Abstract: The present invention provides an antibody that specifically binds to envelope protein 2 of HCV of genotype 2a but does not immunologically react with envelope protein 2 of HCV of genotype 1a.
DESCRIPTION
ANTIBODY BINDING TO ENVELOPE PROTEIN 2 OF HEPATITIS C VIRUS
AND METHOD FOR IDENTIFYING GENOTYPE OF HEPATITIS C VIRUS
USING THE SAME
Technical Field
[0001]
The present invention relates to an antibody binding to envelope protein
2 of Hepatitis C virus and a method for identifying the genotype of Hepatitis C
virus using the antibody.
Background Art
[0002]
Hepatitis C virus (which may be also referred to as "HCV" hereinafter) is
a major causative virus of non-A and non-B hepatitis, which infects mainly via
transfusion and sexual contact (Choo et al., Science, Vol. 244: 359-362, 1989).
It has been estimated that there are 2,000,000 or more HCV carriers in Japan
including those who show no hepatitis symptoms (virus carriers), and there are
170,000,000 or more HCV carriers in the world. The major causes for the
increasing number of HCV carriers are the fact that the chronicity rate of
hepatitis due to HCV infection is as high as 70% to 80%, and the fact that
effective antiviral agents other than interferons do not exist.
[0003]
Pathological conditions exhibited by half or more of chronic hepatitis C
patients will almost certainly go from bad to worse and are known to progress to
cirrhosis or cancer of the liver. Hence, it can be said that hepatitis C is a
serious infectious disease with a poor prognosis. Therefore, studies concerning
the treatment of hepatitis C and the detection of HCV are medically important,
and development of new therapies and therapeutic drugs has been desired.
[0004]
HCV is a single-stranded (+) RNA virus having a genome length of
approximately 9.6 kb, in which the genome encodes a precursor protein that is
converted into 10 types of virus protein (i.e., Core, E1, E2, p7, NS2, NS3, NS4A,
NS4B, NS5A, and NS5B proteins) via post-translational cleavage by
host-derived signal peptidase or HCV-derived proteases. HCV is classified into
10 or more genotypes (e.g., la, lb, 2a, 2b, 3a, and 3b) according to phylogenetic
analysis of the nucleotide sequences of the genome (Choo et al., Science, 1989,
Vol. 244, p. 359-362; Simmonds et al., Hepatology, 1994, Vol. 10, p. 1321-1324;
Okamoto et al., J. Gen. Virol., 1992, Vol. 73, p. 73-679; and Mori et al.,
Biochem. Biophys. Res. Commun., 1992, Vol. 183, p. 334-342).
[0005]
Recently, it has become known that the effects of interferons vary
significantly depending on HCV genotype. It has been revealed that the
antiviral action of interferons is exerted with difficulty on HCV of genotype la
or lb (Fried et al., N. Engl. J. Med., 2002, Vol. 347, p. 975-982 and Lusida et al.,
J. Clin. Microbiol., 2001, Vol. 39, p. 3858-3864).
[0006]
Furthermore, it has become known that the antiviral action of
interferons is exerted differently on HCV of genotype 2a and HCV of genotype
2b, on which interferons have relatively good effects. It has been suggested
that interferons exert their antiviral action more significantly on HCV of
genotype 2a than on HCV of genotype 2b (Murakami et al., Hepatology, 1999,
Vol. 30, p. 1045-1053).
[0007]
An HCV antibody test is known as an HCV diagnostic method by
which an anti-HCV antibody in serum is detected using a C100-3 antigen, since
the anti-HCV antibody recognizing the NS4 region (C100-3 antigen), which is a
non-structural region of HCV, exists at the rate of 70%-80% in the serum of a
hepatitis C patient (Choo et al., Science, 1989, Vol. 244, p. 359-362). Also, as
variations of this method, a second-generation antibody assay system with
detection sensitivity that has been improved using a combination of the C100-3
antigen, a core antigen, and an antigen from the NS3 region and a
third-generation antibody assay system also containing an antigen from the NS5
region in addition to the above antigens have been developed. HCV antibody
tests using these assay systems have been used (Aucella et al., Blood Purif.,
2000, Vol. 18, p. 110-114).
[0008]
Also, other than the aforementioned HCV antibody tests, an HCV core
antigen test (Fabrizi et al., J. Clin. Microbiol., 2005, Vol. 43, p. 414-420) is used
for direct measurement of the amount of an HCV core protein in serum and a
nucleic acid amplification test (NAT) is used for confirmation of the presence or
absence of the HCV genome by a PCR method (Velati et al., Euro Serveill., 2005,
Vol. 10, p.. 12-14).
[0009]
However, HCV antibody tests are problematic in that when a subject
has experienced HCV infection in the past, the subject would unavoidably test
positive for hepatitis C, even after being completely cured. HCV antibody tests
are also problematic, since an anti-HCV antibody in blood is detected only when
1 to 3 months have passed after infection. If a test is conducted before such
time, HCV cannot be detected and the subject would test negative for hepatitis
C.
[0010]
Also, HCV core antigen tests need treatment to cause the liberation of
a core protein by disrupting the envelope using SDS, since the core protein (a
target molecule) is present within HCV particles. Depending on treatment time
with SDS, the core protein may be denatured or substances inhibiting the
antigen-antibody reaction may be liberated, thus effecting detection sensitivity.
[0011]
Furthermore, even when a subject tests positive for HCV in an HCV
antibody test and an HCV core antigen test, it is currently impossible to identify
the HCV genotype. To conduct interferon therapy, further tests, such as a
nucleic acid amplification test, must be conducted in order to identify the HCV
genotype. This is because the antiviral action of interferons significantly
differs depending on HCV genotype. Particularly on HCV genotype la and
HCV genotype lb, effective antiviral action cannot be exerted, and patients
rather suffer from adverse effects of interferon.
[0012]
Meanwhile, a nucleic acid amplification test is problematic in relation
to insufficient preservative quality and stability for test samples, since the test
uses serum RNA of a subject as a target molecule. The nucleic acid
amplification test also presents various problems, and precautions are necessary
in regards to the use of an RT-PCR method. For example, PCR may be carried
out after transcription of RNA as a target molecule to DNA, resulting in a false
negative result due to RNA degradation or inactivation and/or inhibition of a
reverse transcriptase or a false positive result due to cross contamination of a
reaction system. Hence, the nucleic acid amplification test is thought to be
inferior to an HCV antibody test or an HCV core antigen test using a protein as a
target molecule in terms of accuracy.
Disclosure of the Invention
Problem to Be Solved by the Invention
[0013]
Objects of the present invention are to provide antibodies that bind to
envelopes on HCV surfaces and can be used for identifying HCV of genotype 1a,
HCV of genotype lb, and HCV of genotype 2a and to provide a method for
identifying HCV genotypes using such antibodies.
Means for Solving the Problem
[0014]
The present inventors conducted concentrated studies in order to achieve
the above objects. They obtained hybridomas producing monoclonal antibodies
against envelope protein 2 of HCV genotype 2a as an antigen, obtained from
among the hybridomas, an antibody specifically binding to only envelope protein
2 of HCV genotype 2a, an antibody binding to only envelope protein 2 of HCV
genotype 2a and envelope protein 2 of HCV genotype lb, and an antibody
binding to envelope protein 2 of HCV genotype 2a, envelope protein 2 of HCV
genotype lb, and envelope protein 2 of HCV genotype la, and thus they
completed the present invention.
[0015]
Specifically, the present invention provides an antibody that
specifically binds to envelope protein 2 of HCV of genotype 2a but does not
immunologically react with envelope protein 2 of HCV of genotype la.
[0016]
The above antibody is preferably an antibody that recognizes the
amino acid sequence shown in SEQ ID NO: 1 in the Sequence Listing as an
epitope. An example of such an antibody is an antibody that is produced by the
hybridoma cell line having provisional accession No. FERM ABP-11181.
[0017]
Also, preferably the above antibody specifically binds to envelope
protein 2 of HCV of genotype 2a, but it does not immunologically react with
envelope protein 2 of HCV of genotype 1a and envelope protein 2 of HCV of
genotype 1b.
[0018]
The above antibody is more preferably an antibody that recognizes the
amino acid sequence shown in SEQ ID NO: 2 or 3 in the Sequence Listing as an
epitope. An example of such an antibody is an antibody that is produced by the
hybridoma cell line having provisional accession No. FERM ABP-11180 or
FERM ABP-11179.
[0019]
Moreover, the above antibody is preferably an antibody that
specifically binds to envelope protein 2 of the J6CF strain but does not
immunologically react with envelope protein 2 of the JFH1 strain. Examples of
such an antibody include an antibody that recognizes the amino acid sequence
shown in SEQ ID NO: 4 in the Sequence Listing as an epitope, in particular, an
antibody that is produced by the hybridoma cell line having provisional
accession No. FERM ABP-11183.
[0020]
Also, the present invention provides a method for identifying HCV
genotypes, wherein: the genotype of HCV is determined to be genotype lb if the
virus binds to the antibody that is produced by the hybridoma cell line having
provisional accession No. FERM ABP-11181 but does not bind to either of
antibodies that are produced by the hybridoma cell lines having provisional
accession Nos. FERM ABP-11180 and FERM ABP-11179; the genotype of HCV
is determined to be genotype 2a if the virus binds to an antibody that is produced
by the hybridoma cell line having provisional accession No. FERM ABP-11181
and binds to the antibodies that are produced by the hybridoma cell lines having
accession Nos. FERM ABP-11180 and FERM ABP-11179; and the genotype of
HCV is determined to be genotype la if the virus binds to an antibody that is
produced by the hybridoma cell line having provisional accession No. FERM
ABP-11182 but does not bind to any of antibodies that are produced by the
hybridoma cell lines having provisional accession Nos. FERM ABP-11181,
FERM ABP-11180, and FERM ABP-11179.
[0021]
This description includes the contents of the description and/or
drawings of Japanese Patent Application No. 2008-254338, to which the present
application claims the priority.
Effects of the Invention
[0022]
According to the present invention, simple and very accurate
identification of HCV genotype 1a, HCV genotype 1b, and HCV genotype 2a is
made possible and hepatitis C patients for whom interferon therapy is
appropriate can be efficiently selected. In particular, adverse reactions can be
alleviated and the chance of selecting a new therapeutic method can be provided
for hepatitis C patients infected with HCV of genotype 1a or 1b, for which no
therapeutic effects can be expected from interferon therapy.
Brief Description of the Drawings
[0023]
Fig. 1 is a schematic diagram showing an HCV precursor protein.
Black squares indicate transmembrane regions.
Fig. 2 is a schematic diagram showing a fusion protein of a 3 x FLAG
protein and an antigen E2 protein.
Fig. 3 is a schematic diagram showing a fusion protein of an antigen
E2 protein and a human immunoglobulin Fc domain.
Fig. 4 shows SDS-PAGE results for each fraction obtained in a step of
purification of a 3 x FLAGJ6E2dTM protein. Expression and purification of 3
x FLAG-J6E2dTM in COS1 cells are shown. 3 x FLAGJ6E2dTM protein was
detected in an elution fraction. The lanes of the electrophoretic photograph in
Fig. 4 indicate the following, respectively: 1, molecular weight marker; 2,
culture supernatant; 3, anti-FLAG antibody column Void fraction; 4, anti-FLAG
antibody column elution fraction 1; 5, anti-FLAG antibody column elution
fraction 2; 6, anti-FLAG antibody column elution fraction 3; 7, anti-FLAG
antibody column elution fraction 4; and 8, molecular weight marker.
Fig. 5 shows SDS-PAGE results for J6E2-Fc, JFH1E2-Fc, THE2-Fc,
ConlE2-Fc, J1E2-Fc, and H77E2-Fc proteins. Each type of E2 Fc protein has
approximately 97 kDa under reductive conditions. The purified fusion protein
of each of HCV strain-derived antigen E2 proteins and a human immunoglobulin
Fc domain is shown. The lanes of the electrophoretic photograph in Fig. 5
indicate the following, respectively: 1, molecular weight marker; 2, J6E2-Fc; 3,
JFH1E2-Fc; 4, THE2-Fc; 5, ConlE2-Fc; 6, J1E2-Fc; 7, H77E2-Fc; and 8,
molecular weight marker.
