ANTI-BAFF-ANTI-IL-17 BISPECIFIC ANTIBODIES
The present invention is in the field of medicine, particularly in the novel field of
bispecific antibodies directed against B-cell Activating Factor of the TNF Family (BAFF)
and Interleukin- 17A (IL-17). The bispecific antibodies of the present invention are
expected to be useful in treating Lupus Nephritis (LN), Systemic Lupus Erythematosus
(SLE), Rheumatoid Arthritis (RA), Psoriasis (Ps), Ankylosing Spondylitis (AS), Psoriatic
Arthritis (PA), primary Sj5gren's Syndrome (pSS), or Multiple Myeloma (MM).
Increased levels of IL-17 have been associated with several
conditions, diseases or disorders including airway inflammation, rheumatoid arthritis,
osteoarthritis, bone erosion, intraperitoneal abscesses and adhesions, inflammatory bowel
disorder, allograft rejection, psoriasis, certain types of cancer, angiogenesis,
atherosclerosis and multiple sclerosis. IL-17 and IL-17 receptor are up regulated in the
synovial tissue of rheumatoid arthritis patients. Blocking an IL-17 bioactivity reduces
inflammation and bone erosion in various animal arthritis models. Furthermore, IL-17
has IL- I independent effects on collagen matrix breakdown and inflammation and joint
damage, while IL-17 has synergy with TNF-a to amplify inflammation. Thus, given its
localized distribution at the site of inflammation, IL-17 appears to be a possible target for
the treatment of rheumatoid arthritis and other inflammatory or autoimmune diseases with
a potentially greater safety profile than drugs that target the systemic circulation of pro
inflammatory cytokines such as TNF-a.
The involvement of B-cell activating factor (BAFF) in the pathogenesis of
autoimmune diseases is illustrated by BAFF overexpression in mice models, which leads
to autoimmune disease mimicking rheumatoid arthritis, systemic lupus erythematosus and
primary Sj5gren's syndrome, as well as a twofold increase in occurrence of B cell
lymphoma. In humans, numerous reports have shown elevated serum BAFF levels in
SLE, RA, pSS, and systemic sclerosis patients. It has been demonstrated that BAFF
promotes the expansion of Thl7 cells and IL-17 is a crucial effector cytokine for BAFFmediated
proinflammatory effects during collagen- induced arthritis development. IL- 17
has also been shown to act in synergy with BAFF to influence B cell biology and the
pathophysiology of SLE. There is also evidence that both BAFF and IL-17 play a role in
pathology associated with LN, in fact it has been reported that patients with LN have
elevated levels of IL-17 and BAFF.
SLE is a highly heterogeneous and multisystem autoimmune disease that is
characterized by the development of auto-antibodies and the formation of immune
complexes. An estimated 30-60% of patients with SLE have renal involvement at some
stage during the course of their disease. LN is a complex, multi-factorial autoimmune
disease. If left untreated, the 5-year survival rate of patients with LN is 0-20%. The
introduction of immunosuppressive therapy has greatly improved this situation and the
current 10-year survival rate is 88%. However, this improvement comes at a cost for the
patient, as many of these treatments have severe adverse events, especially since they
have to be taken chronically. In addition, response is slow and often incomplete, with
only 25-50% of patients reaching remission.
Co-administration of a BAFF antibody and IL-17 antibody requires either
injections of two separate products or a single injection of a co-formulation of two
different antibodies. Two injections would permit flexibility of dose amount and timing,
but are inconvenient to patients both for compliance and pain. A co-formulation might
also provide some flexibility of dose amounts, but it is often quite challenging or
impossible to find formulation conditions that permit chemical and physical stability of
both antibodies due to different molecular characteristics of the two different antibodies.
WO1995099 17 discloses a method for producing bispecific, tetravalent antibodies
(MAb-scFV) using recombinant DNA technology by producing a single chain fragment
variable antibody fused to a complete antibody having a different specificity. This gene
fusion is expressed by transfection resulting in a tetravalent antibody having dual
specificity. WO2003016468 discloses anti-BAFF antibodies that bind and neutralize both
soluble and membrane bound forms of human BAFF. WO2007070750 discloses anti-IL-
17 antibodies that bind and neutralize human IL-17. However, when following the
teachings in WO1995099 17 to create a starting bispecific antibody comprising the anti-
BAFF antibodies of WO2003016468 and the anti-IL-17 antibodies of WO2007070750,
the present inventors discovered significant problems associated with chemical and
physical stability. Many amino acid changes were required in the starting bispecific
antibody to sufficiently overcome these problems. Neither the need for nor the actual
changes are suggested in the art. Further, the several changes are not routine or derived
from common general knowledge. Likewise, the single antibodies themselves did not
have these problems, suggesting that the local environment around these areas differed in
the context of bispecific antibodies. Thus, pharmacological intervention with a bispecific
antibody that neutralizes both BAFF and IL- 17 is needed.
The present invention provides a bispecific antibody comprising two first
polypeptides and two second polypeptides.
The present invention also provides a DNA molecule comprising a polynucleotide
sequence encoding the first polypeptide.
The present invention also provides a DNA molecule comprising a polynucleotide
sequence encoding the second polypeptide.
The present invention also provides a DNA molecule comprising a polynucleotide
sequence encoding the first polypeptide and the second polypeptide.
The present invention also provides a mammalian cell transformed with DNA
molecule(s) which cell is capable of expressing a bispecific antibody comprising the first
polypeptide and the second polypeptide.
The present invention also provides a process for producing a bispecific antibody
comprising the first polypeptide and the second polypeptide, comprising cultivating the
mammalian cell under conditions such that the bispecific antibody is expressed.
The present invention also provides a bispecific antibody produced by said
process.
The present invention also provides a method of treating Systemic Lupus
Erythematosus, Lupus Nephritis, Rheumatoid Arthritis, Psoriasis, Ankylosing
Spondylitis, Psoriatic Arthritis, primary Sj5gren's syndrome, or Mulitple Myeloma
comprising administering to a patient in need thereof an effective amount of a bispecific
antibody.
The present invention also provides a bispecific antibody for use in therapy.
The present invention also provides a bispecific antibody for use in the treatment
of Systemic Lupus Erythematosus, Lupus Nephritis, Rheumatoid Arthritis, Psoriasis,
Ankylosing Spondylitis, Psoriatic Arthritis, primary Sj5gren's syndrome, or Multiple
Myeloma.
The present invention also provides a pharmaceutical composition comprising the
bispecific antibody and one or more pharmaceutically acceptable carriers, diluents or
excipients.
