Abstract: Aptamers against peptide sequence of PAG-7 for early pregnancy detection in bovine The present invention relates to the aptamers selected against peptide sequence of PAG-7 protein of bovine origin. Aptamers showed little interaction with serum of non pregnant cattle but high affinity towards PAG protein present in serum of pregnant animal. These all aptamers have commercial application especially in development of biosensors for detecting early pregnancy in bovine. Figure 1: Aptamer selection by using magnetic beads. Figure 2: Color development at different time duration in aptamers selection against PAG-7 protein. Figure 3: Amplified aptamer product of tube no. 1 after selection process. Figure 4: Aptamer recognizing PAG protein in pregnant animal by GNP method (A), DAB method (B & C) and ECL method (D).
Claims:I/We Claim:
1. Aptamers against peptide sequence of PAG-7 for early pregnancy detection in bovine which comprises any one of the nucleic acid sequences set forth in SEQ ID NO: 1 to SEQ ID NO: 98.
2. The aptamers against peptide sequence of PAG-7 for early pregnancy detection in bovine as claimed in claim 1 wherein the said aptamers are used for the detection of PAG-7 in the sample.
3. The aptamers against peptide sequence of PAG-7 for early pregnancy detection in bovine as claimed in claim 1 wherein the said aptamers are selected by bead based colorimetric method.
4. A method for detection of PAG-7 for early pregnancy detection in bovine wherein the said method comprising any one of the aptamer against peptide sequence of PAG-7 protein of bovine as claimed in claim 1.
Dated 1st day of February, 2021
Garima Singhal APPLICANT’S AGENT
Regd. Patent Agent ?IN/PA-3332?
, Description:4. Description
Field of the invention: The present invention relates to the aptamers selected against peptide sequence of PAG-7 protein of bovine origin. The selected aptamers have commercial application especially in development of biosensors for detecting early pregnancy in bovine.
Background of the invention:
Early pregnancy detection in bovine is key step for better reproductive management in livestock[1]. There are several methods by which detection can be performed such as rectal palpation[2], ultra sound[3] etc. these all methods are good for detection but required expertise also they are expensive and not portable in nature. The other approach is to consider pregnancy associated products that come out during pregnancy process such as pregnancy associated glycoprotein (PAG)[4], progesterone hormone[5]etc. ELISA based kits are available against PAG1 protein[6] and progesterone[7]. In an unpublished work antibodies has also been generated against PAG-7 protein that is found in abounded during bovine pregnancy. ELISA and lateral flow based method are currently in developing stage against this protein.
Aptamers are new class of synthetic molecules that can be developed for detection and therapeutic purposes[8] and have certain advantages over antibodies such as low cost, animal free production, no batch to batch variation etc[9]
Lu et. al, 2020, selected aptamers against PAG-9 protein (Titled: Colorimetric enzyme-linked aptamer assay utilizing hybridization chain reaction for determination of bovine pregnancy-associated glycoproteins). In another paper the same author given information on selection of aptamers against PAG-4 protein (Titled: Selection, identification, and application of DNA aptamers against bovine pregnancy-associated glycoproteins 4).
References:
1. Balhara, A.K., Gupta, M., Singh, S., Mohanty, A.K. and Singh, I., 2013. Early pregnancy diagnosis in bovines: current status and future directions. The Scientific World Journal, 2013.
2. Cowie, T.A., 1948. Pregnancy diagnosis tests: a review. Commonwealth agricultural bureaux joint publication No. 13.
3. Romano, J.E., Thompson, J.A., Forrest, D.W., Westhusin, M.E., Tomaszweski, M.A. and Kraemer, D.C., 2006. Early pregnancy diagnosis by transrectal ultrasonography in dairy cattle. Theriogenology, 66(4), pp.1034-1041.
4. PagnahZoli, A., Beckers, J.F., Wouters-Ballman, P., Closset, J., Falmagne, P. and Ectors, F., 1991. Purification and characterization of a bovine pregnancy-associated glycoprotein. Biology of reproduction, 45(1), pp.1-10.
5. Skemesh, M., Ayalon, N. and Lindner, H.R., 1973. Early pregnancy diagnosis based upon plasma progesterone levels in the cow and ewe. Journal of animal science, 36(4), pp.726-729.
6. Roberts, J.N., May, K.J. and Veiga-Lopez, A., 2017. Time-dependent changes in pregnancy-associated glycoproteins and progesterone in commercial crossbred sheep. Theriogenology, 89, pp.271-279.
7. Moriyoshi, Masaharu, Kouya Nozoki, Tadatoshi Ohtaki, Ken Nakada, Toshihiko Nakao, and Keiichiro Kawata. "Measurement of gestagen concentration in feces using a bovine milk progesterone quantitative test EIA kit and its application to early pregnancy diagnosis in the sow." Journal of veterinary medical science 59, no. 8 (1997): 695-701.
8. Brody, E.N. and Gold, L., 2000. Aptamers as therapeutic and diagnostic agents. Reviews in Molecular Biotechnology, 74(1), pp.5-13.
9. Keefe, A.D., Pai, S. and Ellington, A., 2010. Aptamers as therapeutics. Nature reviews Drug discovery, 9(7), pp.537-550.
10. Stoltenburg, R., Reinemann, C. and Strehlitz, B., 2005. FluMag-SELEX as an advantageous method for DNA aptamer selection. Analytical and bioanalytical chemistry, 383(1), pp.83-91.
11. Darmostuk, M., Rimpelova, S., Gbelcova, H. and Ruml, T., 2015. Current approaches in SELEX: An update to aptamer selection technology. Biotechnology advances, 33(6), pp.1141-1161.
Objectives of invention:
? The main objective of the present invention is to provide aptamers capable of binding to PAG-7 proteins.
? Yet another objective of this invention is to select aptamers from DNA library against PAG-7 protein of Bubalus bubalis.
? Yet another objective of the present invention is to provide a method for detection of PAG-7 protein in bovine blood by using the selected aptamers.
Summary
Accordingly present invention provides aptamers selected against pregnancy associated glycoproteins-7 (PAG-7) comprising any one of the nucleic acid sequences set forth in group comprising SEQ ID NO. 1 to SEQ ID NO. 98.
Another aspect of the present invention provides a method for detection of pregnancy associated glycoprotein in a biological test sample by these aptamers.
List of Abbreviations used
PAG= Pregnancy associated glycoproteins
ST-GNP= Streptavidin coated gold nanoparticles
ST-HRP= Streptavidin coated Horse reddish peroxidase
DAB= Diaminobenzidine
SELEX=Systematic evolution of ligands by exponential enrichment
BSA=Bovine serum albumin
Brief Description of the drawings:
Figure 1: Aptamer selection by using magnetic beads .