Fig. 6 shows the binding property to E2 proteins of various HCV
genotypes/strains and antibody subtype of each monoclonal antibody. The
strength of binding of an antibody to an antigen E2 protein is indicated with - to
+++ (-, OD450 nm < 0.1; +, 0.1 ≤ OD450 nm < 0.25; ++, 0.25≤ OD450 nm < 0.4;
+++, 0.4≤ OD450 nm). Fig. 6 indicates that: 8D10-3 is an antibody binding to
the antigen E2 proteins of HCV of genotype la and of HCV of genotype lb, and
of HCV of genotype 2a; 1G2-32 and 2F2-7 are antibodies binding to the antigen
E2 protein of HCV of genotype 2a; 4E8-8 is an antibody binding to the antigen
E2 proteins of HCV of genotype lb and of HCV of genotype 2a; M1E12-1 is a
monoclonal antibody binding to the antigen E2 protein of the JFH1 strain; and
9A5-4 is a monoclonal antibody binding to the antigen E2 proteins of the JFH1
strain and of the H77 strain.
Fig. 7 shows the binding strength of a 8D10-3 monoclonal antibody
(Fig. 7A), a 1G2-32 monoclonal antibody (Fig. 7B), a 4E8-8 monoclonal
antibody (Fig. 7C), a 2F2-7 monoclonal antibody (Fig. 7D), and a M1E12-1
monoclonal antibody (Fig. 7E) to peptides having amino acid sequences derived
from the antigen E2 protein of the HCV J6CF strain.
Fig. 8 shows the sensitivity of detecting antigen E2 proteins derived
from various HCV genotypes/HCV strains, as determined by sandwich ELISA
using 1G2-32 and 8D10-3 monoclonal antibodies. In Fig. 8, the black circle
indicates J6E2-Fc, the white circle indicates JFH1E2-Fc, the black square
indicates THE2-Fc, the white square indicates ConlE2-Fc, the black diamond
indicates J1E2-Fc, and the white diamond indicates H77E2-Fc.
Fig. 9 shows the presence or absence of HCVE2 proteins of various
genotypes/strains as detected by a Western blot method using the monoclonal
antibody 8D10-3.
Modes for Carrying out the Invention
[0024]
Hereinafter, preferred embodiments for implementing the present
invention will be described as follows.
[0025]
The antibody of the present invention is characterized by specifically
binding to envelope protein 2 (hereinafter, E2 protein) of HCV of genotype 2a
(hereinafter, HCV2a), but not immunologically reacting with the E2 protein of
HCV of genotype la (hereinafter, HCV1a). In a preferred embodiment, such an
antibody does not immunologically react with both the E2 protein of HCVla and
the E2 protein of HCV of genotype lb (hereinafter, HCV1b).
[0026]
The above antibody can be prepared by immunizing an animal with an
antigen protein consisting of the region without transmembrane region (also
referred to as transmembrane domain) of an E2 protein of HCV or a partial
peptide of the antigen protein as an antigen, preparing hybridomas producing
monoclonal antibodies against the E2 protein, and then screening for hybridomas
producing an antibody that specifically binds to the E2 protein of HCV2a but
does not immunologically react with the E2 protein of HCV1a, and furthermore
preferably does not immunologically react with both the E2 protein of HCV1a
and the E2 protein of HCV1b.
[0027]
Herein "E2 protein" is a functional virus protein generated via
cleavage of an HCV precursor protein by host cell-derived signal peptidase and 2
types of protease encoded by HCV itself. This is explained using the J6CF
strain of HCV2a as an example such that when methionine located at the
N-terminus of a precursor protein is determined to be the 1st amino acid, the E2
protein is a protein of 367 amino acids residues ranging from the amino acid
positions 384 to 750 of the precursor protein. A region in the E2 protein, ranging
from the amino acid positions 722 to 750, is a transmembrane domain (Cocquerel
et al., J. Virol., 2000, Vol. 74, p. 3623-3633). Fig. 1 is a schematic diagram
showing an HCV precursor protein.
[0028]
Hereinafter, techniques for obtaining the above antibodies will be
described sequentially.
[0029]
1) Selection of E2 protein-derived protein or peptide as an antigen
As an antigen to be used for immunization of an animal to obtain the
above antibody, a protein consisting of the region without the transmembrane
region from the E2 protein of HCV2a (hereinafter, antigen E2 protein) or a
partial peptide of the protein (antigen E2 peptide) can be used. An antigen E2
peptide is required to consist of a region with low homology with the E2 protein
of HCV of a genotype other than 2a.
[0030]
As the antigen E2 protein, a protein comprising amino acids 384 to
720 of a precursor protein of HCV2a (e.g., SEQ ID NO: 5) may be selected.
Preferably, a protein comprising the amino acid sequence ranging from amino
acid positions 530 to 562 of the precursor protein is selected, and more
preferably a protein comprising one or more amino acid sequences selected from
the group consisting of: the amino acid sequence comprising amino acids 465 to
484; the amino acid sequence comprising amino acids 559 to 584 and the amino
acid sequence comprising amino acids 683 to 719 of the precursor protein is
selected.
[0031]
Also, as the antigen E2 peptide, a peptide comprising amino acids 530
to 562 (more preferably, amino acids 531 to 549, and further preferably, amino
acids 531 to 540) of a precursor protein of HCV2a (e.g., SEQ ID NO: 5) and
having a peptide length of 10 to 19 amino acids (more preferably, 10 amino
acids) may be selected. More preferably, a peptide comprising amino acids 465
to 484 (more preferably, amino acids 465 to 477 and further preferably amino
acids 468 to 477) of the precursor protein and having a peptide length of 10 to 13
amino acids (more preferably, 10 amino acids); a peptide comprising amino
acids 559 to 584 (more preferably, amino acids 564 to 576 and further preferably
amino acids residues at positions 567 to 576) of the precursor protein and having
a peptide length of 10 to 13 amino acids (more preferably, .10 amino acids); or a
peptide comprising amino acids 683 to 719 (preferably, amino acids 704 to 719
and more preferably amino acids 709 to 719) of the precursor protein and having
a peptide length of 10 to 19 amino acids (more preferably, 10 amino acids) is
selected.
[0032]
In addition, the nucleotide sequence of the HCV2a genome has already
been revealed in many viral strains (Yanagi et al., Virology, 1999, Vol. 262, p.
250-263) and is available from GenBank. For example, the nucleotide sequence
of the genome of the JFH1 strain of HCV2a is disclosed in GenBank under
accession No. AB047639 and the nucleotide sequence of the genome of the J6CF
strain is disclosed in GenBank under accession No. AF177036.
[0033]
2) Preparation of antigen E2 peptides
The above selected antigen E2 peptides can be directly chemically
synthesized based on the amino acid sequence information of the precursor
protein of HCV2a. For example, such an antigen that can be used for
immunization of animals can be easily prepared in a large amount by using a
peptide synthesizer.
[0034]
3) Preparation of antigen E2 protein
The above selected antigen E2 protein can be prepared in a large
amount as an antigen that can be used for immunization of animals by
synthesizing a DNA fragment encoding the antigen E2 protein based on the
nucleotide sequence information concerning the region encoding the precursor
protein of HCV2a and then causing the translation of the antigen E2 protein from
the thus obtained DNA fragment in cells. This will be more specifically
described as follows.
[0035]
The antigen E2 protein can be produced in cells by constructing an
expression vector in which a DNA fragment encoding the antigen E2 protein has
been inserted and then carrying out transduction into mammalian cells, insect
cells, yeast, Escherichia coli, or the like. Preferably the protein is produced via
secretory expression by mammalian cells. In this case, a DNA fragment
encoding an antigen E2 peptide is ligated in-frame downstream of the signal
peptide sequence so that the frames of codon match, and a stop codon is added to
the 3' terminus, and then the resultant may be inserted into an expression vector.
[0036]
Examples of mammalian cells for secretory expression of an antigen
E2 protein include, COS-1, COS-7, Vero, CV-1, CHO, dhfr gene-deficient CHO,
hamster cell BHK, rat GH3, rat phaeochromocytoma PC 12, mouse L cells, mouse
C127 cells, mouse myeloma cells SP2/0, NSO, and NS-1, mouse lymphoma cells
EL4, mouse fibroblasts NIH3T3 and 10T1/2, mouse myoblasts C2C12, mouse
stromal cells PA6, ST2, OP9, and Tst-4, human megakaryoblastic cells CMK,
human T cells Jurkat, human renal epithelial cells 293, human hepatic cancer
cells Huh7, HepG2, and IMY-N9, human osteosarcoma cells MG-63, human FL
cells, white adipocytes, ovum cells, and ES cells.
[0037]
DNA encoding the protein is inserted under control of a promoter and
then used for recombinant expression of an antigen E2 protein in cells.
Examples of such a promoter that can be used for recombinant expression of an
antigen E2 protein in mammalian cells include an SRa promoter, an SV40
promoter, an LTR promoter, a CMV promoter, an actin promoter, an EF-1α
(elongation factor-1α) promoter, an ubiquitin promoter, and a PGK
(phosphoglycerate kinase) promoter.
[0038]
Examples of an expression vector for secretory expression of an
antigen E2 protein in mammalian cells include pSecTag/FRT/V5-His (Invitrogen
Corporation), p3xFLAG-CMV-9 (Sigma), p3xFLAG-CMV13 (Sigma),
pFUSE-Fc2 (InvivoGen), and pTriEx-7 (Novagen). A signal peptide sequence
incorporated in an expression vector is preferably a signal peptide of
preprotrypsin. Examples of a vector having the signal peptide sequence of
preprotrypsin include p3xFLAG-CMV-9 (Sigma) and p3xFLAG-CMV-13
(Sigma). In addition, since when a protein containing a signal peptide is
expressed in mammalian cells, the signal peptide is removed, such a signal
peptide poses no problem upon the use of an antigen E2 protein.
[0039]
Upon secretory expression of an antigen E2 protein in mammalian
cells, the target antigen E2 protein is expressed as a fusion protein with a
labeling protein (e.g., Tag) and then the antigen E2 protein can be detected and
purified using an antibody against or a molecule specifically binding to the
labeling protein. Examples of a labeling protein include a FLAG peptide, a
3xFLAG peptide, an HA peptide, a 3xHA peptide, an myc peptide, a 6xHis
peptide, a GST polypeptide, an MBP polypeptide, a PDZ domain polypeptide,
alkaline phosphatase, an immunoglobulin Fc domain, and avidin. As labeling
proteins to be used for preparing an antigen E2 protein, a FLAG peptide, an HA
peptide, and an immunoglobulin Fc domain are suitable and an immunoglobulin
Fc domain is more suitable.
[0040]
Fig. 2 is a schematic diagram showing a fusion protein of an antigen
E2 protein and a 3 x FLAG protein. Fig. 3 is a schematic diagram showing a
fusion protein of an antigen E2 protein and an immunoglobulin Fc domain.
[0041]
As such an immunoglobulin Fc domain, human-derived,
monkey-derived, mouse-derived, rat-derived, rabbit-derived, hamster-derived, or
chicken-derived immunoglobulin Fc domain can be used and a human-derived
immunoglobulin Fc domain is preferred. In addition, the class of an
immunoglobulin heavy chain of the immunoglobulin Fc domain may be IgM,
IgGl,IgG2, IgG3,or IgG4.
[0042]
The amino acid sequences of human immunoglobulins are as reported
by Edelman et al. (Proc. Natl. Acad. Sci. U.S.A., 1969, Vol. 63, p. 78-85).
Also, the nucleotide sequence information of the cDNAs of human
immunoglobulin heavy chains is available from GenBank (the heavy chain:
accession No. BX640627, for example). PCR primers are designed based on the
obtained nucleotide sequences and then PCR is carried out using a cDNA library
of human spleen cells or human genomic DNA as a template, so that the cDNA
of the immunoglobulin Fc domain can be cloned.