Human IL-17 is understood to mean a homodimeric protein comprising two
human IL-17A proteins. A human IL-17A/F heterodimer is a human IL-17A protein and
a human IL-17F protein.
A bispecific antibody is understood to mean an immunoglobulin molecule
comprising four antigen binding sites, which binds two different antigens with specificity
for each antigen in the MAb-scFV format. The bispecific antibody is capable of binding
each antigen alone or each antigen simultaneously.
The bispecific antibody of the present invention comprises two first polypeptides
and two second polypeptides. Each of the first polypeptides forms an inter-chain
disulfide bond with each of the second polypeptides, and the first polypeptide forms two
inter-chain disulfide bonds with the other first polypeptide, and each of the first
polypeptides forms several intra-chain disulfide bonds. The relationship of the
polypeptides and the disulfide bonds are shown in the following schematic:
Second polypeptide
First p d
First polypeptide
Second
The amino acid sequence of the first polypeptide is:
QVQLQQWGAG LLKPSETLSL TCAVYGGSFS GYYWSWIRQP PGKGLEWIGE 5 0
INHSGSTNYN PSLKSRVTI S VDTSKNQFSL KLSSVTAADT AVYYCARGYY 1 0 0
DILTGYYYYF DYWGQGTLVT VSSASTKGPS VFPLAPCSRS TSESTAALGC 1 5 0
LVKDYFPEPV TVSWNSGALT SGVHTFPAVL QSSGLYSLSS VVTVPSSSLG 2 0 0
TKTYTCNVDH KPSNTKVDKR VESKYGPPCP PCPAPEFLGG PSVFLFPPKP 2 5 0
KDTLMI SRTP EVTCVVVDVS QEDPEVQFNW YVDGVEVHNA KTKPREEQFN 3 0 0
STYRVVSVLT VLHQDWLNGK EYKCKVSNKG LPSS I EKTI S KAKGQPREPQ 3 5 0
VYTLPPSQEE MTKNQVSLTC LVKGFYPSDI AVEWESNGQP ENNYKTTPPV 4 0 0
LDSDGSFFLY SRLTVDKSRW QEGNVFSCSV MHEALHNHYT QKSLSLSPGG 4 5 0
GGSGGGGTGG GGSQVQLVQS GAEVKKPGSS VKVSCKASGY KFTDYHIHWV 5 0 0
RQAPGQCLEW G PTYGT TDYNQRFKGR VTI TADESTS TAYMELSSLR 5 5 0
SEDTAVYYCA RYDYFTGTGV YWGQGTLVTV SSGGGGSGGG GSGGGGSGGG 6 0 0
GSDIVMTQTP LSLSVTPGQP AS I SCRSSRS LVHSRGETYL HWYLQKPGQS 6 5 0
PQLLI YKVSN RFIGVPDRFS GSGSGTDFTL KI SRVEAEDV GVYYCSQSTH 7 0 0
LPFTFGCGTK LEI K 7 1 4 (SEQ ID NO: 1).
The amino acid sequence of the second polypeptide is:
EIVLTQSPAT LSLSPGERAT LSCRASQSVS RYLAWYQQKP GQAPRLLIYD 5 0
ASNRATGI PA RFSGSGSGTD STLTI SSLEP EDFAVYYCQQ RSNWPRTFGQ 1 0 0
GTKVE KRTV AAPSVFI FPP SDEQLKSGTA SVVCLLNNFY PREAKVQWKV 1 5 0
DNALQSGNSQ ESVTEQDSKD STYSLSNTLT LSKADYEKHK VYACEVTHQG 2 0 0
LSSPVTKSFN RGEC 2 1 4 (SEQ ID NO:2).
The inter-chain disulfide bond of each of the first polypeptides and each of the
second polypeptides forms between cysteine residue 137 of SEQ ID NO: 1 and cysteine
residue 214 of SEQ ID NO:2. The first polypeptide forms two inter-chain disulfide bonds
with the other first polypeptide. The first inter-chain disulfide bond forms between
cysteine residue 229 of the first polypeptide of SEQ ID NO: 1 and cysteine residue 229 of
the other first polypeptide of SEQ ID NO: 1. The second inter-chain disulfide bond
forms between cysteine residue 232 of the first polypeptide of SEQ ID NO: 1 and
cysteine residue 232 of the other first polypeptide of SEQ ID NO: 1.
Within the scFV, an engineered intra-chain disulfide bond is formed between
cysteine residue 507 of SEQ ID NO: 1 and cysteine residue 707 of SEQ ID NO: 1. Also,
an intra-chain disulfide bond is formed between between cysteine residue 625 of SEQ ID
NO: 1 and cysteine residue 695 of SEQ ID NO: 1. Within the MAb, intra-chain disulfide
bonds that normally occur in an IgG4 antibody are formed between cysteine residue 22 of
SEQ ID NO: 1 and cysteine residue 95 of SEQ ID NO: 1, between cysteine residue 150 of
SEQ ID NO: 1 and cysteine residue 206 of SEQ ID NO: 1, between cysteine residue 264 of
SEQ ID NO: 1 and cysteine residue 324 of SEQ ID NO: 1, between cysteine residue 370 of
SEQ ID NO: 1 and cysteine residue 428 of SEQ ID NO: 1, between cysteine residue 485 of
SEQ ID NO: 1 and cysteine residue 559 of SEQ ID NO: 1, between cysteine residue 23 of
SEQ ID NO:2 and cysteine residue 88 of SEQ ID NO:2, and between cysteine residue
134 of SEQ ID NO:2 and cysteine residue 194 of SEQ ID NO:2.
The first polypeptide comprises a first heavy chain variable region (HCVR1), a
heavy chain constant region (CH), a second heavy chain variable region (HCVR2) and a
second light chain variable region (LCVR2). The second polypeptides comprises a first
light chain variable region (LCVRl) and a light chain constant region (CL). The HCVR
and LCVR regions can be further subdivided into regions of hypervariability, termed
complementarity determining regions (CDR), interspersed with framework regions (FR).
Each HCVR and LCVR is composed of three CDRs and four FRs, arranged from aminoterminus
to carboxyl-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3,
CDR3, FR4.
The 3 CDRs of HCVR1 are referred to as CDRHl-1, CDRHl-2, and CDRHl-3
and the 3 CDRs of HCVR2 are referred to as CDRH2-1, CDRH2-2, and CDRH2-3 and
the 3 CDRs of LCVRl are referred to as CDRLl-1, CDRLl-2 and CDRLl-3 and the 3
CDRs of LCVR2 are referred to as CDRL2-1, CDRL2-2 and CDRL2-3.
