-granted-form 1.1.pdf | 2011-10-06 |
| 7 | 535-kolnp-2006-granted-description (complete) 1.1.pdf | 2011-10-06 |
| 8 | 535-kolnp-2006-granted-claims 1.1.pdf | 2011-10-06 |
| 9 | 535-kolnp-2006-granted-abstract 1.1.pdf | 2011-10-06 |
| 10 | 535-kolnp-2006-gpa 1.1.pdf | 2011-10-06 |
| 11 | 535-kolnp-2006-form 5.1.pdf | 2011-10-06 |
| 12 | 535-KOLNP-2006-FORM 3.pdf | 2011-10-06 |
| 13 | 535-kolnp-2006-form 3.1.pdf | 2011-10-06 |
| 14 | 535-KOLNP-2006-FORM 3.1.1.pdf | 2011-10-06 |
| 15 | 535-kolnp-2006-form 18.1.pdf | 2011-10-06 |
| 16 | 535-KOLNP-2006-FORM 13.pdf | 2011-10-06 |
| 17 | 535-KOLNP-2006-FORM 1.pdf | 2011-10-06 |
| 18 | 535-kolnp-2006-examination report 1.1.pdf | 2011-10-06 |
| 19 | 535-KOLNP-2006-DESCRIPTION (COMPLETE).pdf | 2011-10-06 |
| 20 | 535-KOLNP-2006-CORRESPONDENCE.pdf | 2011-10-06 |
| 21 | 535-KOLNP-2006-CORRESPONDENCE 1.1.pdf | 2011-10-06 |
| 22 | 535-KOLNP-2006-CLAIMS.pdf | 2011-10-06 |
| 23 | 535-KOLNP-2006-CANCELLED PAGES.pdf | 2011-10-06 |
| 24 | 535-kolnp-2006-assignment 1.1.pdf | 2011-10-06 |
| 25 | 535-KOLNP-2006-ABSTRACT.pdf | 2011-10-06 |
| 26 | 00535-kolnp-2006-sequence listing.pdf | 2011-10-06 |
| 27 | 00535-kolnp-2006-priority document.pdf | 2011-10-06 |
| 28 | 00535-kolnp-2006-pct request.pdf | 2011-10-06 |
| 29 | 00535-kolnp-2006-international search report.pdf | 2011-10-06 |
| 30 | 00535-kolnp-2006-international publication.pdf | 2011-10-06 |
| 31 | 00535-kolnp-2006-gpa.pdf | 2011-10-06 |
| 32 | 00535-kolnp-2006-form 5.pdf | 2011-10-06 |
| 33 | 00535-kolnp-2006-form 3.pdf | 2011-10-06 |
| 34 | 00535-kolnp-2006-form 1.pdf | 2011-10-06 |
| 35 | 00535-kolnp-2006-description complete.pdf | 2011-10-06 |
| 36 | 00535-kolnp-2006-claims.pdf | 2011-10-06 |
| 37 | 00535-kolnp-2006-abstract.pdf | 2011-10-06 |
| 38 | 535-KOLNP-2006-(29-03-2012)-PA-CERTIFIED COPIES.pdf | 2012-03-29 |
| 39 | 535-KOLNP-2006-(29-03-2012)-FORM-27.pdf | 2012-03-29 |
| 40 | 535-KOLNP-2006-(29-03-2012)-CORRESPONDENCE.pdf | 2012-03-29 |
| 41 | 535-KOLNP-2006-(18-04-2013)-CORRESPONDENCE.pdf | 2013-04-18 |
| 42 | 535-KOLNP-2006-FORM-27.pdf | 2013-06-04 |
| 43 | 535-KOLNP-2006-(18-03-2014)-FORM-27.pdf | 2014-03-18 |
| 44 | 535-KOLNP-2006-22-02-2023-RELEVANT DOCUMENTS.pdf | 2023-02-22 |