[0043]
An HCV E2 protein can be directly ligated to an immunoglobulin Fc
domain at a connection site between them, or linked to it via a linker peptide
inserted therein. Examples of a linker peptide include Ser-Gly, Asp-Pro,
Asp-Pro-Glu, Gly-Asp-Pro-Glu, Gly-Gly-Gly-Ser, and (Gly-Gly-Gly-Ser)x3.
[0044]
In addition, upon secretory expression of an antigen E2 protein by
insect cells, for example, insect cells such as Sf21, Sf9, and High Five™ were
transduced with an expression vector using a polyhedrin (polyhedral body)
promoter, a p10 promoter, or the like. Then the antigen E2 protein or a fusion
protein of the antigen E2 protein and a labeling protein may be expressed.
[0045]
Also, upon secretory expression of an antigen E2 protein by yeast, for
example, Saccharomyces cerevisiae, Schizosaccharomyces pombe, or Pichia
pastoris is transduced with an expression vector using a gall promoter, a gal 10
promoter, a heat shock protein promoter, an MFal promoter, a PH05 promoter, a
PGK promoter, a GAP promoter, an ADH promoter, an AOX1 promoter, or the
like and then the antigen E2 protein or a fusion protein of the antigen E2 protein
and a labeling protein may be expressed.
[0046]
Upon secretory expression of an antigen E2 protein by Escherichia
coli, for example, an Escherichia coli strain such as the XL1-Blue strain, the
BL-21 strain, the JM107 strain, the TBI strain, the JM109 strain, the C600 strain,
or the HB101 strain is transformed with an expression vector using a trp
promoter, a lac promoter, a PL promoter, a T7 promoter, a tac promoter, or the
like and then the antigen E2 protein or a fusion protein of the antigen E2 protein
and a labeling protein may be expressed.
[0047]
Examples of a method for transduction with an expression vector in
order to cause the secretory expression of an antigen E2 protein by mammalian
cells and insect cells include a lipofection method, a calcium phosphate method,
an electroporation method, a DEAE-dextran method, and a microinjection
method. More specifically, transduction can be carried out according to the
method described in Molecular Cloning 3rd. Ed. 16. 1-16. 62 (Cold Spring
Harbor Laboratory, New York, 2001).
[0048]
A method for introducing an expression vector into Escherichia coli is
not particularly limited, as long as it is a method for introducing DNA into
Escherichia coli. Examples of such a method include a method using calcium
ions (Cohen et al., Proc. Natl. Acad. Sci., U.S.A., 1972, Vol. 69, p. 2110-2114)
and an electroporation method.
[0049]
A method for introducing an expression vector into yeast is not
particularly limited, as long as it is a method for introducing DNA into yeast.
Examples of such a method include an electroporation method (Becker et al.,
Methods. Enzymol., 1990, Vol. 194, p. 182-187), a spheroplast method (Hinnen
et al., Proc. Natl. Acad. Sci., U.S.A., 1978, Vol. 75, p. 1929-1933), and a lithium
acetate method (Itoh et al., J. Bacteriol., 1983, Vol. 153, p. 163-168).
[0050]
Transduced cells may be cultured by a method known per se. As
medium for culturing mammalian cells, for example, MEM medium, DMEM
medium, RPMI 1640 medium, 199 medium (Proceeding of the Society for the
Biological Medicine, 1950, Vol. 73, p. 1), containing about 5%-20% fetal bovine
serum (FBS), or the like is used. The pH preferably ranges from about 6 to 8.
As serum-free medium, CD-CHO, 293 SFM-II, and Hybridoma-SFM (these are
all produced by Invitrogen Corporation) can be used and serum or a supplement
may be added thereto as required. Cells may be cultured at 30°C to 40°C for 15
hours to 60 hours and aeration or agitation is preferably carried out as required.
[0051]
After completion of cell culture, cells are removed from a culture
solution by centrifugation or the like and then an antigen E2 protein or a fusion
protein of the antigen E2 protein and a labeling protein can be purified from the
thus obtained culture supernatant. The antigen E2 protein or the fusion protein
of the antigen E2 protein and the labeling protein may be purified according to
protein separation and purification techniques known by persons skilled in the
art. For example, a protein can be isolated and purified by a combination of
any of ammonium sulfate precipitation, gel chromatography, ion exchange
chromatography, affinity chromatography, and the like.
[0052]
For example, an antigen E2 protein in a culture solution can be easily
purified using a heparin column or a lectin column. In the case of a fusion
protein with a 3xFLAG peptide, the antigen E2 protein can be efficiently
purified using an anti-FLAG antibody column, in the case of a fusion protein
with an 6xHis peptide, the antigen E2 protein can be efficiently purified using a
nickel column, a zinc column, or a cobalt column, in the case of a fusion protein
with an immunoglobulin Fc domain, the antigen E2 protein can be efficiently
purified using a protein A column or a protein G column, and in the case of a
chimeric protein containing an HA peptide, the antigen E2 protein can be
efficiently purified using an anti-HA antibody column.
[0053]
The thus purified antigen E2 protein or fusion protein of the antigen
E2 protein and the labeling protein can be detected by Coomassie brilliant blue
staining or silver staining after SDS-PAGE fractionation. In the case of the
fusion protein, the fusion protein can be detected by a Western blot method
using an antibody against the fused labeling protein.
[0054]
4) Immunization using antigen E2 peptide or antigen E2 protein
To obtain an antibody that specifically binds to the E2 protein of
HCV2a, but does not immunologically react with the E2 protein of HCV1a more
preferably does not immunologically react with both the E2 protein of HCV1a
and the E2 protein of HCV1b, immunization of animals using the above antigen
E2 peptide or antigen E2 protein and then obtaining a polyclonal antibody or
screening for hybridomas producing a monoclonal antibody of interest should be
carried out.
[0055]
Animals to be immunized may be non-human animals having spleen
cells capable of being used for producing hybridoma cells. Examples of such
an animal include mice, rats, hamsters, rabbits, and chickens. Mice can be
more preferably used.
[0056]
An example of a method for immunization comprises administering
several times the above antigen E2 peptide or antigen E2 protein together with
an adjuvant subcutaneously or intraperitoneally to 4- to 10-week-old mice,
confirming an increase in blood antibody titer, boosting via intravenous or
intraperitoneal administration of the antigen E2 peptide or antigen E2 protein
alone, and then collecting blood or spleen cells on days 3 to 10 (preferably on
day 4). The antibody titer of the serum obtained from the collected blood is
measured. In this case, if it specifically recognizes the target antigen, it can be
used as polyclonal antibodies.
[0057]
Examples of an adjuvant include Freund's complete adjuvant, Freund's
incomplete adjuvant, a mixture of aluminium hydroxide gel and a pertussis
vaccine, Titer Max Gold (Vaxel), and GERBU adjuvant (GERBU Biotechnik).
[0058]
The antibody titer in the blood is measured by collecting blood from
an immunized animal via fundus venous plexus or tail vein and then examining
by enzyme immunoassay (EIA) the presence or absence of an antibody reacting
with an antigen E2 peptide or an antigen E2 protein in the obtained blood.
[0059]
5) Preparation of hybridoma cells
Spleen cells collected from an immunized animal on days 3-10 after
boosting, in which an increased antibody titer in the blood has been confirmed,
are fused to myeloma cells, so that hybridoma cells having autonomous
replicability can be prepared. A monoclonal antibody can be prepared in a
large amount by screening for hybridoma cells producing an antibody having a
target specificity.
[0060]
As myeloma cells to be used for cell fusion, for example,
mouse-derived established cell lines, P3-X63Ag8-Ul (P3-U1), SP2/0-Agl4
(SP2/0), P3-X63-Ag8653 (653), P3-X63-Ag8 (X63), P3/NS1/1-Ag4-1(NS1), and
the like can be used. These cell lines are available from RIKEN BioResource
Center, ATCC (American Type Culture Collection), or ECACC (European
Collection of Cell Cultures).
[0061]
Cell fusion of spleen cells and myeloma cells is carried out by washing
both cells, mixing myeloma cells with spleen cells at a ratio of 1 : 1-10, and then
adding polyethylene glycol or polyvinyl alcohol with an average molecular
weight of 1000-6000 as a fusion accelerator or using a commercial cell fusion
apparatus using electrical stimulation (e.g., electroporation).
[0062]
After completion of treatment for cell fusion, fused cells are suspended
in and washed with culture medium and then cloned by limiting dilution or a
colony formation method in methylcellulose medium. An example of limiting
dilution is a method that comprises diluting to 10 to 10 cells/mL, seeding the
cells into a 96-well cell culture microplate at 10 to 10 cells/well, and then
culturing the cells.
[0063]
A HAT supplement is preferably added to culture medium when
cloning of hybridoma cells is carried out, so as to be able to selectively obtain
target fusion cells alone. More specifically, according to methods described in
Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, 1988) or
Selected Methods in Cellular Immunology (W. H. Freeman and Company, 1980),
hybridoma cells of interest are obtained and cloned.
[0064]
6) Screening for hybridoma cell
Hybridoma cells of interest are screened for by an EIA method
described below, for example.
[0065]
Specifically, first, an antigen E2 peptide or an antigen E2 protein is
immobilized on a carrier, an antibody produced by each cloned hybridoma cell is
added to react for a time sufficient for the formation of an antibody-antigen
complex under conditions of 4°C-37°C.
[0066]
Next, a secondary antibody labeled with an enzyme, a dye, a
radioisotope, or the like and capable of specifically binding to an antibody
portion of the thus formed antibody-antigen complex is contacted with the
formed antibody-antigen complex to react for a time sufficient for the formation
of an antibody-antigen-secondary antibody complex under conditions of
4°C-37°C.
[0067]
Finally, the presence or absence of the thus formed
antibody-antigen-secondary antibody complex is detected using signals from an
enzyme, a dye, or a radioisotope used for labeling the secondary antibody as an
indicator, thereby determining if it is an antibody having target properties.
[0068]
7) Preparation of monoclonal antibody
Hybridoma cells selected by the above method are conditioned to
serum-free medium, e.g., Hybridoma-SFM (Invitrogen Corporation) and then a
monoclonal antibody can be prepared from the supernatant from the culture in
serum-free medium. For culturing cells, flasks, petri dishes, spinner culture
bottles, roller bottles, or high density culture flasks CELLine (Becton, Dickinson
and Company) can be used.
[0069]
Also, in order to prepare a monoclonal antibody in a large amount, for
example, 6- to 8-week-old nude mice or SCID mice may be administered
intraperitoneally with 0.5 mL of pristane (2,6,10,14-tetramethylpentadecane) ,
raised for 2 weeks, and then administered intraperitoneally with hybridoma cells
at 5 x 10 to 2 x 107 cells/mouse and raised for 10 to 21 days, so that a
monoclonal antibody can be prepared from the resulting ascites.
[0070]
Cells and cellular debris are removed from the thus collected ascites
by centrifugation. Purification means such as salting-out using 40%-50%
saturated ammonium sulfate, a caprylic acid precipitation method, a
DEAE-sepharose column, a protein A-column, a protein G-column, a HiTrap
IgM Purification HP-column (GE Healthcare), a mannan binding protein-column
(Pierce), and a gel filtration column are used alone or in combination, so that an
IgG or IgM fraction is collected and then can be used as a purified monoclonal
antibody.
[0071]
8) Analysis of epitope for monoclonal antibody
A linear epitope for a monoclonal antibody can be analyzed by
synthesizing peptides that have amino acid sequences of 8 to 12 contiguous
amino acids which were designed to be shifted by one to several amino acids in
an antigen E2 protein, examining to which peptide a monoclonal antibody binds
when the peptide is used as an antigen, and then determining an epitope for the
antibody.
[0072]
Specifically, the thus synthesized peptides are immobilized on a plate
and reacted with a purified antibody. A labeled secondary antibody is added
and then the plate is left to stand. The binding ability is measured by enzyme
immunoassay (ELISA) or radioimmunoassay (RIA).
[0073]
An epitope may not be determined by this method in some cases. In
such cases, an epitope for a monoclonal antibody can be a conformation epitope
and therefore the antibody may recognize the conformation of the antigen.