The CH is fused to HCVR2 by an amino acid linker (LI). HCVR2 is fused to
LCVR2 by an amino acid linker (L2).
The relationship of the various regions and linkers is as follows:
Bispecific Antibody Engineering
Significant problems associated with chemical and physical stability were
encountered when constructing a bispecific antibody in the MAb-scFv format with the
anti-IL- 17 binding portion in the scFv configuration. Chemical modifications were made
in the CDRL2-1 and CDRH2-2 portions of the bispecific antibody that improved physical
stability and reduced concentration-dependent aggregation. Extensive protein stability
and solubility studies identified chemically unstable residues in CDRL2-1 and CDRH2-2.
These labile residues were replaced with charge neutral amino acids using targeted
libraries constructed by codon depletion. Additionally, the electrostatic surface of the
bispecific antibody was calculated and charged patches were identified. Disruptions of
these charged patches in the scFv led to a decrease in protein self-association. However,
a mutation was identified in the CDRH2-1 portion of the bispecific antibody that
rebalanced the surface electrostatic distribution, and improved physical stability and
solubility at high concentrations. None of the above issues were encountered in the
parental single antibodies. These problems were encountered only in the context of
constructing a bispecific antibody in the MAb-scFv format, suggesting that the local
environment around the mutated areas of the single antibody differed in the context of a
bispecific antibody.
Further chemical modifications were made to stabilize the HCVR2/LCVR2
interface in the IL-17 portion of the bispecific antibody, and to reduce bispecific antibody
aggregation. Studies conducted to determine the aggregation showed that the observed
protein self-association was not driven by conformational instability of the individual
HCVR2 or LCVR2 domains, but rather by the opening or breathing of the
HCVR2/LCVR2 interface, leading to intermolecular protein interactions. Thus, various
intra-chain disulfide bonds were introduced into the HCVR2/LCVR2 interface of the IL-
17 portion of the bispecific antibody. One such intra-chain disulfide bond occurs in each
of the first polypeptides between cysteine residue 507 of SEQ ID NO: 1 and cysteine
residue 707 of SEQ ID NO: 1. This disulfide bond covalently connects the
HCVR2/LCVR2 interface in the IL-17 portion of the bispecific antibody, which stabilizes
the HCVR2/LCVR2 interface and reduces intermolecular protein interactions that can
lead to physical instability and unfavorable formulation limitations. Out of the nine
different disulfide bonds tested, 8 of which expressed functional protein, the magnitude of
affinity loss ranged from about 2 to about 35-fold. The intra-chain disulfide bond in each
of the first polypeptides between cysteine residue 507 of SEQ ID NO: 1 and cysteine
residue 707 of SEQ ID NO: 1best stabilized the HCVR2/LCVR2 interface while
maintaining optimal binding affinity for IL-17.
In addition, studies indicated that linker length for LI affected binding kinetics.
Kinetic analysis (by surface plasmon resonance) showed that a 10 amino acid linker
caused a 2-fold slower Kon rate compared to 15 amino acid and 20 amino acid linkers.
Thus, a linker length of 15 was introduced into the bispecific antibody of the present
invention.
Bispecific Antibody Binding
The bispecific antibodies of the present invention bind both human BAFF and
human IL- 17 and neutralize at least one human BAFF bioactivity and at least one human
IL-17 bioactivity in vitro or in vivo. The bispecific antibodies of the present invention
are potent inhibitors of IL-17 in the presence and absence of BAFF in vitro. The
bispecific antibodies of the present invention are potent inhibitors of both soluble and
membrane-bound BAFF in the presence or absence of IL-17 in vitro. The bispecific
antibodies of the invention are further characterized as having a binding affinity (¾) for
human BAFF in the range of 150 pM to 1 pM and human IL-17 in the range of 50 pM to
1pM. The bispecific antibodies have a binding affinity for human IL-17A/F heterodimer
of about 90 pM.
The bispecific antibodies effectively neutralize soluble as well as membranebound
BAFF and this neutralization is not affected by the presence of saturating amounts
of human IL-17. The bispecific antibodies effectively neutralize human IL-17 and this
neutralization is not affected by the presence of saturating amounts of human BAFF.
Bispecific Antibody Expression
Expression vectors capable of directing expression of genes to which they are
operably linked are well known in the art. Expression vectors can encode a signal peptide
that facilitates secretion of the polypeptide(s) from a host cell. The signal peptide can be
an immunoglobulin signal peptide or a heterologous signal peptide. The first polypeptide
and the second polypeptide may be expressed independently from different promoters to
which they are operably linked in one vector or, alternatively, the first polypeptide and
the second polypeptide may be expressed independently from different promoters to
which they are operably linked in two vectors - one expressing the first polypeptide and
one expressing the second polypeptide.
A host cell includes cells stably or transiently transfected, transformed, transduced
or infected with one or more expression vectors expressing a first polypeptide, a second
polypeptide or both a first polypeptide and a second polypeptide of the invention.
Creation and isolation of host cell lines producing a bispecific antibody of the invention
can be accomplished using standard techniques known in the art. Mammalian cells are
preferred host cells for expression of bispecific antibodies. Particular mammalian cells
are HEK 293, NSO, DG-44, and CHO. Preferably, the bispecific antibodies are secreted
into the medium in which the host cells are cultured, from which the bispecific antibodies
can be recovered or purified.
It is well known in the art that mammalian expression of antibodies results in
glycosylation. Typically, glycosylation occurs in the Fc region of the antibody at a highly
conserved N-glycosylation site. N-glycans typically attach to asparagine. Each of the first
polypeptides is glycosylated at asparagine residue 300 of SEQ ID NO:l.