Figure 2: Color development at different time duration in aptamers selection against PAG-7 protein.
Figure 3: Amplified aptamer product of tube no. 1 after selection process.
Figure 4: Aptamer recognizing PAG protein in pregnant animal by GNP method (A), DAB method (B & C) and ECL method (D).
Detailed Description
While the present invention is described herein by way of example using embodiments and illustrative drawings, those skilled in the art will recognize that the invention is not limited to the embodiments of drawing or drawings described, and are not intended to represent the scale of the various components. Further, some components that may form a part of the invention may not be illustrated in certain figures, for ease of illustration, and such omissions do not limit the embodiments outlined in any way. It should be understood that the drawings and detailed description thereto are not intended to limit the invention to the particular form disclosed, but on the contrary, the invention is to cover all modifications, equivalents, and alternatives falling within the scope of the present invention as defined by the appended claim.
This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiment set forth herein. Rather, the embodiment is provided so that this disclosure will be thorough and complete and will fully convey the scope of the invention to those skilled in the art.
The present invention relates to novel aptamers specific for PAG-7 peptide. The present invention provides a single strand DNA or aptamer capable of binding to PAG-7 which comprises any of the sequences set forth in SEQ ID NO. 1 to SEQ ID NO. 98. However, these sequences may also interact with other variants of PAG.
In an embodiment of present invention the method of selection is based on non-SELEX. The aptamer selection method is fast and reliable, further it is colorimetric in nature. The method uses magnetic bead-based approach where peptide is immobilized on beads and aptamers are added on it. By using streptavidin-biotin approach only those beads are selected that give intense blue color. PCR is performed for selected beads to get amplified product of aptamers attached with target protein on beads. Amplicon sequencing of PCR product gives the information of aptamers sequence information. The method is novel as the method gives selection in visual form that is not possible with conventional SELEX. Further only more interactive aptamers (On the basis of color intensity, high G score and complex M fold structure) are chosen by this method which otherwise be time consuming and labor intensive with conventional method.
Selection of aptamers against bovine PAG-7 protein
In an embodiment of present invention, Tosyl containing magnetic beads were taken and 10 ug. of peptide sequence (KDSRGHCYTTKEKRVRRS) PAG-7 was immobilized on beads by using 150 µl borate buffer, pH 9.5. Further, 100 µl of 3.0 M ammonium sulphate (prepared in borate buffer, pH 9.5) was added to the mixture. The mixture was incubated at 37°C for 22 h. The immobilized beads were blocked in 1.0 Molar tris for 3 h. further the beads were blocked by adding 2% of BSA for 12 h. at room temperature. The control tube contains all the chemicals as mentioned above only devoid of peptide sequence.
Next day 1.0 uM of 50 ul biotin labeled aptamer library was taken and dissolved in 100 ul of 1x PBS, further 0.2 ul of magnesium chloride having stock concentration 1.0 M was added to the mixture. The mixture was snap cooled (heating at 96 ?C for 15 mins. and quick cooling in ice for 5 mins.) added to peptide coated beads at room temperature for 1 hr. After incubation supernatant was discarded and a total of five washing with 1xPBS was given to remove unbound aptamers. Streptavidin conjugated with horse reddish peroxidase (ST-HRP) of 100 ul diluted to 1/40000 times was added to tubes for 20 mins duration and was washed with 1x PBS before adding TMB solution for color development.
The tube that has given most intense blue color was picked and washed with water. After washing, 2.0 ul of beads were taken and PCR was performed at following temperature: initial heating at 95 °C for 3 mins. 28 cycles of 95°C for 30 sec., 50°C for 30 sec, 72°C for 30 sec. and final extension of 72°C for 5 mins. with cool down at 4°C and checked at 2% agarose gel. The PCR product was purified and sent for amlicon sequencing for next generation sequencing (NGS).
The sequences of PAG-7 aptamers generated by non-SELEX method were studied for secondary structure analysis by online program M-fold. The predicted secondary structure based on lowest free energy to highest ones gives information of stem /loop of structure that might be involved in interaction with peptides. For G-quadruplex analysis, QGRS mapper was used to know G-score of these sequences.
Validation of aptamers interaction with PAG protein in biological samples
The streptavidin coated gold nanoparticles (ST-GNP) (Cytodiagnostics, cat. No. AC-40-04-05, conc. 0.15 mg/ml) was taken (5 ul) and mixed with 20 ul of 1x PBS. The mixture as further mixed with 25 ul of 1 uM of biotin labeled Seq. ID No. 29 (Sigma) and incubated for 1 h at RT. Tube was centrifuged at 12000 g for 5 minutes. The process was repeated thrice and each time unbound aptamers were discarded by removing supernatant and finally added 20 ul of 1x PBS. Now 10 ul of serum solution extracted from blood of animal (0 day animal also considered as before the AI of cattle) was taken and spotted at nitrocellulose membrane, pore size 0.45 um on spot no. 2 on membrane surface, acts as a control. Spot no. 1 on membranes had 10 ul solution of serum of an animal already passed 42 days after an AI. The membrane was dried for an hour at RT and blocked in 5% BSA solution for 2 hrs. After the incubation 10 ul of aptamer conjugated GNP was added at spot no. 1 and 2. The membrane was incubated for 45 mins and then washed thrice by 1x PBS for pink color observation.
NC of pore size of 0.45 um was again taken and three spots were made on it. 4.0 ul of serum solution extracted from blood of animal (0 day animal also considered as before the AI of cattle) was taken and spotted at nitrocellulose membrane (spot no. 2). Spot no. 1 on membranes had 4.0 ul solution of serum of an animal already passed 42 days after an AI while 10% BSA was used as control and spotted at spot no. 3 on membrane surface. The membrane was dried for an hour at RT and blocked in 5% BSA solution for 2 hrs. After the incubation 5.0 ul of aptamer (Seq. ID No. 29), conjugated to biotin at 5’ end was added at spot no. 1, 2 & 3 for 45 mins. at RT. The membrane was washed and, streptavidin conjugated to HRP was taken (5 ul of 1.25 mg/ml was dissolved in 10 ml 1x PBS) and membrane was immersed in that solution for 30 mins. A brief washing was again given to membrane in 1x PBS and subsequently 5.0 ul solution of DAB chemical was added to each spot in dark and color observation was done after 15 mins. duration. Test was also carried out to see aptamer (Seq. ID No. 29) interaction with synthetic peptide sequence of PAG-7 protein. The result showed interaction of aptamer with given target in DAB method. The same set up of experiment was also performed with ECL method in presence of Seq. ID No 45 to see aptamer interaction with PAG protein of pregnant animals serum sample.