[0074]
An example of an antibody that specifically binding to the E2 protein
of HCV2a, but not immunologically reacting with the E2 protein of HCV1a is an
antibody recognizing the amino acid sequence shown in SEQ ID NO: 1 in the
Sequence Listing as an epitope. A specific example of such an antibody is an
antibody that is produced from the hybridoma cell line having provisional
accession No. FERM ABP-11181.
[0075]
Also, an example of an antibody specifically binding to the E2 protein
of HCV2a, but not immunologically reacting with both the E2 protein of HCV1a
and the E2 protein of HCV1b is an antibody recognizing the amino acid sequence
shown in SEQ ID NO: 2 or 3 in the Sequence Listing as an epitope. A specific
example of such an antibody is an antibody that is produced by the hybridoma
cell line having provisional accession No. FERM ABP-11180 or FERM
ABP-11179.
[0076]
Moreover, an example of an antibody specifically binding to envelope
protein 2 of the J6CF strain of HCV2a, but not immunologically reacting with
envelope protein 2 of the JFH1 strain is an antibody recognizing the amino acid
sequence shown in SEQ ID NO: 4 in the Sequence Listing as an epitope. A
more specific example of such an antibody is an antibody that is produced by the
hybridoma cell line having provisional accession No. FERM ABP-11183. This
antibody can distinguish the J6CF strain from among HCV genotype 2a, so that
it can be used for identifying the J6CF strain.
[0077]
In addition, the above hybridoma cell lines having provisional
accession Nos. FERM ABP-11181, FERM ABP-11180, FERM ABP-11179,
FERM ABP-11183, and FERM ABP-11182 have been deposited with the
International Depositary Authority, the International Patent Organism Depositary,
National Institute of Advanced Industrial Science and Technology (postal code:
305-8566 Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki, Japan) (deposition date:
September 19, 2008) and thus they are available. These cell lines were each
originally deposited domestically (date of original deposition: September 19,
2008) with the same depositary authority under accession Nos. FERM P-21677
(provisional accession No. FERM AP-21677), FERM P-21676 (provisional
accession No. FERM AP-21676), FERM P-21675 (provisional accession No.
FERM AP-21675), FERM P-21679 (provisional accession No. FERM AP-21679),
and FERM P-21678 (provisional accession No. FERM AP-21678) and then
transferred to international deposition under the Budapest Treaty.
[0078]
Also, the method for identifying HCV genotypes of the present
invention comprising: determining the genotype of HCV to be genotype lb if the
HCV binds to the antibody produced by the hybridoma cell line having
provisional accession No. FERM ABP-11181 but does not bind to either of
antibodies produced by the hybridoma cell lines having provisional accession
Nos. FERM ABP-11180 and FERM ABP-11179; determining the genotype of
HCV to be genotype 2a if the HCV binds to the antibody produced by the
hybridoma cell line having provisional accession No. FERM ABP-11181 and
binds to the antibodies produced by the hybridoma cell lines having provisional
accession Nos. FERM ABP-11180 and FERM ABP-11179; and determining the
genotype of HCV to be genotype la if the HCV binds to the antibody produced
by the hybridoma cell line having provisional accession No. FERM ABP-11182,
but does not bind to any of antibodies produced by the hybridoma cell lines
having provisional accession Nos. FERM ABP-11181, FERM ABP-11180, and
FERM ABP-11179.
[0079]
Whether or not HCV of unknown genotype binds to the antibody
produced by the hybridoma cell line having provisional accession No. FERM
ABP-11181, FERM ABP-11180, FERM ABP-11179, or FERM ABP-11182 can
be determined using any assay system without particular limitation, as long as it
is capable of detecting the presence or absence of an antigen-antibody reaction.
An example of such a method is an immunoassay and a Western blot method
described below.
[0080]
(Immunoassay)
First, a test sample containing HCV of unknown genotype is contacted
with a carrier or a plate onto which the above antibody to be examined for the
presence or absence of binding has been immobilized as a primary antibody and
then allowed to react for a time sufficient for the formation of an
antibody-antigen complex under conditions of 4°C-37°C.
[0081]
Next, a secondary antibody labeled with an enzyme, a dye, a
radioisotope, or the like, which binds to HCV in a non-genotype-specific manner,
is contacted with the antibody-antigen complex and then allowed to react for a
time sufficient for the formation of an antibody-antigen-secondary antibody
complex under conditions of 4°C-37°C.
[0082]
Finally, the presence or absence of the thus formed
antibody-antigen-secondary antibody complex is detected using as an indicator
signals from the enzyme, dye, or radioisotope used for labeling the secondary
antibody, so that the presence or absence of binding with the above antibodies
can be determined.
[0083]
(Western blot method)
First, a test sample containing HCV of unknown genotype is spotted
onto a membrane such as a nitrocellulose membrane or a PVDF membrane and
then proteins contained in the test sample are immobilized.
[0084]
Next, the membrane is soaked in 5% skim milk, 1% BSA solution, or a
commercial blocking agent for blocking, sufficiently washed with buffer, and
then transferred into buffer containing the above antibody labeled with an
enzyme, a dye, a radioisotope, or the like to be examined for the presence or
absence of binding. A reaction is carried out for a time sufficient for the
formation of an antibody-antigen complex under conditions of 4°C-37°C.
[0085]
Subsequently, the membrane is sufficiently washed and then signals
from the enzyme, dye, or radioisotope used for labeling the above antibody for
examination of the presence or absence of binding are detected, so that the
presence or absence of binding with the above antibody is determined.
[0086]
All publications, patents, and patent applications cited herein are
incorporated herein by reference in their entirety.
Examples
[0087]
The present invention will be explained more specifically with
reference to the following examples. However, these examples are only
illustrative, and the scope of the present invention is not limited to these
examples.
[0088]
(Example 1) Preparation of vector for expression of fusion protein of antigen E2
protein of HCV strain and labeling protein.
(1) Construction of vector for expression of fusion protein of antigen E2 protein
derived from J6CF strain of HCV2a and 3xFLAG tag
The antigen E2 protein derived from the J6CF strain of HCV2a; that is,
a protein consisting of the region without transmembrane region of the E2
protein of the J6CF strain of HCV2a, was prepared as described below.
[0089]
First, a gene encoding a protein consisting of a region corresponding to
amino acid positions 384 to 720 of the precursor protein (SEQ ID NO: 5) of the
J6CF strain, when the initiation methionine at the N-terminus was determined to
be the 1st amino acid, was amplified by a PCR method using the cDNA of the
genomic RNA of the J6CF strain of HCV2a (GenBank Accession No. AF177036)
as a template, an Advantage GC2 PCR kit (Takara Bio Inc.), and J6E2dTM-s
(SEQ ID NO: 6: CACAAGCTTCGCACCCATACTGTTGGGG) and J6E2dTM-as
(SEQ ID NO: 7: GCTCTAGATTACCATCGGACGATGTATTTTGT) as primers.
[0090]
Next, the thus amplified DNA fragment was cloned into pCR-TOPO
(Invitrogen Corporation) and then 3 clones were subjected to sequence analysis.
A gene fragment encoding the antigen E2 protein was digested with Hind III and
BamH I and thus excised from clones having the correct nucleotide sequence
insert. The gene fragment was inserted in-frame between Hind III and BamH I
sites of p3xFLAG-CMV-9 (Sigma) such that the reading frames matched. As a
result, a CMV-3XFLAGJ6E2dTM vector expressing the antigen E2 protein to
which 3xFLAG-tag had been connected (hereinafter, 3xFLAG-J6E2dTM protein)
was obtained.
[0091]
(2) Construction of vector for expression of fusion protein of antigen E2 protein
derived from J6CF strain of HCV2a and human IgG Fc protein added to the
antigen E2 protein
First, a gene encoding a protein consisting of the region corresponding
to amino acid positions 384 to 720 of the precursor protein (SEQ ID NO: 5) of
the J6CF strain, when the initiation methionine at the N-terminus was
determined to be the 1st amino acid, was amplified by a PCR method using the
genomic RNA of the cDNA of the J6CF strain of HCV2a (GenBank Accession
No. AF177036) as a template, an Advantage GC2 PCR kit (Takara Bio Inc.), and
J6E2Fc-s (SEQ ID NO: 8: CACAAGCTTCGCACCCATACTGTTGGGG) and
J6E2Fc-as (SEQ ID NO: 9: ACAGGATCCCATCGGACGATGTATTTTGTG) as
primers.
[0092]
Next, the thus amplified DNA fragment was cloned into pCR-TOPO
(Invitrogen Corporation) and then 3 clones were subjected to sequence analysis.
A gene fragment encoding the antigen E2 protein was digested with Hind III and
BamH I and thus excised from clones having the correct nucleotide sequence
insert. The gene fragment was inserted between the Hind III site and the BamH
I site downstream of the signal peptide sequence of p3xFLAG-CMV-13 (Sigma)
such that the reading frames (readable frame) matched, that is, inserted in-frame.
The resulting vector was designated as CMV-13-J6E2.
[0093]
Subsequently, CMV-13-J6E2 was digested with Sac I and BamH I.
DNA fragments encoding the signal peptide sequence and the antigen E2 protein,
respectively, were each separated by agarose gel electrophoresis, and then
purified using GeneElute (Sigma).
[0094]
Thereafter, DNA fragments encoding the above signal peptide
sequence and the antigen E2 protein, respectively, were inserted in-frame (so
that the reading frames matched) between the Sac I site and the BamH I site of
the CDM-mIL7R-Ig vector (Sudo et al., Proc Natl. Acad Sci U.S.A., 1993, Vol.
90, p. 9125-9129) expressing a chimeric protein comprising mouse IL-7
receptor-human immunoglobulin Fc domain. Thus, a CDM-J6E2Fc vector
expressing the antigen E2 protein to which the human immunoglobulin Fc
domain had been connected (hereinafter, J6E2-Fc protein) was obtained.
[0095]
(3) Construction of vector for expression of fusion protein of antigen E2 protein
derived from JFH1 strain of HCV2a and human IgG Fc protein
First, a gene encoding a protein consisting of the region corresponding
to amino acid positions 384 to 721 of a precursor protein of the JFH1 strain,
when the initiation methionine at the N-terminus was determined to be the 1st
amino acid, was amplified by a PCR method using as a template the cDNA of the
genomic RNA of the JFH1 strain of HCV2a (GenBank Accession No.
AB047639), an Advantage GC2 PCR kit (Takara Bio Inc.), and JFE2Fc-s (SEQ
ID NO: 10: CACAAGCTTGGCACCACCACCGTTGGAG) and JFE2Fc-as (SEQ
ID NO: 11: ACAGGATCCTCCCATCGAACGACGTATTTTGTG) as primers.
[0096]
Next, the thus amplified DNA fragment was cloned into pCR-TOPO
(Invitrogen Corporation) and then 3 clones were subjected to sequence analysis.
A gene fragment encoding the antigen E2 protein was digested with Hind III and
BamH I and thus excised from clones having the correct nucleotide sequence
insert and then inserted in-frame between the Hind III site and the BamH I site
downstream of a signal peptide sequence of p3xFLAG-CMV-13 (Sigma). The
vector was designated as CMV-13-JFH1E2.
[0097]
Subsequently, CMV-13-JFH1E2 was digested with Sac I and BamH I.
DNA fragments encoding the signal peptide sequence and the antigen E2 protein,
respectively, were each separated by agarose gel electrophoresis, and then
purified using GeneElute (Sigma).
[0098]
Thereafter, DNA fragments encoding the above signal peptide
sequence and the antigen E2 protein, respectively, were inserted in-frame
between the Sac I site and the BamH I site of CDM-mIL7R-Ig. Thus a
CDM-JFHlE2Fc vector expressing the antigen E2 protein to which the human
immunoglobulin Fc domain had been connected (hereinafter, JFH1E2-Fc protein)
was obtained.