A particular DNA polynucleotide sequence encoding the first polypeptide having
an amino acid sequence of SEQ ID NO: 1 is:
cAGGTGCAACTACAGCAGTGGGGCGCAGGACTGTTGAAGCCTTCGGAGACCCTGTCCCTC
ACCTGCGCTGTCTATGGTGGGTCCTTCAGTGGTTACTACTGGAGCTGGATTCGCCAGCCC
CCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCAATCATAGTGGAAGCACCAACTACAAC
CCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTG
AAACTGAGCTCTGTGACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGAGGGTATTAC
GATATTTTGACTGGTTATTATTACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACC
GTCTCCTCAGCCTCCACCAAGGGCCCATCGGTCTTCCCGCTAGCGCCCTGCTCCAGGAGC
ACCTCCGAGAGCACAGCCGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTG
ACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTA
CAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGC
ACGAAGACCTACACCTGCAACGTAGATCACAAGCCCAGCAACACCAAGGTGGACAAGAGA
GTTGAGTCCAAATATGGTCCCCCATGCCCACCCTGCCCAGCACCTGAGTTCCTGGGGGGA
CCATCAGTCTTCCTGTTCCCCCCAAAACCCAAGGACACTCTCATGATCTCCCGGACCCCT
GAGGTCACGTGCGTGGTGGTGGACGTGAGCCAGGAAGACCCCGAGGTCCAGTTCAACTGG
TACGTGGATGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTTCAAC
AGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAACGGCAAG
GAGTACAAGTGCAAGGTCTCCAACAAAGGCCTCCCGTCCTCCATCGAGAAAACCATCTCC
AAAGCCAAAGGGCAGCCCCGAGAGCCACAGGTGTACACCCTGCCCCCATCCCAGGAGGAG
ATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTACCCCAGCGACATC
GCCGTGGAGTGGGAAAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTG
CTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAGGCTAACCGTGGACAAGAGCAGGTGG
CAGGAGGGGAATGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACA
CAGAAGAGCCTCTCCCTGTCTCCTGGAGGCGGAGGATCCGGGGGAGGGGGTACCGGAGGA
GGGGGCTCGCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCA
GTGAAGGTTTCCTGCAAGGCATCTGGTTACAAGTTCACTGACTACCATATTCATTGGGTG
CGACAGGCCCCTGGACAATGCCTTGAGTGGATGGGAGTAATTAATCCTACTTATGGTACT
ACTGACTACAATCAGCGGTTCAAAGGCCGTGTCACCATTACCGCGGACGAATCCACGAGC
ACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCG
AGATATGATTACTTTACTGGGACGGGTGTGTACTGGGGCCAAGGAACCCTGGTCACCGTC
TCCTCAGGTGGCGGAGGATCTGGTGGAGGTGGCTCAGGAGGTGGCGGAAGCGGCGGAGGT
GGAAGTGATATTGTGATGACTCAGACTCCACTCTCCCTGTCCGTCACCCCTGGACAGCCG
GCCTCCATCTCCTGCAGATCTAGTAGGAGCCTTGTACACAGTCGTGGAGAAACCTATTTA
CATTGGTATCTGCAGAAGCCAGGCCAATCTCCACAGCTCCTAATTTATAAAGTTTCCAAC
CGGTTTATTGGGGTCCCAGACAGATTCAGCGGCAGTGGGTCAGGCACAGATTTCACACTG
AAAATCAGCAGGGTGGAGGCCGAAGATGTTGGGGTTTATTACTGCTCTCAAAGTACACAT
CTTCCATTCACGTTTGGCTGCGGGACCAAGCTGGAGATCAAA SEQ ID NO:3.
A particular DNA polynucleotide sequence encoding the second polypeptide
having an amino acid sequence of SEQ ID NO:2 is:
GAAATTGTGTTGACGCAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACC
CTCTCCTGCAGGGCCAGTCAGAGTGTTAGCCGCTACTTAGCCTGGTACCAGCAGAAACCT
GGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCAACAGGGCCACTGGCATCCCAGCC
AGGTTCAGTGGCAGTGGGTCTGGGACAGACTCCACTCTCACCATCAGCAGCCTAGAGCCT
GAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCGGACGTTCGGCCAA
GGGACCAAGGTGGAAATCAAACGAACTGTGGCGGCGCCATCTGTCTTCATCTTCCCGCCA
TCTGATGAGCAGTTGAAATCCGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTAT
CCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAG
GAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAACACCCTGACG
CTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGC
CTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGC
SEQ ID NO:4.
Medium, into which a bispecific antibody has been secreted, may be purified by
conventional techniques. For example, the medium may be applied to and eluted from a
Protein A or G column using conventional methods. Soluble aggregate and multimers
may be effectively removed by common techniques, including size exclusion,
hydrophobic interaction, ion exchange, or hydroxyapatite chromatography. The product
may be immediately frozen, for example at -70°C, or may be lyophilized.
There may be a need to reduce the level of misfolded bispecific antibody present
in the medium. Misfolded bispecific antibody is also known as diabody. Misfolding
results when one or more disulfide bonds form incorrectly, either inter or intra chains.
The misfolded bispecific antibody may be purified by conventional techniques. For
example, the medium containing the misfolded bispecific antibody may be applied to and
eluted from strong cation exchange resin. For example, SP-Sepharose HP strong cation
exchange resin is used to purify correctly folded bispecific antibody from diabody. The
pH of the medium containing the diabody is adjusted to pH 8 using 1M Tris Base. The
medium is loaded onto an SP-Sepharose HP column, washed with 2 column volumes of
20mM Tris, pH 8 and eluted with 20mM Tris, lOOmM NaCl, pH8 over 30 column
volumes (0-70 mM NaCl). The collected pools can be assessed for high molecular
weight versus main peak. A typical result is an improvement from 10% diabody to 1%
diabody with 71% recovery.
In another example, Poros HS 50 strong cation exchange resin is used to purify
correctly folded bispecific antibody from diabody. The pH of the medium containing the
diabody is adjusted to pH 8 using 1M Tris Base . The medium is loaded onto an SPSepharose
HP column and eluted with 20mM Tris, lOOmM NaCl, pH8 over 15 column
volumes (15-50 mM NaCl). The collected pools can be assessed for high molecular
weight versus main peak. A typical result is an improvement from 10% diabody to 1%
diabody with 57% recovery.
Therapeutic Uses
A patient refers to a mammal, preferably a human with a disease, disorder or
condition that would benefit from a decreased level of BAFF and/ or IL-17 or decreased
bioactivity of BAFF and/or IL-17.
Treatment and/or treating are intended to refer to all processes wherein there may
be a slowing, interrupting, arresting, controlling, or stopping of the progression of the
disorders described herein, but does not necessarily indicate a total elimination of all
disorder symptoms. The bispecific antibody of the present invention is expected to treat
systemic lupus erythematosus, lupus nephritis, rheumatoid arthritis, psoriasis, ankylosing
spondylitis, psoriatic arthritis, primary Sj5gren's syndrome or multiple myeloma.