In another embodiment of present invention the tube which has given intense blue color was used for aptamers amplification by PCR and sent for amplicon sequencing. A total of ninety eight sequences were identified. The aptamer sequence information is given in sequence listing section. The G- score value ranges from 0 to 55.Seq. ID No. 29 recognized the PAG-18 protein in animal whose blood was taken after 42 days of an AI. A clear pink color spot was formed at spot no.1 which was stayed up to four washing while such color was absent in spot no. 2. The same result was also observed when DAB (with Seq. ID No. 29) & ECL (with Seq. ID No. 45) chemical were used.
In an embodiment the said aptamers can be used as recognition agents for detection of PAG-7 protein and helps in detection of early pregnancy in bovine.
In an embodiment the aptamers were selected by using modified version of SELEX which is also colorimetric in nature. The benefit of this method is that selection and recognition of target can be done simultaneously. The method is quick and can be performed in single day. The best color giving tube was selected; aptamer was amplified and sequenced for biosensor making. These aptamers are novel which are selected against peptide sequence of PAG-7 proteins and currently unavailable in market.
Listing of Sequences:
<160> No of SEQ ID NOS.: 98
<210> SEQ ID NO 1
<211> LENGTH: 87
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 1
TAGGGAAGAGAAGGACATATGATGGGTGAGCCGGACGGGGGGCTGGCAAGGGACGGGGGGGCTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 2
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 2
TAGGGAAGAGAAGGACTTTTTTCAAGCAGAAGACGGCATACGAGATAGCTAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATTC
<210> SEQ ID NO 3
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 3
TAGGGAAGAGAAGGACATATGATCGGATCGTTCGGTTGGTCGAGGGTTGACCTCGTGGCCGCGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 4
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 4
TAGGGAAGAGAAGGACATATGATGCTTGGGAGCGGGCTATGAGTCCCAGGGCTCTGCTATGCCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 5
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 5
TAGGGAAGAGAAGGACATATGATAACCAGACTATGAGTAGCGTACTATCTATCGTCCCGCAGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 6
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 6
TAGGGAAGAGAAGGACATATGATACGAGGGAATGTCGGTGTAGCTAATAGCCCCCGACGGGGCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 7
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 7
TAGGGAAGAGAAGGACATATGATCGGTACTTCACGAACGTCCTATATGTACGGCAAGGTGTGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 8
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 8
TAGGGAAGAGAAGGACATATGATACATCGCCGTACTGGGCAGGAGTCCGGGGCTTTCTAGCGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 9
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 9
TAGGGAAGAGAAGGACATATGATTAAAAACTGAAACGGGTGACTCGCTGCTATGTCTGCCTACTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 10
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 10
TAGGGAAGAGAAGGACATATGATGCATGTTAAGGTTACACCACATTCAGGTTAAGGACCGGTTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 11
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 11
TAGGGAAGAGAAGGACATATGATGCTGTGGCTCCGTGGTTGGAACTACGATGCCGATCGACGCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 12
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 12
TAGGGAAGAGAAGGACATATGATGTATGTATTATCCTGTAACTGTAGCTTGTACCAGCAGCCATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 13
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 13
TAGGGAAGAGAAGGACATATGATTTGGAACGTGAGGATGAAGGGGTTGGTTGTCGGGGCAGGCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 14
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 14
TAGGGAAGAGAAGGACATATGATGTATGGAGGGCGGATCATGAGGGGGGAATTGGGAGAAGGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 15
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 15
TAGGGAAGAGAAGGACATATGATCCCTACCGATGGCACTCTATTTGGGCCTCTGTGTAAAGACTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 16
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 16
TAGGGAAGAGAAGGACATATGATCTAACTTCGTGTGTTGTACTGTGAGAGAGAGGACACCGTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 17
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 17
TAGGGAAGAGAAGGACATATGATGTTGATGGGCTGGTGTGTCACGTGTGGGTGGAGGTGGGGCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 18
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 18
TAGGGAAGAGAAGGACATATGATGGCTGCGTTTGGTCCGCTGTGTTTGGTCTAGGCTTATGGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 19
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 19
TAGGGAAGAGAAGGACATATGATCCTGTGTGCACAGAAGCTACGCGTGGCCTAGTGATCCGGATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 20
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 20
TAGGGAAGAGAAGGACATATGATAAGGAAGTACTAACATGGTCTGTAAGCAGGAACCTTCGCTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 21
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 21
TAGGGAAGAGAAGGACATATGATCTCCCCGAAACTGATGCCCTAGGGCCTGGCGTATTTGTGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 22
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 22
TAGGGAAGAGAAGGACATATGATTGTCAGTAGAGGGCTGGGGTGGCCAAGTGCAGTTGGTGGCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 23
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 23
TAGGGAAGAGAAGGACATATGATTGTCCGGGGGCACGTGGGGACGGAGGGAGATTGTAACGGCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 24
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 24
TAGGGAAGAGAAGGACATATGATGGGACCACATTTTTTTTATTGAAGCAGTATGAGACGGCCCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 25
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 25