[0099]
(4) Construction of vector for expression of fusion protein of antigen E2 protein
derived from TH strain of HCV1b and human IgG Fc protein
First, a gene encoding a protein consisting of the region correspo
nding to amino acid positions 384 to 717 of a precursor protein of the TH
strain, when the initiation methionine at the N-terminus was determined to
be the 1st amino acid, was amplified by a PCR method using as a templa
te the cDNA of the genomic RNA of the TH strain of HCVlb (Internation
al Patent Publication WO2006/022422), an Advantage GC2 PCR kit (Takara
Bio Inc.), and THE2Fc-s (SEQ ID NO: 12: CAAAGCTTGCGACCTACGT
GACGGGGGGGTCG) and THE2Fc-as (SEQ ID NO: 13: CCTCTAGATTAT
GGATCCCATTTGATTGCATAGGAGACAACCG) as primers.
[0100]
Next, the thus amplified DNA fragment was cloned into pCR-TOPO
(Invitrogen Corporation) and then 3 clones were subjected to sequence analysis.
A gene fragment encoding the antigen E2 protein was digested with Hind III and
BamH I and thus excised from clones having the correct nucleotide sequence
insert. The gene fragment was inserted in-frame between the Hind III site and
the BamH I site downstream of a signal peptide sequence of p3xFLAG-CMV-13
(Sigma). The vector was designated as CMV-13-THE2.
[0101]
Subsequently, CMV-13-THE2 was digested with Sac I and BamH I.
DNA fragments encoding the signal peptide sequence and the antigen E2 protein,
respectively, were each separated by agarose gel electrophoresis and then
purified using GeneElute (Sigma).
[0102]
Thereafter, DNA fragments encoding the signal peptide sequence and
the antigen E2 protein, respectively, were inserted in-frame between the Sac I
site and the BamH I site of CDM-mIL7R-Ig. Thus, a CDM-THE2Fc vector
expressing the antigen E2 protein to which the human immunoglobulin Fc
domain had been connected (hereinafter, THE2-Fc protein) was obtained.
[0103]
(5) Construction of vector for expression of fusion protein of antigen E2 protein
derived from Conl strain of HCV1b and human IgG Fc protein
First, a gene encoding a protein consisting of the region correspo
nding to amino acid positions 384 to 716 of a precursor protein of the Co
nl strain, when the initiation methionine at the N-terminus was determined
to be the 1st amino acid, was amplified by a PCR method using as a tern
plate the cDNA of the genomic RNA of the Conl strain of HCVlb (GenB
ank Accession No. AJ238799), an Advantage GC2 PCR kit (Takara Bio In
c), and ConlE2Fc-s (SEQ ID NO: 14: CAAAGCTTGGAACCTATGTGACA
GGGGGGACGAT) and ConlE2Fc-as (SEQ ID NO: 15: CCTCTAGATTATG
GATCCCATTTGATTGCAAAGGAGACAAC) as primers.
[0104]
Next, the thus amplified DNA fragment was cloned into pCR-TOPO
(Invitrogen Corporation) and then 3 clones were subjected to sequence analysis.
A gene fragment encoding the antigen E2 protein was digested with Hind III and
BamH I and thus excised from clones having the correct nucleotide sequence
insert. The gene fragment was inserted in-frame between the Hind III site and
the BamH I site downstream of a signal peptide sequence of p3xFLAG-CMV-13
(Sigma). The vector was designated as CMV-13-Con1E2.
[0105]
Subsequently, CMV-13-Con1E2 was digested with Sac I and BamH I.
DNA fragments encoding the signal peptide sequence and the antigen E2 protein,
respectively, were each separated by agarose gel electrophoresis and then
purified using GeneElute (Sigma).
[0106]
Thereafter, DNA fragments encoding the signal peptide sequence and
the antigen E2 protein, respectively, were inserted in-frame between the Sac I
site and the BamH I site of CDM-mIL7R-Ig. Thus, a CDM-Con1E2Fc vector
expressing the antigen E2 protein to which the human immunoglobulin Fc
domain had been connected (hereinafter, ConlE2-Fc protein) was obtained.
[0107]
(6) Construction of vector for expression of fusion protein of antigen E2 protein
derived from J1 strain of HCV1b and human IgG Fc protein
First, a gene encoding a protein consisting of the region correspo
nding to amino acid positions 384 to 716 of a precursor protein of the Jl
strain, when the initiation methionine at the N-terminus was determined to
be the 1st amino acid, was amplified by a PCR method using as a templa
te the cDNA of genomic RNA derived from the J1 strain of HCVlb (Gen
Bank Accession No. D89815), an Advantage GC2 PCR kit (Takara Bio In
c), and JlE2Fc-s (SEQ ID NO: 16: CAAAGCTTCATACCCGCGTGACGGG
GGGGGTGC) and JlE2Fc-as (SEQ ID NO: 17: CCTCTAGATTATGGATCC
CACTTGATGGCAATGGAGACGACC) as primers.
[0108]
Next, the thus amplified DNA fragment was cloned into pCR-TOPO
(Invitrogen Corporation) and then 3 clones were subjected to sequence analysis.
A gene fragment encoding the antigen E2 protein was digested with Hind III and
BamH I and thus excised from clones having the correct nucleotide sequence
insert. The gene fragment was inserted in-frame between the Hind III site and
the BamH I site downstream of the signal peptide sequence of
p3xFLAG-CMV-13 (Sigma). The vector was designated as CMV-13-J1E2.
[0109]
Subsequently, CMV-13-J1E2 was digested with Tth111 I, blunt-ended
with T4 DNA polymerase, and then digested with BamH I. The resulting DNA
fragments encoding the signal peptide sequence and the antigen E2 protein,
respectively, were each separated by agarose gel electrophoresis and then
purified using GeneElute (Sigma).
[0110]
Thereafter, CDM-mILR7R-Ig was digested with BamH I and Xba I to
excise a DNA fragment containing the sequence encoding human
immunoglobulin Fc domain. And then the fragment was inserted downstream
of a promoter region in pcDL-SRa296 (Takebe et al., Proc Natil Acad Sci.
U.S.A., 1987, Vol. 84, p. 7388-7392) to prepare SRalgGlFc. Furthermore,
DNA fragments encoding the signal peptide sequence and the antigen E2 protein,
respectively, were inserted in-frame between the EcoR V site and the BamH I
site in SRalgGlFc. Thus, an SRa-JlE2Fc vector expressing the antigen E2
protein to which the human immunoglobulin Fc domain had been connected
(hereinafter, J1E2-Fc protein) was obtained.
[0111]
(7) Construction of vector for expression of fusion protein of antigen E2 protein
derived from H77 strain of HCV1a and human IgG Fc protein
First, a gene encoding a protein consisting of the region correspo
nding to amino acid positions 384 to 716 of a precursor protein of the H7
7 strain, when the initiation methionine at the N-terminus was determined t
o be the 1st amino acid, was amplified by a PCR method using as a tempi
ate the cDNA of the genomic RNA of the H77 strain of HCVla (GenBank
Accession No. AF011751), an Advantage GC2 PCR kit (Takara Bio Inc.),
and H77E2Fc-s (SEQ ID NO: 18: CAAAGCTTGAAACCCACGTCACCGGG
GGAAA) and H77E2Fc-as (SEQ ID NO: 19: CCTCTAGATTATGGATCCCA
CTTAATGGCCCAGGACGCGAT) as primers.
[0112]
Next, the thus amplified DNA fragment was cloned into pCR-TOPO
(Invitrogen Corporation) and then 3 clones were subjected to sequence analysis.
A gene fragment encoding the antigen E2 protein was digested with Hind III and
Xba I and thus excised from clones having the correct nucleotide sequence insert.
The gene fragment was inserted in-frame between the Hind. III site and the Xba I
site downstream of a signal peptide sequence of a p3xFLAG-CMV-13Xho vector
which was prepared by converting the Sac I site to the Xho I site in
p3xFLAG-CMV-13 (Sigma). The resulting vector was designated as
CMV-13-XhoH77E2.
[0113]
Subsequently, CMV-13-XhoH77E2 was digested with Xho I and BamH
I and then DNA fragments encoding the signal peptide sequence and the antigen
E2 protein, respectively, were each separated by agarose gel electrophoresis and
then purified using GeneElute (Sigma).
[0114]
Thereafter, DNA fragments encoding the signal peptide sequence and
the antigen E2 protein, respectively, were inserted in-frame between the Xho I
site and the BamR I site of SRa-IgGlFc constructed in 5) above. A
SRa-H77E2Fc vector expressing the antigen E2 protein to which the human
immunoglobulin Fc domain had been connected (hereinafter, H77E2-Fc protein)
was obtained.
[0115]
(Example 2) Expression of fusion protein of antigen E2 protein and labeling
protein
CMV-3XFLAGJ6E2dTM, CDM-J6E2Fc, CDM-JFH1E2Fc,
CDM-THE2Fc, CDM-Con1E2Fc, SRa-JlE2Fc, and SRa-H77E2Fc constructed in
Example 1 were introduced into monkey kidney-derived COS1 cells and then
each fusion protein was expressed as described below.
[0116]
First, COS1 cells were subcultured in RPMI1640 medium (Invitrogen
Corporation) containing 10% fetal calf serum (Invitrogen Corporation), 100
U/ml penicillin, and 100 µg/ml streptomycin. On the day before the gene
transfer, COS1 cells were seeded in 150 cm culture flasks (Corning Coaster
Corporation) at a split ratio of 1 : 2 and then cultured overnight at 37°C in a 5%
CO2 incubator.
[0117]
Subsequently, DEAE dextran (GE Healthcare) and chloroquine (Sigma)
were added to RPMI1640 mediumat final concentrations of 400 µg/ml and 100
µM, respectively. 50 µg of the above expression vector
(CMV-3xFLAGJ6E2dTM, CDM-J6E2Fc, CDM-JFH1E2Fc, CDM-THE2Fc,
CDM-Con1E2Fc, SRa-J1E2Fc, or SRa-H77E2Fc) was added at a concentration
of 0.1 µg/µ1 per 13 ml and then cells were cultured for 3 to 4 days.
[0118]
Thereafter, the supernatant of cultured COS1 cells was aspirated off.
10 ml of PBS(-) (Nissui Pharmaceutical Co., Ltd.) was added, and again, PBS(-)
was aspirated off for washing cells. Subsequently, a DEAE dextran-DNA
mixture was added at 13 ml/150 cm2 flask and then the resultant was left to stand
at 37°C in the presence of 5% CO2.
[0119]
Four hours later, the DEAE dextran-DNA mixture was aspirated off,
each flask was washed once with 10 ml of PBS, Hybridoma-SFM medium
(Invitrogen Corporation) was added at 50 ml/flask, and then cells were cultured
at 37°C in the presence of 5% CO2 for 4 days. Thereafter, the culture
supernatant was collected in a 50-ml centrifuge tube (Corning Coaster
Corporation) and then centrifuged at 2500 rpm for 30 minutes at 4°C. The
supernatant was filtered through a 0.2-u.m filter (Whatman).
[0120]
(Example 3) Purification of fusion protein of antigen E2 protein and labeling
protein
The culture supernatant of cells into which CMV-3xFLAG-J6E2dTM
had been introduced was subjected to purification using anti-FLAG M2 agarose
(Sigma) as described below.
[0121]
First, 1 ml of anti-FLAG M2 agarose was added to 500 ml of the
culture supernatant and then allowed to react at 4°C for 2 hours during stirring in
a spinner bottle. After 2 hours, a mixture of the supernatant and anti-FLAG M2
agarose was transferred to Econocolumn (Bio-Rad Laboratories Inc.), the Void
fraction was removed, and then anti-FLAG M2 agarose was collected.
[0122]
Next, anti-FLAG M2 agarose was washed twice with 10 ml of TBS (50
mM Tris-HCl, 150 mM NaCl, pH 7.4). Six fractions (anti-FLAG antibody
column elution fractions 1-6) were eluted with 0.1 M Glycine-HCl (pH 3.5) to 1
ml/fraction. Immediately after elution, 1M Tris-HCl (pH 9.5) was added to
return the pH to neutral. 20 µl of each fraction was fractionated under
reductive conditions by SDS-polyacrylamide gel electrophoresis and then stained
with Coomassie brilliant blue. As a result, it was confirmed that the fusion
protein of the J6CF strain-derived antigen E2 protein and the 3xFLAG tag
(3xFLAG-J6E2dTM protein) had been purified (Fig. 4).