Pharmaceutical Composition
A bispecific antibody of the invention can be incorporated into a pharmaceutical
composition suitable for administration to a patient. Such pharmaceutical compositions
are designed to be appropriate for the selected mode of administration, and
pharmaceutically acceptable diluents, carrier, and/or excipients such as dispersing agents,
buffers, surfactants, preservatives, solubilizing agents, isotonicity agents, stabilizing
agents and the like are used as appropriate. Said compositions can be designed in
accordance with conventional techniques disclosed in, e.g., Remington , The Science and
Practice of Pharmacy, 19th Edition, Gennaro, Ed., Mack Publishing Co., Easton, PA 1995
which provides a compendium of formulation techniques as are generally known to
practitioners. Suitable carriers for pharmaceutical compositions include any material
which, when combined with a bispecific antibody of the invention, retains the molecule's
activity and is non-reactive with the patient's immune system. A pharmaceutical
composition of the present invention comprises a bispecific antibody and one or more
pharmaceutically acceptable carriers, diluents or excipients.
A pharmaceutical composition comprising a bispecific antibody of the present
invention can be administered to a patient at risk for or exhibiting diseases or disorders as
described herein using standard administration techniques.
A pharmaceutical composition of the invention contains an effective amount of a
bispecific antibody of the invention. An effective amount refers to an amount necessary
(at dosages and for periods of time and for the means of administration) to achieve the
desired therapeutic result. An effective amount of the bispecific antibody may vary
according to factors such as the disease state, age, sex, and weight of the individual, and
the ability of the antibody or antibody portion to elicit a desired response in the
individual. An effective amount is also one in which any toxic or detrimental effect of
the bispecific antibody, are outweighed by the therapeutically beneficial effects.
The bispecific antibody of the following example of expression and demonstration
of properties comprises two first polypeptides having amino acid sequences of SEQ ID
NO:l and two second polypeptides having amino acid sequences of SEQ ID NO:2
wherein each of the first polypeptides forms an inter-chain disulfide bond with each of the
second polypeptides between cysteine residue 137 of SEQ ID NO:l and cysteine residue
214 of SEQ ID NO:2, and the first polypeptide forms two inter-chain disulfide bonds with
the other first polypeptide between cysteine residue 229 first polypeptide of SEQ ID
NO: 1 and cysteine residue 229 of the other first polypeptide of SEQ ID NO: 1 and
between cysteine residue 232 first polypeptide of SEQ ID NO: 1 and cysteine residue 232
of the other first polypeptide of SEQ ID NO: 1, and each of the first polypeptides forms an
intra-chain disulfide bond between cysteine residue 22 and cysteine residue 95 of SEQ ID
NO:l, between cysteine residue 150 of SEQ ID NO:l and cysteine residue 206 of SEQ ID
NO: 1, between cysteine residue 264 of SEQ ID NO: 1 and cysteine residue 324 of SEQ ID
NO: 1, between cysteine residue 370 of SEQ ID NO: 1 and cysteine residue 428 of SEQ ID
NO:l, between cysteine residue 485 of SEQ ID NO:l and cysteine residue 559 of SEQ ID
NO:l, between cysteine residue 507 of SEQ ID NO:l and cysteine residue 707 of SEQ ID
NO: 1, and between cysteine residue 625 of SEQ ID NO: 1 and cysteine residue 695 of
SEQ ID NO:l, and each of the second polypeptides forms an intra-chain disulfide bond
between cysteine residue 23 of SEQ ID NO:2 and cysteine residue 88 of SEQ ID NO:2,
and between cysteine residue 134 of SEQ ID NO:2 and cysteine residue 194 of SEQ ID
NO:2, and wherein each of the first polypeptides is glycosylated at asparagine residue 300
of SEQ ID NO:l. The ratio of correctly folded bispecific antibody to misfolded diabody
is on the order to 90: 10.
Expression of Bispecific Antibody
The bispecific antibody can be expressed and purified essentially as follows. A
glutamine synthetase (GS) expression vector containing the DNA of SEQ ID NO:3
(encoding the first polypeptide having amino acid sequence of SEQ ID NO: 1) and SEQ
ID NO:4 (encoding the light chain amino acid sequence of SEQ ID NO:2) is used to
transfect the Chinese hamster cell line, CHOK1SV (Lonza Biologies PLC, Slough,
United Kingdom) by electroporation. The expression vector encodes an SV Early
(Simian Virus 40E) promoter and the gene for GS. Expression of GS allows for the
biochemical synthesis of glutamine, an amino acid required by the CHOK1SV cells.
Post-transfection, cells undergo bulk selection with 50mM L-methionine sulfoximine
(MSX). The inhibition of GS by MSX is utilized to increase the stringency of selection.
Cells with integration of the expression vector cDNA into transcriptionally active regions
of the host cell genome can be selected against CHOK1SV wild type cells, which express
an endogenous level of GS. Transfected pools are plated at low density to allow for
close-to-clonal outgrowth of stable expressing cells. The masterwells are screened for
bispecific antibody expression and then scaled up in serum-free, suspension cultures to be
used for production. Clarified medium, into which the bispecific antibody has been
secreted, is applied to a Protein A affinity column that has been equilibrated with a
compatible buffer, such as phosphate buffered saline (pH 7.4). The column is washed to
remove nonspecific binding components. The bound bispecific antibody is eluted, for
example, by pH gradient (such as 0.1 M sodium phosphate buffer pH 6.8 to 0.1 M sodium
citrate buffer pH 2.5). Bispecific antibody fractions are detected, such as by SDS-PAGE
or analytical size-exclusion, and then are pooled. Soluble aggregate and multimers may
be effectively removed by common techniques, including size exclusion, hydrophobic
interaction, ion exchange, or hydroxyapatite chromatography. The bispecific antibody
may be concentrated and/or sterile filtered using common techniques. The purity of the
bispecific antibody after these chromatography steps is greater than 98%. The bispecific
antibody may be immediately frozen at -70°C or stored at 4°C for several months.
Binding affinity to IL-17 and BAFF
Binding affinity and binding stoichiometry of the bispecific antibody to human
IL-17 and human BAFF is determined using a surface plasmon resonance assay on a
Biacore 2000 instrument primed with HBS-EP+ (GE Healthcare, 10 mM Hepes pH7.4 +
150 mM NaCl + 3 mM EDTA + 0.05% surfactant P20) running buffer and analysis
temperature set at 25 °C. A CM5 chip containing immobilized protein A (generated
using standard NHS-EDC amine coupling) on all four flow cells (Fc) is used to employ a
capture methodology. Antibody samples are prepared at 10 mcg/mL by dilution into
running buffer. Human IL-17 or human BAFF are prepared at final concentrations of
20.0, 10.0, 5.0, 2.5, 1.25 and 0 (blank) nM by dilution into running buffer. Each analysis
cycle consists of (1) capturing antibody samples on separate flow cells (Fc2, Fc3, and
Fc4), (2) injection of 250 mcL (300-sec) of human IL-17 or human BAFF over all Fc at
50 mcL/min, (3) return to buffer flow for 20 min to monitor dissociation phase, (4)
regeneration of chip surfaces with a 5 mcL (30-sec) injection of glycine, pH1.5, (5)
equilibration of chip surfaces with a 10 mcL (60-sec) injection of HBS-EP+. Data are
processed using standard double-referencing and fit to a 1:1 binding model using Biacore
2000 Evaluation software, version 4.1, to determine the association rate (kon, M 1units),
dissociation rate ( o ¾ s 1 units), and Rm ax (RU units). The equilibrium dissociation
constant (¾) is calculated as from the relationship ¾ = k0 ff/ko n , and is in molar units. .