TAGGGAAGAGAAGGACATATGATGCAAAATTGGTGTGTCGCCTATTCTTAATCCACGCGTCATTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 26
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 26
TAGGGAAGAGAAGGACATATGATATTGGCTATTTAGGAATTAGTAGGGAGCGACTTTGAAGTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 27
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 27
TAGGGAAGAGAAGGACATATGATTCTGCTTTTATGTTTTTAGCTATATTGTCGTTTGTTCATGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 28
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 28
TAGGGAAGAGAAGGACATATGATTCGTGCAGCTATTCGCTGCTCACGTCCGTCTGTTTCCTGCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 29
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 29
TAGGGAAGAGAAGGACATATGATTATTGATTACCGGCTCTTAGGGTGACATATGCGTTTGCAGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 30
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 30
TAGGGAAGAGAAGGACATATGATAGCACACTTACACATACGGGGCACAGCCTCAATCCACGTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 31
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 31
TAGGGAAGAGAAGGACATATGATTTACTTGCTGCGCACTTTTTGTCAGATCGCATGCTGTGCCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 32
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 32
TAGGGAAGAGAAGGACATATGATGTGTATCTATGGGTGTACGTTAGTGATTTGTCTCTCATCCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 33
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 33
TAGGGAAGAGAAGGACATATGATATAATGGGGTAATTGCAGCTATAGTGGGTTCTGATCGCGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 34
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 34
TAGGGAAGAGAAGGACATATGATTGGGCGCGAGCGGACGGAGTGCGGCCTCGGGGAGCACTGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 35
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 35
TAGGGAAGAGAAGGACATATGATTAAGGCGGCCCGATGGTTTTTTGTGTGTTTTCCGTGGGGATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 36
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 36
TAGGGAAGAGAAGGACATATGATTTCAGCCAAGAAAGGGCACGATCGACTCCTTACGTGGCGATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 37
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 37
TAGGGAAGAGAAGGACATATGATTCACCGTTTCACTTAAGCCTCATAGTTTCTTCCGCTAGCTTTGACTAGTACATGACCACTTGA
TAGGGAAGAGAAGGACATATGATGGAATCGGCGGGGGGCACTTTGAGTATGCGAGGCTGATGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 38
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 38
TAGGGAAGAGAAGGACATATGATGGAACCGCTGGGAAAGTTTAAGATGGGACGATGGCATGTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 39
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 39
TAGGGAAGAGAAGGACATATGATCAACCTGGAGTGAGTTCTTTAATCCGTCCTGATGGGATTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 40
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 40
TAGGGAAGAGAAGGACATATGATGTGTATTTCCTTTTTGTCACGTCTTTTCGCTCGGTTATTATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 41
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 41
TAGGGAAGAGAAGGACATATGATGCTAGACGGGTAGCTATGACACACGGAGCCCTCGTGTCGATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 42
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 42
TAGGGAAGAGAAGGACATATGATATCAGGCTAGCAAGAGGCGCGGTGTAACAGTGTAACACGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 43
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 43
TAGGGAAGAGAAGGACATATGATCGAGGAATCGACTAGACTGTTGCGATAGGATTCTCGGTATTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 44
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 44
TAGGGAAGAGAAGGACATATGATTCAGGGTCGAGCAAAGGAGGGTTTAGGCACTATTCGGGTCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 45
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 45
TAGGGAAGAGAAGGACATATGATGCGTATTACCTAGTTTGAGTCCCATGAAACGATGCACTGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 46
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 46
TAGGGAAGAGAAGGACATATGATGAAGGGAGTTGGGCGGTTACAGGGAACCCCGGCCCCGGAGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 47
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 47
TAGGGAAGAGAAGGACATATGATTGGTCGCCAATAATCCCATGTAGAGCCTTTCGATTAGCTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 48
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 48
TAGGGAAGAGAAGGACATATGATACAGACCATAGGTGTATTGGATCCAACAGATAAAGGCTGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 49
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 49
TAGGGAAGAGAAGGACATATGATGGATCCTGCGGTGCGGGTATGTGTATTTGGGAGGGTTTGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 50
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 50
TAGGGAAGAGAAGGACATATGATCGTAGACTCTGATCAGCGTTCAGGAATATAATTTCCCGGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 51
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 51
TAGGGAAGAGAAGGACATATGATGCCGTACTGACGCAATTAAGCGGGCGCTAAGGGGGTGGAGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 52
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 52
TAGGGAAGAGAAGGACATATGATGGAACTGGTTTGAGACTGGGAAAATGGTGGAAGGGTTAAGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 53
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 53
TAGGGAAGAGAAGGACATATGATCCCTGGCCCTTATTATACGATACACTCTATCGCTGAACTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 54
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 54
TAGGGAAGAGAAGGACATATGATTCTGTTCGAAACGTCTTATATTTGTAAGCAACTGATTGGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 55
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 55
TAGGGAAGAGAAGGACATATGATAAGTGAACATGACACTGGAACATCCGAGCGCAAATTAAACTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 56
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 56
TAGGGAAGAGAAGGACATATGATTTGATTTATTGCTTAGTTCAATGCGGAGTTGCTGTTCTGATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 57