[0123]
The culture supernatant of cells into which CDM-J6E2Fc,
CDM-JFH1E2Fc, CDM-THE2Fc, CDM-Con1E2Fc, SRa-J1E2Fc, or
SRa-H77E2Fc had been introduced was purified using Prosep-A (Millipore)
which was a carrier to which Protein-A had been bound, as described below.
[0124]
First, an Econocolumn was filled with 1 ml of Prosep-A, 500 ml of the
culture supernatant was caused to pass through at a flow rate of 1-1.5 mL/min,
and then washed with 20 ml of PBS(-).
[0125]
Next, 5 fractions were eluted with 0.1 M Glycine-HCl (pH 3.0) to 1
ml/fraction. Immediately after elution, 1 M Tris-HCl (pH 9.5) was added to
return the pH to neutral. 20 µl of each fraction was fractionated under
reductive conditions by SDS-polyacrylamide gel electrophoresis, and then
stained with Coomassie brilliant blue. As a result, the fusion proteins of
antigen E2 protein derived from each of the HCV strains and the human
immunoglobulin Fc domain were purified and the molecular weights under
reductive conditions were revealed to be about 97 kDa (Fig. 5).
[0126]
(Example 4) Immunization of mouse with the antigen E2 protein of J6CF strain
of HCV2a
0.3 ml of a PBS solution containing 10 µg of 3xFLAG-J6E2dTM
protein and 0.3 ml of Freund's complete adjuvant were mixed to prepare an
emulsion. A 7-week-old Balb/c mouse (female) was subcutaneously inoculated
with half the amount of the emulsion.
[0127]
After 2 weeks, 0.3 ml of a PBS solution containing 10 µg of
3xFLAG-J6E2dTM protein and 0.3 ml of Freund's incomplete adjuvant were
mixed to prepare an emulsion, and half the amount of the emulsion was
subcutaneously administered to the mouse. After further 2 weeks, 0.15 ml of
PBS solution containing 10 µg of 3xFLAG-J6E2dTM protein was administered
intraperitoneally to the mouse. After 3 days, spleen cells were prepared from
the mouse.
[0128]
In another experiment, 0.3 ml of PBS solution containing 20 µg of the
J6E2-Fc protein and 0.3 mL of Alum (Pierce) were mixed to prepare a solution
to be administered. A 7-week-old Balb/c mouse (female) was inoculated
intraperitoneally with the total amount of the emulsion.
[0129]
At 2, 4, and 6 weeks later, similarly, 0.3 ml of PBS solution containing
20 µg of the J6E2-Fc protein and 0.3 mL of Alum were mixed to prepare a
solution to be administered, and the total amount of the emulsion was
administered intraperitoneally to the mouse. After further 2 months, 0.3 ml of
PBS solution containing 20 µg of the J6E2-Fc protein was administered
intraperitoneally to the mouse. After 3 days, spleen cells were prepared from
the mouse.
[0130]
(Example 5) Preparation of hybridoma cell
First, the mouse myeloma cell line SP2/0 (obtained from ECACC) was
cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen
Corporation) containing 55 µM 2-mercaptoethanol, 100 U/ml penicillin, 100
µg/ml streptomycin, and 10% fetal calf serum (FCS; Invitrogen Corporation).
Thus, SP2/0 cells at the logarithmic growth phase were obtained. The cells
were washed 3 times with serum-free DMEM.
[0131]
Next, spleen cells were prepared from the mouse to which the
3xFLAG-J6E2dTM protein or the J6E2-Fc protein had been administered and
then washed 3 times with serum-free DMEM. SP2/0 cells and mouse spleen
cells were added at a ratio of 1 : 5 to a 50-ml centrifugal tube and then subjected
to centrifugation at 1,000 rpm for 10 minutes. The supernatant was completely
removed by aspiration. Subsequently, the centrifugal tube was tapped to loosen
the pellet. 1 ml of 50% polyethylene glycol-1500 solution (Roche) pre-heated
at 37°C was added for 1 minute and allowed to react at 37°C for 1 minute.
[0132]
Subsequently, 1 ml of serum-free DMEM was added to the above
centrifugal tube for 1 minute, and again 1 ml of serum-free DMEM was added
for 1 minute, and then finally 7 ml of serum-free DMEM was added for 3
minutes, so that an ethylene glycol solution was diluted. Thereafter, the above
centrifugal tube was subjected to centrifugation at 1,000 rpm for 10 minutes to
collect cells. The cells were suspended at 1x106 cells/ml in DMEM containing
55 µM 2-mercaptoethanol, 100 U/ml penicillin, 100 µg/ml streptomycin, 15%
FCS, and a 10% hybridoma cloning factor (BioVeris).
[0133]
The thus obtained cell suspension was seeded at 100 µl/well in each
well of a 96-well plate and then cultured at 37°C in a 5% CO2 incubator. On
the next day, 100 µl of DMEM containing 2xHAT (Invitrogen Corporation), 15%
FCS, and 10% hybridoma cloning factor were added to each well and then cells
were continuously cultured at 37°C in a 5% CO2 incubator.
[0134]
After 10 to 14 days of culture, the culture supernatant in each well was
collected and then an antibody recognizing the antigen E2 protein contained in
the culture supernatant was screened for as described in Example 6.
[0135]
(Example 6) Screening for hybridoma cell producing antibody binding to antigen
E2 protein
Hybridoma cells were screened for by immobilizing the antigen E2
protein on a plate and then evaluating by EIA whether or not the antibodies in
the culture supernatant of hybridoma cells had bound to the antigen E2 protein
immobilized on the plate.
[0136]
(1) Preparation of antigen E2 protein-immobilized plate
The 3xFLAG-J6E2dTM protein or the J6E2-Fc protein was diluted to 1
µg/ml with PBS and then 50 µ1 each of the resultant was added to each well of an
immunoplate (Nunc). The immunoplate was left to stand at 4°C overnight, so
that the protein was immobilized on the plate. The protein solution was
removed from each well, 200 µl each of Blocking One solution (NACALAI
TESQUE, INC.) prepared according to the included manuals was added to each
well, and then blocking was carried out for 2 hours at room temperature.
[0137]
(2) Screening for hybridoma cell
The above protein-immobilized plates subjected to blocking were used
for screening for the anti-E2 protein antibody in the culture supernatant of
hybridoma cells. The plate on which the J6E2-Fc protein had been immobilized
was used for screening for a monoclonal antibody produced by hybridoma cells
prepared from the mouse to which 3xFLAG-J6E2dTM protein had been
administered. The plate on which the 3xFLAG-J6E2dTM protein had been
immobilized was used for screening for a monoclonal antibody produced by
hybridoma cells prepared from the mouse to which the J6E2-Fc protein had been
administered.
[0138]
Specifically, the above protein-immobilized plates were washed 4
times with PBS containing 0.1% Tween20 (Sigma). The supernatant sample of
each hybridoma cell obtained in Example 5 was added at 50 ul/well and then
allowed to react at room temperature for 1 hour. After completion of the
reaction, wells were washed 4 times with PBS containing 0.1% Tween20.
HRP-labeled anti-mouse IgG antibody (GE Healthcare) diluted 5,000-fold with
PBS containing 0.1% Tween20 was subsequently added at 50 ul/well and
allowed to react at room temperature for 1 hour. After completion of the
reaction, wells were washed 4 times with PBS containing 0.1 % Tween20, color
was developed using a peroxidase-color-developing kit (Sumitomo Bakelite Co.,
Ltd.), and then absorbance at 450 nm was measured. Thus, positive clones were
selected.
[0139]
As a result, regarding hybridoma cells prepared from the mouse to
which the 3xFLAG-J6E2dTM protein had been administered, 11 clones could be
positively selected from the 980 wells subjected to screening. Cloning of these
clones was carried out by limiting dilution, so that hybridoma cell lines, 1G2-32,
2F2-7, 2F3-7, 4E8-8, 5D4-6, 9G3-2, 9A5-4, 9C4-2, 8D10-3, and 10G4-1 having
good proliferative property and antibody productivity were obtained.
[0140]
Meanwhile, regarding hybridoma cells prepared from the mouse to
which the J6E2-Fc protein had been administered, 10 clones could be positively
selected from 2064 wells screened for. Cloning of these clones was carried out
by limiting dilution, so that an M1E12-1 hybridoma cell line, having good
proliferative property and antibody productivity was obtained.
[0141]
(3) Isotype and subtype analysis
The isotypes and the subtypes of the monoclonal antibodies produced
by the thus obtained hybridoma cells were analyzed using ImmunoPure
Monoclonal Antibody Isotyping Kit (Pierce) according to the included manuals.
As a result, the antibody subtype of each clone is as shown in Fig. 6. These
were all found to have K-immunoglobulin light chains.
[0142]
(4) Purification of IgG antibody
The thus obtained hybridoma cells were each finally conditioned to
serum-free culture by decreasing stepwise the FCS concentration in culture
medium.
[0143]
Hybridoma cells were each cultured to confluence in serum-free
medium, Hybridoma SFM (Invitrogen Corporation). The culture solution was
collected in a centrifugation tube and then centrifuged at 1500 rpm for 5 minutes.
The culture supernatant was added to Prosep-G (Millipore) and then washed with
30 bed volumes of PBS. Subsequently, 6 fractions were eluted with 1 bed
volume of 0.1 M glycine-HCl (pH 3.0). Immediately after elution, 1 M
Tris-HCl (pH 9.5) was added to return the pH to neutral. 20 µl of each fraction
was subjected to SDS-polyacrylamide gel electrophoresis under reductive
conditions and non-reductive conditions for fractionation. The presence or
absence of the proteins was confirmed by staining with Coomassie brilliant blue.
IgG fractions were pooled and then subjected to dialysis against PBS or
demineralization through gel filtration, thereby preparing antibody samples.
[0144]
(Example 7) HCV genotype specificity of monoclonal antibody against antigen
E2 protein
It was examined whether or not the monoclonal antibody produced by
each of hybridoma cells prepared via immunization with the antigen E2 protein
of the J6CF strain of HCV2a had bound to E2 proteins derived from the J6CF
strain of genotype 2a and the JFH1 strain of genotype 2a, E2 proteins derived
from the TH strain of genotype 1b, the J1 strain of genotype lb, and the Con1
strain of genotype 1b, and an E2 protein derived from the H77 strain of genotype
la.
[0145]
As antigens, the J6E2-Fc protein, the JFH1E2-Fc protein, the THE2-Fc
protein, the J1E2-Fc protein, the ConlE2-Fc protein and the H77E2-Fc protein
prepared in Examples 1-3, which are fusion proteins of the antigen E2 proteins
and the human immunoglobulin Fc domains, were used. These proteins were
immobilized on plates and then used for evaluation as described in Example 6.
[0146]
Specifically, each of the above fusion proteins was diluted with PBS to
1 µg/ml, the diluted solution was added to an immunoplate at 50 µl/well, and
then the immunoplate was left to stand at 4°C overnight, so that each fusion
protein was immobilized on the plate. The protein solution was removed and
then a Blocking One solution (NACALAI TESQUE, INC.) prepared according to
the included manuals was added at 200 µl/well, followed by 2 hours of blocking
at room temperature.
[0147]
Next, the monoclonal antibody produced by each hybridoma cell was
diluted with PBS to 1 µg/ml, added to the above protein-immobilized plate at 50
ul/well, and then allowed to react at room temperature for 1 hour. After
completion of the reaction, wells were washed 4 times with PBS containing
0.05% Tween20, an HRP-labeled anti-mouse IgG antibody diluted 5,000-fold
with PBS containing 0.05% Tween20 was added at 50 µl/well and then allowed
to react at room temperature for 1 hour. After completion of the reaction, wells
were washed 4 times with PBS containing 0.05% Tween20, color was developed
using a peroxidase color-developing kit, and then absorbance at 450 nm was
measured.