Table 1: Binding affinity to human IL-17 and human BAFF by the bispecific antibody.
These results demonstrate that the bispecific antibody of the present invention
binds human IL-17 and human BAFF.
Simultaneous binding of IL-17 and BAFF
BIAcore 2000 instrument is used to determine whether human IL- 17 and human
BAFF can bind to the bispecific antibody simultaneously. Except as noted, all reagents
and materials are purchased from BIAcore AB (Upsala, Sweden). All measurements are
performed at 25°C. HBS-EP+ buffer (150 mM sodium chloride, 3 mM EDTA, 0.05 %
(w/v) surfactant P-20, and 10 mM HEPES, pH7.4) is used as the running buffer and
sample buffer. Protein A is immobilized on flow cells 1 and 2 of a CM4 sensor chip
using an amine coupling kit. The bispecific antibody is first captured on flow cell 2,
followed by injection of human IL-17 at 20 nM for 5 min to saturate IL-17 binding site.
After binding of IL-17, human BAFF at 20 nM is then injected for 5 min. and additional
binding signal is observed. Chip surface is then regenerated using lOmM Glycine pH 1.5.
The same process is repeated except with a different order of human IL-17 and human
BAFF. The stoichiometry is calculated to ensure complete saturation of human IL-17 or
human BAFF to the bispecific antibody. The stoichiometry of human IL-17 to the
bispecific antibody is typically at -1.3 based on a kinetic binding experiment. Similarly,
the stoichiometry of human BAFF to the bispecific antibody is typically at ~ 1.0 based on
a kinetic binding experiment. Control BAFF Ab is 4A5-3.1.1-B4 of US7,3 17,089.
Control IL-17 Ab is Fab 126 of US7,838,638.
Table 2 : Simultaneous binding of human IL-17 and human BAFF to the bispecific
antibody.
These results demonstrate that the bispecific antibody of the present invention can
bind human IL-17 and human BAFF simultaneously as shown by the increase in response
units (D RU) from the two ligands binding to the bispecific antibody.
Inhibition of IL-17-induced CXCL1 production in vitro from HT-29 cells
HT-29 cells are human colorectal adenocarcinoma epithelial cells that naturally
express the IL-17 receptor. Incubation of HT29 cells with human IL-17 results in the
production of CXCL1, which can be measured using a commercially available ELISA.
A dose range of the bispecific antibody from 41200 to 2.64 pM is evaluated (final
concentration based on monomeric MW of bispecific antibody (=100 kDa)). Each test
concentration of bispecific antibody is then added (50 mcl) to wells containing
recombinant IL-17 (final IL-17 concentration in the well is 3.75 nM (based on monomeric
MW of IL-17 (=16 kDa)). Testing is carried out in triplicate wells per treatment. Assay
medium is used for "medium alone" and "IL-17 alone" controls. An IL-17 neutralizing
antibody (Fab 126 of US7,838,638) is used as positive control in the assay. Plates
containing IL-17 and antibody mixtures are incubated for 60 to 90 minutes at 37°C, 95%
relative humidity, 5% C02 in the inner wells of tissue-culture treated 96 well plates. In a
variation of this assay, a saturating concentration of human BAFF is added (1.25 nM final
concentration based on monomeric MW of BAFF (=20 kDa)), with the goal to determine
if bispecific antibody would still be able to neutralize IL-17 when simultaneously bound
to BAFF. HT-29 cells are routinely cultured in assay medium (McCoy's 5A containing
10% FBS, penicillinG (0.2 U/mL) and streptomycin (0.2 mcg/mL)). On the day of the
assay, the cells are rinsed with HBSS and detached from the culture flasks with trypsin +
EDTA. The trypsin is inactivated with assay medium. HT-29 cells are then centrifuged
at 500Xg for 5 minutes at RT. The cell pellet is resuspended in assay medium. Cell
density is measured with a hemocytometer, and 20,000 HT-29 cells (in 100 mcl) are
added to the 96-well plates containing the antibody/IL-17 mixture. Two hundred mcl of
PBS is added to each of the unused edge wells (without cells) to reduce edge effects
resulting from evaporation. The 96-well plates are placed in a tissue culture incubator
(37°C, 95% relative humidity, 5%C02) for approximately 48 hours.
At the end of the assay, the plates are centrifuged (500Xg for 5 minutes at RT),
and the cell culture medium is transferred to polypropylene 96-well plates, which are
sealed and frozen at -80°C. On the day of measuring CXCLl by ELISA, the plates are
thawed at RT. CXCLl levels in medium (either undiluted, or diluted 1:3) are measured
with a CXCLl sandwich ELISA (R&D Systems DuoSet #DY275), as per the
manufacturer's instructions, using the following buffers and modifications: IX ELISA
wash buffer from BioFX Labs (from 10X, #WSHW- 1000-01); sample and standard
volume of 50 mcL per well; substrate from BioFX Labs ( 1 component HRP substrate,
#TMBW- 1000-01); a stop solution from BioFX Labs (#LSTP- 1000-01; 100 mcl per
well). At the end of the ELISA reactions, plates were read at 450 nm on a microplate
reader (Molecular Devices SpectraMax 190). Data are collected as % of maximum
amount of CXCLl produced (with IL-17 alone being 100%). The concentration where
50% of the IL-17-induced response is inhibited (IC50) by either bispecific antibody or the
positive control is calculated using a 4 parameter sigmoidal fit of the data (GraphPad
Prism).
The results demonstrate that the bispecific antibody of the present invention
inhibited IL-17-induced secretion of CXCLl by HT-29 cells in a concentration-dependent
manner. The inhibition is comparable to that observed with the positive control antibody
(with an IC50 for bispecific antibody of 2.00 + 0.21 nM versus 1.86 + 0.22 nM for the
positive control antibody (average of 3 independent experiments + SEM)), whereas the
negative control antibody did not inhibit proliferation. Moreover, a similar inhibition is
observed in the presence of a saturating amount of BAFF, with an IC50 for bispecific
antibody of 1.57 + 0.45 nM versus 1.41 + 0.50 nM for the positive control antibody
(average of 3 independent experiments + SEM). The bispecific antibody of the present
invention effectively neutralizes IL-17 and that this neutralization is not affected by the
presence of saturating amounts of BAFF.