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 57
TAGGGAAGAGAAGGACATATGATCTCGTCTTTATTCCCTCGTATGGCTGTGAAGTTCCCCCGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 58
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 58
TAGGGAAGAGAAGGACATATGATTTGGTCATGCGCCGTGATAACTTTTATCTGGAGATCGTTATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 59
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 59
TAGGGAAGAGAAGGACATATGATTGGGGAGGTTCACAGGTGTCCGGACGTTGGCAGCGACTGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 60
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 60
TAGGGAAGAGAAGGACATATGATGCTGCAGGGGGGGAGCCCCGTGAGCCACCCGCCGTCGGGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 61
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 61
TAGGGAAGAGAAGGACATATGATAGCGCTTGTAGTACAGTAGCCCTCGTTTTTGCAAGGCCCGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 62
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 62
TAGGGAAGAGAAGGACATATGATGTCGTCTGTACGTGGAACTCCGGCTTTGAGGGGAAGCGCCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 63
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 63
TAGGGAAGAGAAGGACATATGATTCCGGGATTTGGTGCGGCTTTGTCAATGTGAAGCACAGTTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 64
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 64
TAGGGAAGAGAAGGACATATGATCTGTTCCCTCCTGTAATTTGAGGCGCCTATGTTCCGGCAGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 65
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 65
TAGGGAAGAGAAGGACATATGATTCGTAGTCATTTGCCTGGTTTGTTTTACTCGCTTCGTGTATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 66
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 66
TAGGGAAGAGAAGGACATATGATAGTCGTTGTACAGGCGATGGAAAGATAGCGGAGGAGAGGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 67
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 67
TAGGGAAGAGAAGGACATATGATCTTACTTCTCCTGCTAAAATTTCATGTTTTGCTCTCGATGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 68
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 68
TAGGGAAGAGAAGGACATATGATGTCAATAATAAGAACTCGGCTATGCACTTCAATACCCGGCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 69
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 69
TAGGGAAGAGAAGGACATATGATACTGTGCTCTTTTTGACGTCGACGTATGAAGGACCCGAAGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 70
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 70
TAGGGAAGAGAAGGACATATGATCCTGCAAGCGGGTAAGCTTCGTAAGGGGGGTTGAAATGTATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 71
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 71
TAGGGAAGAGAAGGACATATGATTCATCGATTGTTGAGAGTTTAGTTGATCTTATACGCTTTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 72
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 72
TAGGGAAGAGAAGGACATATGATGACGGTTATTAGTTCGTGGCTGGGCCGAGGTGTAAAGTTCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 73
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 73
TAGGGAAGAGAAGGACATATGATCAGGGGAAGCAATACCTCTTAACTAGGAAGATTGTTGGTTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 74
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 74
TAGGGAAGAGAAGGACATATGATTCATCCCTAGCGGGTCGGGCGGCGCTCGCGGCCCAGGGTATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 75
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 75
TAGGGAAGAGAAGGACATATGATGAATTATGGGGTCGAAGGGATATGCATGTCGAGCCTAGGATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 76
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 76
TAGGGAAGAGAAGGACATATGATGGGCCAATCGTCATGTTTGATCTGTGTAGCCACACCAATCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 77
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 77
TAGGGAAGAGAAGGACATATGATGATGTATTGGGTATGCTGGAGAGAGACGGTTGTTGAAGGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 78
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 78
TAGGGAAGAGAAGGACATATGATCAATAGGGCTCTATTAATGCTCAAGTCGGCTTATGGTTTATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 79
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 79
TAGGGAAGAGAAGGACATATGATCTCTACGGGGCCCGGGTTTGGTGTTTGCTATGCACCGCGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 80
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 80
TAGGGAAGAGAAGGACATATGATCGCCGGGATTACTGGTGGCGGCGGGAGCATGCAGGGGGGGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 81
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 81
TAGGGAAGAGAAGGACATATGATGCATTGAGCTCCTGGGAACGTTGGAGGAATCCACGGCGGATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 82
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 82
TAGGGAAGAGAAGGACATATGATTCATCCGCTCGGGAGGCCGAAAAGACTTCTGGGTGTCGTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 83
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 83
TAGGGAAGAGAAGGACATATGATATCTCGCCGTCTTTAGGGGGGTTCTAGGCTCTTACGGTCTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 84
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 84
TAGGGAAGAGAAGGACATATGATCATCATTGTTGAGTAGTACTGTGCGCGGTTGCGTGGGGAGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 85
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 85
TAGGGAAGAGAAGGACATATGATGCTCACCGTGGAGCAAATGTATACCTGCTAAGGCGGGTATTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 86
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 86
TAGGGAAGAGAAGGACATATGATGCATACTGTGACCAACACGAATTACTTAGTCGCGGGAGGCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 87
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 87
TAGGGAAGAGAAGGACATATGATTCGGTTTCATGTGCACTAGGTGTATCTCTCCGTGTTCTGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 88
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 88
TAGGGAAGAGAAGGACATATGATGGTTGGAGTCCGTTACCTTAGGTACAAGGTCATGTTACGCTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 89