[0148]
Fig. 6 shows the binding of each monoclonal antibody to the antigen
E2 proteins of various HCV genotypes or strains. Regarding absorbance values,
a value of less than 0.1 is denoted with "-," a value of 0.1 or more and less than
0.25 is denoted with "+," a value of 0.25 or more and less than 0.4 is denoted
with "++," and a value of 0.4 or more is denoted with "+++." These values
represent the strength of binding to the antigen E2 proteins. As shown in Fig. 6,
8D10-3 was an antibody binding to the antigen E2 proteins of HCV genotypes la,
lb, and 2a, 1G2-32 and 2F2-7 were antibodies binding to the antigen E2 protein
of genotype 2a, and 4E8-8 was an antibody binding to the antigen E2 proteins of
genotypes lb and 2a. Moreover, as shown in Fig. 6, M1E12-1 was a
monoclonal antibody binding to the antigen E2 protein of the J6CF strain.
[0149]
These results indicate that a set of the above monoclonal antibodies
can be used for identifying HCV genotypes or HCV strains.
[0150]
Also, a hybridoma cell (8D10-3) producing the monoclonal antibody
8D10-3 was deposited under provisional accession No. FERM ABP-11182, a
hybridoma cell (1G2-32) producing the monoclonal antibody 1G2-32 was
deposited under provisional accession No. FERM ABP-11179, a hybridoma cell
(2F2-7) producing the monoclonal antibody 2F2-7 was deposited under
provisional accession No. FERM ABP-11180, a hybridoma cell (4E8-8)
producing the monoclonal antibody 4E8-8 was deposited under provisional
accession No. FERM ABP-11181, and a hybridoma cell (M1E12-1) producing
the monoclonal antibody M1E12-1 was deposited under provisional accession No.
FERM ABP-11183 on September 19, 2008, with the International Patent
Organisms Depositary, National Institute of Advanced Industrial Science and
Technology (central 6, 1-1, Higashi 1, Tsukuba, Ibaraki, Japan).
[0151]
(Example 8) Analysis of epitope for monoclonal antibody
A group of peptides (peptide numbers 1-110) was synthesized, each
peptide having amino acid sequences of 10 contiguous amino acids which were
designed to be shifted by three amino acids from the N-terminus in the amino
acid sequence of antigen E2 protein corresponding to the amino acid positions
384 to 720 when the initiation methionine at the N-terminus of the precursor
protein of the J6CF strain (SEQ ID NO: 5) was determined to be the 1st amino
acid. The N-terminus of each peptide was biotinylated and glycinamide was
located at the C-terminus of the same (synthesized by JPT on commission).
[0152]
The thus synthesized peptides were each dissolved in DMSO and then
dissolved in PBS to 0.01 nmol/µl. The peptide solution was added to a
streptavidin coated plate (Nunc) at 50 µl/well and then allowed to react at room
temperature for 2 hours. The peptide solution was discarded, a Blocking One
solution (NACALAI TESQUE, INC.) prepared according to the included
manuals was added at 200 ul/well, and then wells were left to stand at 4°C
overnight, so that blocking was carried out.
[0153]
Subsequently, the blocking solution was discarded, wells were washed
4 times with PBS containing 0.05% Tween20, and then each monoclonal
antibody diluted to 1 µg/ml with PBS containing 0.05% Tween20 was added at
50 ul/well, followed by 1.5 hours of reaction at room temperature. After
completion of the reaction, the antibody solution was discarded, wells were
washed 4 times with PBS containing 0.05% Tween20, and an HRP-labeled
anti-mouse IgG goat antibody (GE Healthcare) diluted 5000-fold with PBS
containing 0.05% Tween20 was added at 50 ul/well and then allowed to react at
room temperature for 1 hour. After the reaction, the antibody solution was
discarded and then wells were washed 5 times with PBS containing 0.05%
Tween20. After washing, color was developed using a peroxidase
color-developing kit and then absorbance at 450 nm was measured, so that the
antibody that had bound to the peptide was detected.
[0154]
Figs. 7A-E show the binding strength of each monoclonal antibody to
the peptides derived from the J6CF strain-derived antigen E2 protein. A high
measurement value of OD 450 nm (shown on the longitudinal axes in Figs.
7A-E) indicates that the binding strength of the monoclonal antibody to the
relevant peptide was strong and the antibody specifically recognized the peptide.
Each monoclonal antibody recognized some peptides derived from the antigen
E2 protein of the J6CF strain.
[0155]
Particularly strong epitopes for the monoclonal antibody 8D10-3 were
DRLGAPTYTW (SEQ ID NO: 20; peptide No. 47), and GAPTYTWGEN (SEQ
ID NO: 21; peptide No. 48) overlapping with the epitope peptide (Fig. 7A).
Based on the results, it was considered that the epitopes may comprise an amino
acid sequence of at least 10 contiguous amino acids in the amino acid sequence
DRLGAPTYTWGEN. (SEQ ID NO: 22). YPYRLWHYPC (SEQ ID NO: 23;
peptide No. 78) was a weak epitope (Fig. 7A).
[0156]
A particularly strong epitope for the monoclonal antibody 4E8-8 was
WGENETDVFL (SEQ ID NO: 1; peptide No. 50). NETDVFLLNS (SEQ ID
NO: 24; peptide No. 51), DVFLLNSTRP (SEQ ID NO: 25; peptide No. 52), and
LLNSTRPPLG (SEQ ID NO: 26; peptide No. 53) overlapping with the peptide
No. 50 were weak epitopes (Fig. 7C). Based on the result, it was considered
that each of the epitopes has an amino acid sequence of at least 10 contiguous
amino acids in WGENETDVFLLNSTRPPLG (SEQ ID NO: 27).
[0157]
A particularly strong epitope for the monoclonal antibody 2F2-7 was
GWGALQYEDN (SEQ ID NO: 2; peptide No. 29) (Fig. 7D). FRVGWGALQY
(SEQ ID NO: 28; peptide No. 28) overlapping with the peptide No. 29 was a
weak epitope (Fig. 7D). Based on the result, it was considered that each of the
epitopes has an amino acid sequence of at least 10 contiguous amino acids in the
amino acid sequence, FRVGWGALQYEDN (SEQ ID NO: 29).
[0158]
Particularly strong epitopes for the monoclonal antibody 1G2-32 were
KTCGAPPCRT (SEQ ID NO: 3; peptide No. 61) and GAPPCRTRAD (SEQ ID
NO: 30; peptide No. 62) (Fig. 7B). Based on the result, it was considered that
each of the epitopes has an amino acid sequence of at least 10 contiguous amino
acids in the amino acid sequence, KTCGAPPCRTRAD (SEQ ID NO: 31).
[0159]
Particularly strong epitopes for the monoclonal antibody M1E12-1
were NYTIFKIRMY (SEQ ID NO: 4; peptide No. 82) and IFKIRMYVGG (SEQ
ID NO: 32; peptide No. 83) (Fig. 7E). Based on the results, it was considered
that each of the epitopes has an amino acid sequence of at least 10 contiguous
amino acids in the amino acid sequence, NYTIFKIRMYVGG (SEQ ID NO: 33).
[0160]
(Example 9) Detection of HCV envelope protein using monoclonal antibody
Whether or not the antigen E2 protein derived from the H77 strain of
genotype 1a, the antigen E2 proteins derived from the J6CF strain of genotype 2a
and the JFH1 strain of genotype 2a, and the antigen E2 proteins derived from the
TH strain of genotype lb, the J1 strain of genotype 1b, and the Conl strain of
genotype 1b had been detected using the monoclonal antibodies prepared from
the hybrdioma cells prepared above was examined by a sandwich ELISA method
and a Western blot method.
[0161]
(1) Sandwich ELISA
The monoclonal antibody 1G2-32 was diluted with PBS to 1 µg/ml.
The antibody solution was added to an immunoplate (Nunc) at 50 µl/well, and
then wells were left to stand at room temperature for 2 hours, so that the
antibody was immobilized on the plate. The antibody solution was removed, a
Blocking One solution (NACALAI TESQUE, INC.) prepared according to the
included manuals was added at 200 µl/well, and then wells were left to stand at
room temperature for 2 hours for blocking.
[0162]
Next, each fusion protein of an antigen E2 protein and the human
immunoglobulin Fc domain added thereto (i.e., JFH1E2-Fc protein, J6E2-Fc
protein, THE2-Fc protein, Con1E2-Fc protein, J1E2-Fc protein, or H77E2-Fc
protein) was diluted with PBS and then added to the above protein-immobilized
plate at 50 µl/well, followed by 1.5 hours of reaction at room temperature.
After completion of the reaction, wells were washed 3 times with PBS containing
0.05% Tween20. The biotinylated 8D10-3 monoclonal antibody diluted to 1
ug/ml with PBS containing 0.05% Tween20 was added at 50 ul/well and then
allowed to react at room temperature for 2 hours. After the reaction, wells were
washed 3 times with PBS containing 0.05% Tween20. 50 µl of HRP-labeled
anti-streptavidin (GE Healthcare) diluted 5,000-fold with PBS containing 0.05%
Tween20 was added and then allowed to react at room temperature for 1.5 hours.
[0163]
After the reaction, wells were washed 4 times with PBS containing
0.05% Tween20, color was developed using a peroxidase color-developing kit
(Sumitomo Bakelite Co., Ltd.), and then absorbance at 490 nm was measured.
The results are shown in Fig. 8.
[0164]
Fig. 8 shows detection sensitivity for the antigen E2 proteins of
various genotypes/strains as determined by sandwich ELISA using the
monoclonal antibodies 1G2-32 and 8D10-3. The horizontal axis indicates the
amounts of the antigen E2 proteins and the longitudinal axis indicates
absorbances at 490 nm; that is, the detected amounts of the antigen E2 proteins.
The sandwich ELISA using the monoclonal antibodies 1G2-32 and 8D10-3
showed that only the antigen E2 proteins of HCV genotype 2a could be detected,
and that no antigen E2 proteins of genotype 1a and genotype 1b could be
detected. These results indicate that HCV genotypes or strains can be identified
using the set of the antibodies obtained according to the present invention.
[0165]
(2) Western blot method
A one-fifth volume of 5 x sample buffer (0.3125 M Tris-HCl, pH 6.8,
5% SDS, 50% glycerol, 0.05% BPB, 5% 2-ME) was added to 0.1 µg to 0.3 µg
of each fusion protein (JFH1E2-Fc protein, J6E2-Fc protein, THE2-Fc protein,
ConlE2-Fc protein, J1E2-Fc protein, or H77E2-Fc protein) of an antigen E2
protein and the human immunoglobulin Fc domain added thereto, followed by 5
minutes of treatment at 100°C. The resultants were used as samples. Each
sample was applied to 4%-20% gradient gel (TEFCO), subjected to
electrophoresis with a constant current of 40 mA, and then blotted to a PVDF
membrane using a semi-dry blotting apparatus at a constant current of 120 mA.
[0166]
After blotting, the PVDF membrane was soaked in Block Ace (Snow
Brand Milk Products Co., Ltd.) at room temperature for 1 hour for blocking,
washed with TBS containing 0.1% Tween20, soaked in the 8D10-3 monoclonal
antibody diluted with Can Get Signal (Toyobo Co., Ltd.) to 1 µg/mL, and then
allowed to react for 1 hour at room temperature. After the reaction, the
membrane was washed with TBS containing 0.1% Tween20, subsequently soaked
in an HRP-labeled anti-mouse IgG antibody diluted 5,000-fold with Can Get
Signal, and then allowed to react at room temperature for 1 hour. The
membrane was washed with TBS containing 0.1% Tween20, and then bands were
detected using an ECL kit (GE Healthcare).
[0167]
Fig. 9 shows detection or lack of detection of the antigen E2 proteins
of various genotypes/strains by a Western blot method using the 8D10-3
monoclonal antibody. The antigen E2 proteins of all 6 strain types could be
detected with the 8D10-3 monoclonal antibody.