Inhibition of BAFF-induced proliferation in vitro of T1165 cells
Tl 165.17 is a murine plasmacytoma cell line that is dependent on external factors
(IL-lbeta or BAFF) for survival and growth. These cells naturally express the receptor
for BAFF and their response to human BAFF is measured by monitoring proliferation.
A dose range of the bispecific antibody from 1 nM to 4.1 pM (final concentration
based on monomeric MW of bispecific antibody (=100 kDa)) is evaluated for the ability
to neutralize soluble BAFF (final soluble BAFF concentration in assay is 150 pM based
on monomeric MW of BAFF (=20 kDa)). Various concentrations of bispecific antibody
are incubated with soluble BAFF for 30-60 minutes at 37°C in the inner wells of a flat
bottom 96 well tissue culture plate in a total volume of 50 mcl. A BAFF neutralizing
antibody (4A5-3.1.1-B4 of US7,317,089) is used as positive control in the assay. Each
condition is tested in triplicate. In a variation of this assay, the ability of bispecific
antibody to neutralize membrane BAFF is tested. Various concentrations of bispecific
antibody are incubated with the membrane fraction of HEK293 cells expressing a noncleavable
form of BAFF (achieved by mutating the furin cleavage site in BAFF, resulting
in permanent expression of BAFF on the cell membrane). In another variation of this
assay, a saturating concentration of human IL-17 is added (15.6 nM final concentration,
based on monomeric MW of IL-17 (=16 kDa)), with the goal to determine if bispecific
antibody would still be able to neutralize either soluble or membrane BAFF when
simultaneously bound to IL-17.
Tl 165 cells are routinely cultured in assay medium (RPMI1640 containing 10%
FBS, HEPES, L-Glutamine, lmM Sodium Pyruvate, 5 x 10 M 2-mercaptoethanol, IX
Antibiotic-Antimycotic) supplemented with 2 ng/mL recombinant human IL-lbeta. On
the day of the assay cells are washed 3 times with assay medium and resuspended to
lxlO 5 cells/mL in assay medium. Fifty mcl of the cell suspension is added to the 96 well
plate, containing the mixture of antibody and BAFF. One hundred mcl of assay medium
is added to each of the unused edge wells (without cells) to reduce edge effects resulting
from evaporation. Plates are placed in a tissue culture incubator (37°C, 95% relative
humidity, 5%C02) for approximately 44 hours. At the end of the assay 20 mcl of
Promega Cell Titer 96 Aqueous One Solution is added to each well and incubated for 1 to
4 hours at 37°C. Plates are read at 490 nm on a microplate reader (Molecular Devices
SpectraMax 190). Data are collected as % inhibition, using wells without BAFF as the
minimum and wells with 150 pM BAFF as the maximum responses. The concentration
where 50% of the BAFF-induced response is inhibited (IC50) by either bispecific
antibody or the positive control is calculated using a 4 parameter sigmoidal fit of the data
(SigmaPlot).
The results demonstrate that the bispecific antibody inhibits soluble BAFFinduced
proliferation of Tl 165 cells in a concentration-dependent manner. This
inhibition is comparable to that observed with the positive control antibody (with an IC50
for bispecific antibody of 0.064 + 0.021 pM versus 0.071 + 0.002 pM for the positive
control antibody (average of 2 independent experiments + SEM)), whereas the negative
control antibody did not inhibit proliferation. Moreover, a similar inhibition is observed
in the presence of a saturating amount of IL-17, with an IC50 for bispecific antibody of
0.060 + 0.014 pM versus 0.073 + 0.012 pM for the positive control antibody (average of
2 independent experiments + SEM). The bispecific antibody effectively neutralizes
BAFF and this neutralization is not affected by the presence of saturating amounts of IL-
17.
The ability of bispecific antibody to inhibit proliferation of Tl 165 cells induced
by membrane-bound BAFF is also demonstrated. The bispecific antibody of the present
invention effectively inhibits proliferation induced by membrane-bound BAFF similarly
to the positive control BAFF antibody (4A5-3.1.1-B4 of US7,3 17,089). Moreover,
similar inhibition is observed in the presence of a saturating amount of IL-17.
Inhibition of human IL-17-induced production of CXCL1 in vivo
Injection of human IL-17 leads to a rapid and transient increase in mouse CXCL1
in the circulation. Regular female C57B16 mice (n=8 per group) are injected SC with
either bispecific antibody (66 meg/mouse), or a positive control anti-IL-17 antibody (Fab
126 of US7, 838,638, 50 meg/mouse) or negative control antibody (huIgG4, 50
meg/mouse). Two days later, mice receive a single IP injection of human IL-17 (3
meg/mouse) and 2 hours later serum is collected and stored at -80°C until analysis. The
concentration of CXCL1 is determined by ELISA. Microtiter plates are coated with an
antibody capturing human Fc (Jackson ImmunoResearch 109-005-098, 1 mcg/mL) and
incubated overnight at 4°C. Plates are washed, blocked with casein, and 100 mcl of serum
(1:1000 dilution) is added. Plates are incubated for 2h at RT, washed and an HRP-labeled
detection antibody (anti-human IgG, Jackson ImmunoResearch 709-035-149) is added.
Plates are incubated for lh at RT, washed and developed using TMB substrate and read
using a plate reader. The concentration is calculated based on appropriate standard curves.
Table 3 : IL-17-induced levels of CXCL1 after exposure to bispecific antibody.
These data confirms that human IL-17 results in an increase in serum CXCL1
levels. However, in the presence of the bispecific antibody these results demonstrate that
the IL-17-induced increase of CXCL1 is reduced (P<0.01, ANOVA) relative to animals
that receive the negative control antibody. The reduction in CXCL1 with bispecific
antibody is comparable to that observed with the positive control anti-IL-17 antibody.
Equivalent exposure to either bispecific antibody, the positive and negative control
antibodies within each group is confirmed by quantitative ELISA. Thus, bispecific
antibody of the present invention effectively neutralizes biological effects induced by
human IL-17 in the mouse. P value determination is compared to negative control/IL-17
group.
Inhibition of human BAFF in vivo
Mice that carry a transgene encoding soluble human BAFF have an abnormally
high number of B lymphocytes in the spleen.