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 89
TAGGGAAGAGAAGGACATATGATGTTCGCTTTTGGTTTTTTGTACTCACGTTGGCGTGTTTAATTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 90
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 90
TAGGGAAGAGAAGGACATATGATGCACCCGCGGAGGGCTTGCTGTATGGGGGACGGGGTTGACTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 91
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 91
TAGGGAAGAGAAGGACATATGATCCGACTAGGATATATCGAGCAGGCGCTTTCGGCATGTGGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 92
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 92
TAGGGAAGAGAAGGACATATGATAGTGTTCGATCTTCCCTGGCCTTAGGAATCTTGACGTGGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 93
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 93
TAGGGAAGAGAAGGACATATGATTGAACACGGTGCCCGTGGAGAGCGGGCGGGGGGGTAGGTTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 94
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 94
TAGGGAAGAGAAGGACATATGATTAATGTGCATTCGCGATTGTCGGTCACGTTACCCACACGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 95
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 95
TAGGGAAGAGAAGGACATATGATTTGGTGCGTACGTGCAGAGGTGGGAGGCAGGCGCCAGGGTTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 96
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 96
TAGGGAAGAGAAGGACATATGATGCTAGCGGACCTGCTCGCCTTCCATGTTCTTAGGAAGTAGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 97
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 97
TAGGGAAGAGAAGGACATATGATCAGCTGACCCCTGCGTGTTTAAGCCGCGCTATTCCGTTTGTTGACTAGTACATGACCACTTGA
<210> SEQ ID NO 98
<211> LENGTH: 86
<212> TYPE: DNA
<213> ORGANISM: artificial
<220> FEATURES:
<223> OTHER INFORMATION: PAG-7 aptamer
<400> Sequence: 98
TAGGGAAGAGAAGGACATATGATGGGTAGCTATGTGCGGGGTTACGGTCAGGACGGGCAGTAGTTGACTAGTACATGACCACTTGA
| Section | Controller | Decision Date |
|---|---|---|
| u/s 15 | Rajiv Kumar Singh | 2022-11-28 |
| u/s 15 | Rajiv Kumar Singh | 2025-02-21 |
| # | Name | Date |
|---|---|---|
| 1 | 202141007213-Correspondence_SIPP Scheme_16-03-2023.pdf | 2023-03-16 |
| 1 | 202141007213-IntimationOfGrant21-02-2025.pdf | 2025-02-21 |
| 1 | 202141007213-ReviewPetition-ExtendedHearingNotice-(HearingDate-30-01-2025)-1200.pdf | 2024-12-30 |
| 1 | 202141007213-ReviewPetition-HearingNotice-(HearingDate-24-12-2024).pdf | 2024-11-21 |
| 1 | 202141007213-STATEMENT OF UNDERTAKING (FORM 3) [20-02-2021(online)].pdf | 2021-02-20 |
| 2 | 202141007213-Correspondence_SIPP Scheme_16-03-2023.pdf | 2023-03-16 |
| 2 | 202141007213-FORM-24 [28-12-2022(online)]-1.pdf | 2022-12-28 |
| 2 | 202141007213-PatentCertificate21-02-2025.pdf | 2025-02-21 |
| 2 | 202141007213-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [21-12-2024(online)].pdf | 2024-12-21 |
| 2 | 202141007213-REQUEST FOR EARLY PUBLICATION(FORM-9) [20-02-2021(online)].pdf | 2021-02-20 |
| 3 | 202141007213-FORM-24 [28-12-2022(online)]-1.pdf | 2022-12-28 |
| 3 | 202141007213-FORM-24 [28-12-2022(online)].pdf | 2022-12-28 |
| 3 | 202141007213-PROOF OF RIGHT [20-02-2021(online)].pdf | 2021-02-20 |
| 3 | 202141007213-ReviewPetition-HearingNotice-(HearingDate-24-12-2024).pdf | 2024-11-21 |
| 3 | 202141007213-Written submissions and relevant documents [14-02-2025(online)].pdf | 2025-02-14 |
| 4 | 202141007213-Correspondence to notify the Controller [20-01-2025(online)].pdf | 2025-01-20 |
| 4 | 202141007213-Correspondence_SIPP Scheme_16-03-2023.pdf | 2023-03-16 |
| 4 | 202141007213-FORM-24 [28-12-2022(online)].pdf | 2022-12-28 |
| 4 | 202141007213-POWER OF AUTHORITY [20-02-2021(online)].pdf | 2021-02-20 |
| 4 | 202141007213-RELEVANT DOCUMENTS [28-12-2022(online)]-1.pdf | 2022-12-28 |
| 5 | 202141007213-ReviewPetition-ExtendedHearingNotice-(HearingDate-30-01-2025)-1200.pdf | 2024-12-30 |
| 5 | 202141007213-RELEVANT DOCUMENTS [28-12-2022(online)].pdf | 2022-12-28 |
| 5 | 202141007213-RELEVANT DOCUMENTS [28-12-2022(online)]-1.pdf | 2022-12-28 |
| 5 | 202141007213-FORM-9 [20-02-2021(online)].pdf | 2021-02-20 |
| 5 | 202141007213-FORM-24 [28-12-2022(online)]-1.pdf | 2022-12-28 |
| 6 | 202141007213-Written submissions and relevant documents [08-03-2022(online)].pdf | 2022-03-08 |
| 6 | 202141007213-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [21-12-2024(online)].pdf | 2024-12-21 |
| 6 | 202141007213-RELEVANT DOCUMENTS [28-12-2022(online)].pdf | 2022-12-28 |
| 6 | 202141007213-FORM-24 [28-12-2022(online)].pdf | 2022-12-28 |
| 6 | 202141007213-FORM FOR STARTUP [20-02-2021(online)].pdf | 2021-02-20 |
| 7 | 202141007213-FORM FOR SMALL ENTITY(FORM-28) [20-02-2021(online)].pdf | 2021-02-20 |
| 7 | 202141007213-RELEVANT DOCUMENTS [28-12-2022(online)]-1.pdf | 2022-12-28 |
| 7 | 202141007213-ReviewPetition-HearingNotice-(HearingDate-24-12-2024).pdf | 2024-11-21 |
| 7 | 202141007213-US(14)-ExtendedHearingNotice-(HearingDate-22-02-2022).pdf | 2022-02-17 |
| 7 | 202141007213-Written submissions and relevant documents [08-03-2022(online)].pdf | 2022-03-08 |
| 8 | 202141007213-Correspondence to notify the Controller [15-02-2022(online)].pdf | 2022-02-15 |
| 8 | 202141007213-Correspondence_SIPP Scheme_16-03-2023.pdf | 2023-03-16 |
| 8 | 202141007213-FORM 1 [20-02-2021(online)].pdf | 2021-02-20 |
| 8 | 202141007213-RELEVANT DOCUMENTS [28-12-2022(online)].pdf | 2022-12-28 |
| 8 | 202141007213-US(14)-ExtendedHearingNotice-(HearingDate-22-02-2022).pdf | 2022-02-17 |
| 9 | 202141007213-Correspondence to notify the Controller [15-02-2022(online)].pdf | 2022-02-15 |
| 9 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [20-02-2021(online)].pdf | 2021-02-20 |
| 9 | 202141007213-FORM-24 [28-12-2022(online)]-1.pdf | 2022-12-28 |
| 9 | 202141007213-US(14)-HearingNotice-(HearingDate-18-02-2022).pdf | 2022-01-24 |