Industrial Applicability
[0168]
The antibodies of the present invention make it possible to simply
identify HCV genotypes la, lb, and 2a, with high accuracy. Thus, adverse
effects can be alleviated and a chance to select new therapeutic methods can be
provided for hepatitis C patients infected with HCV of genotype la or lb, for
which no therapeutic effects of interferon therapy could previously have been
expected.
We Claim:
1. An antibody, which specifically binds to envelope protein 2 of hepatitis C
virus of genotype 2a but does not immunologically react with envelope protein 2
of hepatitis C virus of genotype 1a.
2. The antibody according to claim 1, which recognizes the amino acid sequence
shown in SEQ ID NO: 1 in the Sequence Listing as an epitope.
3. The antibody according to claim 1 or 2, which is produced by the hybridoma
cell line having provisional accession No. FERM ABP-11181.
4. The antibody according to claim 1, which does not immunologically react with
envelope protein 2 of hepatitis C virus of genotype 1b.
5. The antibody according to claim 4, which recognizes the amino acid sequence
shown in SEQ ID NO: 2 in the Sequence Listing as an epitope.
6. The antibody according to claim 4, which recognizes the amino acid sequence
shown in SEQ ID NO: 3 in the Sequence Listing as an epitope.
7. The antibody according to claim 4 or 5, which is produced by the hybridoma
cell line having provisional accession No. FERM ABP-11180.
8. The antibody according to claim 4 or 6, which is produced by the hybridoma
cell line having provisional accession No. FERM ABP-11179.
9. The antibody according to claim 4, which specifically binds to envelope
protein 2 of the J6CF strain but does not immunologically react with envelope
protein 2 of the JFH1 strain.
10. The antibody according to claim 9, which recognizes the amino acid
sequence shown in SEQ ID NO: 4 in the Sequence Listing as an epitope.
11. The antibody according to claim 9 or 10, which is produced by the
hybridoma cell line having provisional accession No. FERM ABP-11183.
12. A method for identifying a hepatitis C virus genotype, wherein:
the genotype of hepatitis C virus is determined to be genotype 1b if the
virus binds to the antibody according to claim 3, but does not bind to either of
antibodies according to claims 7 and 8;
the genotype of hepatitis C virus is determined to be genotype 2a if the
virus binds to the antibody according to claim 3 and binds to the antibodies
according to claims 7 and 8; and
the genotype of hepatitis C virus is determined to be genotype 1a if the
virus binds to an antibody produced by the hybridoma cell line having
provisional accession No. FERM ABP-11182, but does not bind to any of
antibodies according to claims 3, 7, and 8.
The present invention provides an antibody that specifically binds to
envelope protein 2 of HCV of genotype 2a but does not immunologically react
with envelope protein 2 of HCV of genotype 1a.
| # | Name | Date |
|---|---|---|
| 1 | 1481-KOLNP-2011-(16-09-2011)-FORM 3.pdf | 2011-09-16 |
| 1 | 1481-KOLNP-2011-Correspondence to notify the Controller (Mandatory) [27-11-2017(online)].pdf | 2017-11-27 |
| 2 | 1481-KOLNP-2011-(16-09-2011)-CORRESPONDENCE.pdf | 2011-09-16 |
| 2 | 1481-KOLNP-2011-HearingNoticeLetter.pdf | 2017-11-02 |
| 3 | abstract-1481-kolnp-2011.jpg | 2011-10-07 |
| 3 | Abstract [29-12-2016(online)].pdf | 2016-12-29 |
| 4 | Claims [29-12-2016(online)].pdf | 2016-12-29 |
| 4 | 1481-kolnp-2011-specification.pdf | 2011-10-07 |
| 5 | Correspondence [29-12-2016(online)].pdf | 2016-12-29 |
| 5 | 1481-kolnp-2011-sequence listing.pdf | 2011-10-07 |
| 6 | Description(Complete) [29-12-2016(online)].pdf | 2016-12-29 |
| 6 | 1481-kolnp-2011-pct request form.pdf | 2011-10-07 |
| 7 | Description(Complete) [29-12-2016(online)].pdf_17.pdf | 2016-12-29 |
| 7 | 1481-kolnp-2011-pct priority document notification.pdf | 2011-10-07 |
| 8 | Examination Report Reply Recieved [29-12-2016(online)].pdf | 2016-12-29 |
| 8 | 1481-KOLNP-2011-PA.pdf | 2011-10-07 |
| 9 | 1481-kolnp-2011-others pct form.pdf | 2011-10-07 |
| 9 | Other Document [29-12-2016(online)].pdf | 2016-12-29 |
| 10 | 1481-kolnp-2011-international search report.pdf | 2011-10-07 |
| 10 | Other Document [29-12-2016(online)].pdf_46.pdf | 2016-12-29 |
| 11 | 1481-kolnp-2011-international publication.pdf | 2011-10-07 |
| 11 | Other Document [29-12-2016(online)].pdf_48.pdf | 2016-12-29 |
| 12 | 1481-kolnp-2011-form-5.pdf | 2011-10-07 |
| 12 | Other Document [29-12-2016(online)].pdf_50.pdf | 2016-12-29 |
| 13 | 1481-kolnp-2011-form-3.pdf | 2011-10-07 |
| 13 | Petition Under Rule 137 [29-12-2016(online)].pdf | 2016-12-29 |
| 14 | 1481-kolnp-2011-form-2.pdf | 2011-10-07 |
| 14 | Petition Under Rule 137 [29-12-2016(online)].pdf_47.pdf | 2016-12-29 |
| 15 | 1481-KOLNP-2011-FORM-18.pdf | 2011-10-07 |
| 15 | Petition Under Rule 137 [29-12-2016(online)].pdf_49.pdf | 2016-12-29 |
| 16 | 1481-KOLNP-2011-FER.pdf | 2016-08-31 |
| 16 | 1481-kolnp-2011-form-1.pdf | 2011-10-07 |
| 17 | Other Patent Document [14-07-2016(online)].pdf | 2016-07-14 |
| 17 | 1481-kolnp-2011-drawings.pdf | 2011-10-07 |
| 18 | 1481-KOLNP-2011-(15-04-2016)-ANNEXURE TO FORM 3.pdf | 2016-04-15 |
| 18 | 1481-kolnp-2011-description (complete).pdf | 2011-10-07 |
| 19 | 1481-KOLNP-2011-(15-04-2016)-CORRESPONDENCE.pdf | 2016-04-15 |
| 19 | 1481-kolnp-2011-correspondence.pdf | 2011-10-07 |
| 20 | 1481-KOLNP-2011-(11-02-2015)-ANNEXURE TO FORM 3.pdf | 2015-02-11 |
| 20 | 1481-KOLNP-2011-CORRESPONDENCE-1.1.pdf | 2011-10-07 |
| 21 | 1481-KOLNP-2011-(11-02-2015)-CORRESPONDENCE.pdf | 2015-02-11 |
| 21 | 1481-kolnp-2011-claims.pdf | 2011-10-07 |
| 22 | 1481-KOLNP-2011-(26-05-2014)-CORRESPONDENCE.pdf | 2014-05-26 |
| 22 | 1481-kolnp-2011-abstract.pdf | 2011-10-07 |
| 23 | 1481-KOLNP-2011-(22-08-2012)-CORRESPONDENCE.pdf | 2012-08-22 |
| 23 | 1481-KOLNP-2011-(26-05-2014)-FORM-1.pdf | 2014-05-26 |
| 24 | 1481-KOLNP-2011-(22-08-2012)-ANNEXURE TO FORM 3.pdf | 2012-08-22 |
| 25 | 1481-KOLNP-2011-(26-05-2014)-FORM-1.pdf | 2014-05-26 |
| 25 | 1481-KOLNP-2011-(22-08-2012)-CORRESPONDENCE.pdf | 2012-08-22 |
| 26 | 1481-KOLNP-2011-(26-05-2014)-CORRESPONDENCE.pdf | 2014-05-26 |
| 26 | 1481-kolnp-2011-abstract.pdf | 2011-10-07 |
| 27 | 1481-KOLNP-2011-(11-02-2015)-CORRESPONDENCE.pdf | 2015-02-11 |
| 27 | 1481-kolnp-2011-claims.pdf | 2011-10-07 |
| 28 | 1481-KOLNP-2011-(11-02-2015)-ANNEXURE TO FORM 3.pdf | 2015-02-11 |
| 28 | 1481-KOLNP-2011-CORRESPONDENCE-1.1.pdf | 2011-10-07 |
| 29 | 1481-KOLNP-2011-(15-04-2016)-CORRESPONDENCE.pdf | 2016-04-15 |
| 29 | 1481-kolnp-2011-correspondence.pdf | 2011-10-07 |
| 30 | 1481-KOLNP-2011-(15-04-2016)-ANNEXURE TO FORM 3.pdf | 2016-04-15 |
| 30 | 1481-kolnp-2011-description (complete).pdf | 2011-10-07 |
| 31 | 1481-kolnp-2011-drawings.pdf | 2011-10-07 |
| 31 | Other Patent Document [14-07-2016(online)].pdf | 2016-07-14 |
| 32 | 1481-KOLNP-2011-FER.pdf | 2016-08-31 |
| 32 | 1481-kolnp-2011-form-1.pdf | 2011-10-07 |
| 33 | 1481-KOLNP-2011-FORM-18.pdf | 2011-10-07 |
| 33 | Petition Under Rule 137 [29-12-2016(online)].pdf_49.pdf | 2016-12-29 |
| 34 | 1481-kolnp-2011-form-2.pdf | 2011-10-07 |
| 34 | Petition Under Rule 137 [29-12-2016(online)].pdf_47.pdf | 2016-12-29 |
| 35 | 1481-kolnp-2011-form-3.pdf | 2011-10-07 |
| 35 | Petition Under Rule 137 [29-12-2016(online)].pdf | 2016-12-29 |
| 36 | Other Document [29-12-2016(online)].pdf_50.pdf | 2016-12-29 |
| 36 | 1481-kolnp-2011-form-5.pdf | 2011-10-07 |
| 37 | 1481-kolnp-2011-international publication.pdf | 2011-10-07 |
| 37 | Other Document [29-12-2016(online)].pdf_48.pdf | 2016-12-29 |
| 38 | 1481-kolnp-2011-international search report.pdf | 2011-10-07 |
| 38 | Other Document [29-12-2016(online)].pdf_46.pdf | 2016-12-29 |
| 39 | 1481-kolnp-2011-others pct form.pdf | 2011-10-07 |
| 39 | Other Document [29-12-2016(online)].pdf | 2016-12-29 |
| 40 | 1481-KOLNP-2011-PA.pdf | 2011-10-07 |
| 40 | Examination Report Reply Recieved [29-12-2016(online)].pdf | 2016-12-29 |
| 41 | 1481-kolnp-2011-pct priority document notification.pdf | 2011-10-07 |
| 41 | Description(Complete) [29-12-2016(online)].pdf_17.pdf | 2016-12-29 |
| 42 | Description(Complete) [29-12-2016(online)].pdf | 2016-12-29 |
| 42 | 1481-kolnp-2011-pct request form.pdf | 2011-10-07 |
| 43 | Correspondence [29-12-2016(online)].pdf | 2016-12-29 |
| 43 | 1481-kolnp-2011-sequence listing.pdf | 2011-10-07 |
| 44 | Claims [29-12-2016(online)].pdf | 2016-12-29 |
| 44 | 1481-kolnp-2011-specification.pdf | 2011-10-07 |
| 45 | abstract-1481-kolnp-2011.jpg | 2011-10-07 |
| 45 | Abstract [29-12-2016(online)].pdf | 2016-12-29 |
| 46 | 1481-KOLNP-2011-HearingNoticeLetter.pdf | 2017-11-02 |
| 46 | 1481-KOLNP-2011-(16-09-2011)-CORRESPONDENCE.pdf | 2011-09-16 |
| 47 | 1481-KOLNP-2011-(16-09-2011)-FORM 3.pdf | 2011-09-16 |
| 47 | 1481-KOLNP-2011-Correspondence to notify the Controller (Mandatory) [27-11-2017(online)].pdf | 2017-11-27 |