Mice transgenic for human BAFF (n=5 per group) are injected IP with either a
single dose of bispecific antibody (660 meg/mouse), or a positive control anti-BAFF
antibody (4A5-3.1.1-B4 US7,3 17,089, 500 meg/mouse) or negative control antibody
(huIgG4, 500 meg/mouse). Eight days later, serum and spleens are collected. A single cell
suspension of spleen cells is prepared and the total number of leukocytes is determined
after lysing the red blood cells. The relative percentage of B lymphocytes is determined
using the cell surface marker B220 by flow cytometry. The total number of B cells per
spleen is calculated by multiplying the percentage of B220 positive cells by the total
number of lymphocytes in the spleen. Microtiter plates are coated with an antibody
capturing human Fc (Jackson ImmunoResearch 109-005-098, 1 mcg/mL) and incubated
overnight at 4°C. Plates are washed, blocked with casein, and 100 mcl of serum (1:5000
dilution) is added. Plates are incubated for 2h at RT, washed and an HRP-labeled
detection antibody (anti-human IgG, Jackson ImmunoResearch 709-035-149) is added.
Plates are incubated for lh at RT, washed and developed using TMB substrate and read
using a plate reader. The concentration is calculated based on appropriate standard curves.
Table 4 : B cell numbers in the spleen of mice transgenic for human BAFF after exposure
of bispecific antibody.
These results demonstrate that the number of B cells in the spleens of mice
transgenic for human BAFF is reduced (p<0.0001, ANOVA) by a single administration of
bispecific antibody. This normalization of B cell numbers is equivalent to that observed
with the positive control BAFF antibody. Equivalent exposure to either bispecific
antibody, the positive and negative control antibodies within each group is confirmed by
quantitative ELISA. Thus, bispecific antibody of the present invention effectively
neutralizes biological effects induced by human BAFF in the mouse. P value
determination is compared to negative control group.
Solubility and Stability Analysis
The bispecific antibody is formulated in PBS at pH 7.4. The bispecific antibody is
concentrated from 1-2 mg/mL to a concentration ranging from 52 mg/mL to 58 mg/mL
using Amicon concentrators. Concentrated samples are stored at 25°C over a period of 4
weeks. Samples are analyzed for percent high molecular weight (%HMW) with size
exclusion chromatography (SEC) at initial concentration, 1 day, 1 week, and 4 weeks
incubations. SEC is performed on a Agilent 1100 system using a TSK G3000SW-XL
(Tosoh Bioscience) column. PBS + 0.35M NaCl, pH 7.4 is used as the mobile phase
running at 0.5 mL/min for 35 minutes. A volume of luL of the concentrated antibody is
injected into the column and the detection is measured at 280nm. Chromatograms are
analyzed using ChemStation and % high molecular weight (HMW) is calculated using the
ratio of AUC of the peaks eluted before the monomer peak to total AUC. Samples stored
at 25°C at different time points are analyzed for %HMW and the results are summarized
in Table 5.
Table 5 : Summary of % high molecular weight species measured by SE-HPLC.
Preliminary studies with a starting bispecific antibody comprising a BAFF
antibody of WO20030 16468 and an IL-17 antibody of WO2007070750 demonstrated that
after concentration to only 6 mg/mL, a 25% increase in % HMW species was detected by
SE-HPLC after 3 weeks storage at 4°C in PBS, and at 30 mg/mL the increase in % HMW
species was 15% after just 2 days storage at 4°C in PBS. These results demonstrate that
the bispecific antibody of the present invention has much improved properties, including
decreased aggregation and increased physical stability, over the starting bispecific
antibody.
WE CLAIM:
1. A bispecific antibody comprising two first polypeptides and two second polypeptides
wherein the amino acid sequence of the first polypeptide is SEQ ID NO: 1 and the
amino acid sequence of the second polypeptide is SEQ ID NO:2.
2. The bispecific antibody of Claim 1, wherein the intra-chain disulfide bond between
cysteine residue 507 of SEQ ID NO: 1 and cysteine residue 707 of SEQ ID NO: 1.
3. A DNA molecule comprising a polynucleotide sequence encoding a polypeptide
having the amino acid sequence of SEQ ID NO: 1.
4. A DNA molecule comprising a polynucleotide sequence encoding a polypeptide
having the amino acid sequence of SEQ ID NO:2.
5. A DNA molecule comprising a polynucleotide sequence encoding a polypeptide
having the amino acid sequence of SEQ ID NO: 1 and comprising a polynucleotide
sequence encoding a polypeptide having the amino acid sequence of SEQ ID NO:2.
6. A mammalian cell comprising the DNA molecule of Claim 3 and the DNA molecule
of Claim 4, which cell is capable of expressing a bispecific antibody comprising a
first polypeptide having an amino acid sequence of SEQ ID NO: 1 and a second
polypeptide having an amino acid sequence of SEQ ID NO:2.
7. A mammalian cell transformed with the DNA molecule of Claim 5, which cell is
capable of expressing a bispecific antibody comprising a first polypeptide whose
amino acid sequence is SEQ ID NO:l and a second polypeptide whose amino acid
sequence is SEQ ID NO:2.
8. The mammalian cell of Claims 6 and 7, wherein the mammalian cell is CHO.
9. A process for producing a bispecific antibody comprising a first polypeptide whose
amino acid sequence is SEQ ID NO:l and a second polypeptide whose amino acid
sequence is SEQ ID NO:2, comprising: (1) cultivating the mammalian cell of Claim
8 under conditions such that the bispecific antibody is expressed, and; (2) recovering
the expressed bispecific antibody.
10. A bispecific antibody produced by the process of Claim 9.
11. A method of treating Systemic Lupus Erythematosus, Lupus Nephritis, Rheumatoid
Arthritis, Psoriasis, Ankylosing Spondylitis, Psoriatic Arthritis, primary Sj5gren's
syndrome, or Multiple Myeloma comprising administering to a patient in need thereof
an effective amount of a bispecific antibody of any one of Claims 1, 2 or 10.
12. A bispecific antibody of any one of Claims 1, 2 or 10 for use in therapy.
13. A bispecific antibody of any of Claims 1, 2 or 10 for use in the treatment Systemic
Lupus Erythematosus, Lupus Nephritis, Rheumatoid Arthritis, Psoriasis, Ankylosing
Spondylitis, Psoriatic Arthritis, primary Sj5gren's syndrome, or Multiple Myeloma
14. A pharmaceutical composition comprising a bispecific antibody of any one of Claims
1, 2 or 10 and one or more pharmaceutically acceptable carriers, diluents or
excipients.