| 9 | 202141007213-Written submissions and relevant documents [08-03-2022(online)].pdf | 2022-03-08 |
| 10 | 202141007213-CLAIMS [26-10-2021(online)].pdf | 2021-10-26 |
| 10 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI [20-02-2021(online)].pdf | 2021-02-20 |
| 10 | 202141007213-FORM-24 [28-12-2022(online)].pdf | 2022-12-28 |
| 10 | 202141007213-US(14)-ExtendedHearingNotice-(HearingDate-22-02-2022).pdf | 2022-02-17 |
| 10 | 202141007213-US(14)-HearingNotice-(HearingDate-18-02-2022).pdf | 2022-01-24 |
| 11 | 202141007213-CLAIMS [26-10-2021(online)].pdf | 2021-10-26 |
| 11 | 202141007213-Correspondence to notify the Controller [15-02-2022(online)].pdf | 2022-02-15 |
| 11 | 202141007213-DRAWINGS [20-02-2021(online)].pdf | 2021-02-20 |
| 11 | 202141007213-FER_SER_REPLY [26-10-2021(online)].pdf | 2021-10-26 |
| 11 | 202141007213-RELEVANT DOCUMENTS [28-12-2022(online)]-1.pdf | 2022-12-28 |
| 12 | 202141007213-US(14)-HearingNotice-(HearingDate-18-02-2022).pdf | 2022-01-24 |
| 12 | 202141007213-SEQUENCE LISTING [26-10-2021(online)].txt | 2021-10-26 |
| 12 | 202141007213-RELEVANT DOCUMENTS [28-12-2022(online)].pdf | 2022-12-28 |
| 12 | 202141007213-FER_SER_REPLY [26-10-2021(online)].pdf | 2021-10-26 |
| 12 | 202141007213-DECLARATION OF INVENTORSHIP (FORM 5) [20-02-2021(online)].pdf | 2021-02-20 |
| 13 | 202141007213-CLAIMS [26-10-2021(online)].pdf | 2021-10-26 |
| 13 | 202141007213-COMPLETE SPECIFICATION [20-02-2021(online)].pdf | 2021-02-20 |
| 13 | 202141007213-FER.pdf | 2021-10-18 |
| 13 | 202141007213-SEQUENCE LISTING [26-10-2021(online)].txt | 2021-10-26 |
| 13 | 202141007213-Written submissions and relevant documents [08-03-2022(online)].pdf | 2022-03-08 |
| 14 | 202141007213-Correspondence_19-03-2021.pdf | 2021-03-19 |
| 14 | 202141007213-FER.pdf | 2021-10-18 |
| 14 | 202141007213-FER_SER_REPLY [26-10-2021(online)].pdf | 2021-10-26 |
| 14 | 202141007213-STARTUP [02-03-2021(online)].pdf | 2021-03-02 |
| 14 | 202141007213-US(14)-ExtendedHearingNotice-(HearingDate-22-02-2022).pdf | 2022-02-17 |
| 15 | 202141007213-Correspondence to notify the Controller [15-02-2022(online)].pdf | 2022-02-15 |
| 15 | 202141007213-Correspondence_19-03-2021.pdf | 2021-03-19 |
| 15 | 202141007213-FORM-8 [12-03-2021(online)].pdf | 2021-03-12 |
| 15 | 202141007213-FORM28 [02-03-2021(online)].pdf | 2021-03-02 |
| 15 | 202141007213-SEQUENCE LISTING [26-10-2021(online)].txt | 2021-10-26 |
| 16 | 202141007213-US(14)-HearingNotice-(HearingDate-18-02-2022).pdf | 2022-01-24 |
| 16 | 202141007213-FORM-8 [12-03-2021(online)].pdf | 2021-03-12 |
| 16 | 202141007213-FORM FOR STARTUP [02-03-2021(online)].pdf | 2021-03-02 |
| 16 | 202141007213-FER.pdf | 2021-10-18 |
| 16 | 202141007213-Correspondence, Form-1, Form-5, Form-26, Form-18A, Form-28_08-03-2021.pdf | 2021-03-08 |
| 17 | 202141007213-FORM 18A [02-03-2021(online)].pdf | 2021-03-02 |
| 17 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI [02-03-2021(online)].pdf | 2021-03-02 |
| 17 | 202141007213-Correspondence_19-03-2021.pdf | 2021-03-19 |
| 17 | 202141007213-Correspondence, Form-1, Form-5, Form-26, Form-18A, Form-28_08-03-2021.pdf | 2021-03-08 |
| 17 | 202141007213-CLAIMS [26-10-2021(online)].pdf | 2021-10-26 |
| 18 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI [02-03-2021(online)].pdf | 2021-03-02 |
| 18 | 202141007213-FER_SER_REPLY [26-10-2021(online)].pdf | 2021-10-26 |
| 18 | 202141007213-FORM 18A [02-03-2021(online)].pdf | 2021-03-02 |
| 18 | 202141007213-FORM-8 [12-03-2021(online)].pdf | 2021-03-12 |
| 19 | 202141007213-Correspondence, Form-1, Form-5, Form-26, Form-18A, Form-28_08-03-2021.pdf | 2021-03-08 |
| 19 | 202141007213-FORM 18A [02-03-2021(online)].pdf | 2021-03-02 |
| 19 | 202141007213-FORM FOR STARTUP [02-03-2021(online)].pdf | 2021-03-02 |
| 19 | 202141007213-SEQUENCE LISTING [26-10-2021(online)].txt | 2021-10-26 |
| 20 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI [02-03-2021(online)].pdf | 2021-03-02 |
| 20 | 202141007213-FER.pdf | 2021-10-18 |
| 20 | 202141007213-FORM FOR STARTUP [02-03-2021(online)].pdf | 2021-03-02 |
| 20 | 202141007213-FORM-8 [12-03-2021(online)].pdf | 2021-03-12 |
| 20 | 202141007213-FORM28 [02-03-2021(online)].pdf | 2021-03-02 |
| 21 | 202141007213-STARTUP [02-03-2021(online)].pdf | 2021-03-02 |
| 21 | 202141007213-FORM28 [02-03-2021(online)].pdf | 2021-03-02 |
| 21 | 202141007213-FORM 18A [02-03-2021(online)].pdf | 2021-03-02 |
| 21 | 202141007213-Correspondence_19-03-2021.pdf | 2021-03-19 |
| 22 | 202141007213-COMPLETE SPECIFICATION [20-02-2021(online)].pdf | 2021-02-20 |
| 22 | 202141007213-FER.pdf | 2021-10-18 |
| 22 | 202141007213-FORM FOR STARTUP [02-03-2021(online)].pdf | 2021-03-02 |
| 22 | 202141007213-FORM-8 [12-03-2021(online)].pdf | 2021-03-12 |
| 22 | 202141007213-STARTUP [02-03-2021(online)].pdf | 2021-03-02 |
| 23 | 202141007213-SEQUENCE LISTING [26-10-2021(online)].txt | 2021-10-26 |
| 23 | 202141007213-FORM28 [02-03-2021(online)].pdf | 2021-03-02 |
| 23 | 202141007213-DECLARATION OF INVENTORSHIP (FORM 5) [20-02-2021(online)].pdf | 2021-02-20 |
| 23 | 202141007213-Correspondence, Form-1, Form-5, Form-26, Form-18A, Form-28_08-03-2021.pdf | 2021-03-08 |
| 23 | 202141007213-COMPLETE SPECIFICATION [20-02-2021(online)].pdf | 2021-02-20 |
| 24 | 202141007213-STARTUP [02-03-2021(online)].pdf | 2021-03-02 |
| 24 | 202141007213-FER_SER_REPLY [26-10-2021(online)].pdf | 2021-10-26 |
| 24 | 202141007213-DECLARATION OF INVENTORSHIP (FORM 5) [20-02-2021(online)].pdf | 2021-02-20 |
| 24 | 202141007213-DRAWINGS [20-02-2021(online)].pdf | 2021-02-20 |
| 24 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI [02-03-2021(online)].pdf | 2021-03-02 |
| 25 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI [20-02-2021(online)].pdf | 2021-02-20 |
| 25 | 202141007213-FORM 18A [02-03-2021(online)].pdf | 2021-03-02 |
| 25 | 202141007213-CLAIMS [26-10-2021(online)].pdf | 2021-10-26 |
| 25 | 202141007213-COMPLETE SPECIFICATION [20-02-2021(online)].pdf | 2021-02-20 |
| 25 | 202141007213-DRAWINGS [20-02-2021(online)].pdf | 2021-02-20 |
| 26 | 202141007213-DECLARATION OF INVENTORSHIP (FORM 5) [20-02-2021(online)].pdf | 2021-02-20 |
| 26 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI [20-02-2021(online)].pdf | 2021-02-20 |
| 26 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [20-02-2021(online)].pdf | 2021-02-20 |
| 26 | 202141007213-FORM FOR STARTUP [02-03-2021(online)].pdf | 2021-03-02 |
| 26 | 202141007213-US(14)-HearingNotice-(HearingDate-18-02-2022).pdf | 2022-01-24 |
| 27 | 202141007213-Correspondence to notify the Controller [15-02-2022(online)].pdf | 2022-02-15 |
| 27 | 202141007213-DRAWINGS [20-02-2021(online)].pdf | 2021-02-20 |
| 27 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [20-02-2021(online)].pdf | 2021-02-20 |
| 27 | 202141007213-FORM 1 [20-02-2021(online)].pdf | 2021-02-20 |
| 27 | 202141007213-FORM28 [02-03-2021(online)].pdf | 2021-03-02 |
| 28 | 202141007213-US(14)-ExtendedHearingNotice-(HearingDate-22-02-2022).pdf | 2022-02-17 |
| 28 | 202141007213-STARTUP [02-03-2021(online)].pdf | 2021-03-02 |
| 28 | 202141007213-FORM FOR SMALL ENTITY(FORM-28) [20-02-2021(online)].pdf | 2021-02-20 |
| 28 | 202141007213-FORM 1 [20-02-2021(online)].pdf | 2021-02-20 |
| 28 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI [20-02-2021(online)].pdf | 2021-02-20 |
| 29 | 202141007213-COMPLETE SPECIFICATION [20-02-2021(online)].pdf | 2021-02-20 |
| 29 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [20-02-2021(online)].pdf | 2021-02-20 |
| 29 | 202141007213-FORM FOR SMALL ENTITY(FORM-28) [20-02-2021(online)].pdf | 2021-02-20 |
| 29 | 202141007213-FORM FOR STARTUP [20-02-2021(online)].pdf | 2021-02-20 |
| 29 | 202141007213-Written submissions and relevant documents [08-03-2022(online)].pdf | 2022-03-08 |
| 30 | 202141007213-DECLARATION OF INVENTORSHIP (FORM 5) [20-02-2021(online)].pdf | 2021-02-20 |
| 30 | 202141007213-FORM 1 [20-02-2021(online)].pdf | 2021-02-20 |
| 30 | 202141007213-FORM FOR STARTUP [20-02-2021(online)].pdf | 2021-02-20 |
| 30 | 202141007213-FORM-9 [20-02-2021(online)].pdf | 2021-02-20 |
| 30 | 202141007213-RELEVANT DOCUMENTS [28-12-2022(online)].pdf | 2022-12-28 |
| 31 | 202141007213-DRAWINGS [20-02-2021(online)].pdf | 2021-02-20 |
| 31 | 202141007213-FORM FOR SMALL ENTITY(FORM-28) [20-02-2021(online)].pdf | 2021-02-20 |
| 31 | 202141007213-FORM-9 [20-02-2021(online)].pdf | 2021-02-20 |
| 31 | 202141007213-POWER OF AUTHORITY [20-02-2021(online)].pdf | 2021-02-20 |
| 31 | 202141007213-RELEVANT DOCUMENTS [28-12-2022(online)]-1.pdf | 2022-12-28 |
| 32 | 202141007213-PROOF OF RIGHT [20-02-2021(online)].pdf | 2021-02-20 |
| 32 | 202141007213-POWER OF AUTHORITY [20-02-2021(online)].pdf | 2021-02-20 |
| 32 | 202141007213-FORM-24 [28-12-2022(online)].pdf | 2022-12-28 |
| 32 | 202141007213-FORM FOR STARTUP [20-02-2021(online)].pdf | 2021-02-20 |
| 32 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI [20-02-2021(online)].pdf | 2021-02-20 |
| 33 | 202141007213-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [20-02-2021(online)].pdf | 2021-02-20 |
| 33 | 202141007213-FORM-24 [28-12-2022(online)]-1.pdf | 2022-12-28 |
| 33 | 202141007213-FORM-9 [20-02-2021(online)].pdf | 2021-02-20 |
| 33 | 202141007213-PROOF OF RIGHT [20-02-2021(online)].pdf | 2021-02-20 |
| 33 | 202141007213-REQUEST FOR EARLY PUBLICATION(FORM-9) [20-02-2021(online)].pdf | 2021-02-20 |
| 34 | 202141007213-Correspondence_SIPP Scheme_16-03-2023.pdf | 2023-03-16 |
| 34 | 202141007213-FORM 1 [20-02-2021(online)].pdf | 2021-02-20 |
| 34 | 202141007213-POWER OF AUTHORITY [20-02-2021(online)].pdf | 2021-02-20 |
| 34 | 202141007213-REQUEST FOR EARLY PUBLICATION(FORM-9) [20-02-2021(online)].pdf | 2021-02-20 |
| 34 | 202141007213-STATEMENT OF UNDERTAKING (FORM 3) [20-02-2021(online)].pdf | 2021-02-20 |
| 35 | 202141007213-FORM FOR SMALL ENTITY(FORM-28) [20-02-2021(online)].pdf | 2021-02-20 |
| 35 | 202141007213-PROOF OF RIGHT [20-02-2021(online)].pdf | 2021-02-20 |
| 35 | 202141007213-ReviewPetition-HearingNotice-(HearingDate-24-12-2024).pdf | 2024-11-21 |
| 35 | 202141007213-STATEMENT OF UNDERTAKING (FORM 3) [20-02-2021(online)].pdf | 2021-02-20 |
| 36 | 202141007213-FORM FOR STARTUP [20-02-2021(online)].pdf | 2021-02-20 |
| 36 | 202141007213-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [21-12-2024(online)].pdf | 2024-12-21 |
| 36 | 202141007213-REQUEST FOR EARLY PUBLICATION(FORM-9) [20-02-2021(online)].pdf | 2021-02-20 |
| 37 | 202141007213-STATEMENT OF UNDERTAKING (FORM 3) [20-02-2021(online)].pdf | 2021-02-20 |
| 37 | 202141007213-ReviewPetition-ExtendedHearingNotice-(HearingDate-30-01-2025)-1200.pdf | 2024-12-30 |
| 37 | 202141007213-FORM-9 [20-02-2021(online)].pdf | 2021-02-20 |
| 38 | 202141007213-Correspondence to notify the Controller [20-01-2025(online)].pdf | 2025-01-20 |
| 38 | 202141007213-POWER OF AUTHORITY [20-02-2021(online)].pdf | 2021-02-20 |
| 39 | 202141007213-Written submissions and relevant documents [14-02-2025(online)].pdf | 2025-02-14 |
| 39 | 202141007213-PROOF OF RIGHT [20-02-2021(online)].pdf | 2021-02-20 |
| 40 | 202141007213-PatentCertificate21-02-2025.pdf | 2025-02-21 |
| 40 | 202141007213-REQUEST FOR EARLY PUBLICATION(FORM-9) [20-02-2021(online)].pdf | 2021-02-20 |
| 41 | 202141007213-IntimationOfGrant21-02-2025.pdf | 2025-02-21 |
| 41 | 202141007213-STATEMENT OF UNDERTAKING (FORM 3) [20-02-2021(online)].pdf | 2021-02-20 |
| 1 | SearchE_04-05-2021.pdf |