The present application relates to a method of producing aspartate Tokina first variant, L- aspartate-derived amino acids or amino acid derivatives using microorganisms, and the microorganisms containing the mutant.
[2]
BACKGROUND
[3]
Corynebacterium ( Corynebacterium sp . ) In the microorganism, in particular Corynebacterium glutamicum ( Corynebacterium glutamicum ) is a Gram-positive microorganism which is widely used in the L- amino acids, and other biologically active substances production. In order to produce the L- amino acid, and other useful materials, and various studies for the efficient production microorganism and fermentation process technology it is being carried out. For example, L- specific target substance approaches, such as to lysine increases the expression of the gene coding for the enzyme involved in biosynthesis or as removing an unnecessary gene in the biosynthesis have been mainly used (Republic of Korea Patent No. 10- No. 0,838,038).
[4]
On the other hand, from L- amino acids L- lysine, L- threonine, L- methionine, L- isoleucine, L- glycine-aspartate (aspartate, Asp or less) aspartate Tokina In Asp with the derived amino acid (aspartokinase, or less , LysC, is used as an aspartyl phosphate (aspartyl phosphate, App or less) generated by EC 2.7.2.4) it is common (Fig. 1). Therefore, to maintain the activity of enzymes used in the biosynthetic pathway to produce the amino acid fermentation by microorganisms in a certain level or higher is necessary, it has been made intensive studies on this.
[5]
In particular, LysC, which acts as the first enzyme of the biosynthesis of the aspartate-derived amino acids are known to be activated is controlled by feedback inhibition on L- lysine and L- threonine (J Mol Biol 2007 Apr 27;. 368 ( 2):. 521-36 Epub 2007 Feb 20). In this application but relating to the feedback inhibition (U.S. Patent No. US 8062869 B, JP 3473042 B) a situation that continued research are still needed for increasing production capacity of the aspartate-derived product.
[6]
Detailed Description of the Invention
SUMMARY
[7]
The inventors have completed the present invention by confirming the improvement of the production when using the novel variants aspartate Tokina L- aspartate-derived amino acids or amino acid derivatives.
[8]
Problem solving means
[9]
One object of the present application is an aspartate Tokina the variants in the amino acid sequence of SEQ ID NO: 1 comprising one or more amino acid substitutions, said amino acid substitution comprises the 377 amino acid substituted by L- lysine or L- methionine, aspartate Tokina to provide the mutant.
[10]
Another object of the present application is to provide a polynucleotide coding for the variant.
[11]
It is another object of the present application is to provide a microorganism of the genus Corynebacterium that contain or produce its activity is a reinforced, aspartate-derived amino acids or L- amino acid derivatives of the aspartate Tokina first variant.
[12]
It is another object of the present application includes the steps of culturing the microorganism in a medium; And to provide a production method of the aspartate-derived amino acids or L- amino acid derivatives, comprising the step of recovering the aspartate-derived amino acids or L- amino acid derivatives from the culture medium or the cultured microorganism.
[13]
It is another object of the present application includes the steps of culturing the microorganism in a medium; Wherein said microorganism or from the cultured medium production serinreul acetyl-homoserine or succinyl Homo; And to provide a method for producing methionine comprising the step of converting the acetyl-homoserine or succinyl homoserine into methionine.
[14]
Effects of the Invention
[15]
Microorganism containing aspartate Tokina first variant according to the present application, and the aspartate-derived amino acids or L- aspartate-derived products without inhibiting growth of a host cell as compared to the wild-type microorganisms comprising LysC polypeptides can be obtained in a high yield.
[16]
Brief Description of the Drawings
[17]
Figure 1 shows the aspartate-derived amino acids and amino acid derivatives biosynthesis of Corynebacterium glutamicum.
[18]
Best Mode for Carrying Out the Invention
[19]
Hereinafter, the present invention will be described in more detail.
[20]
[21]
On the other hand, each of the descriptions and embodiments disclosed in this application may be applied to other embodiments and description of each. That is, any combination of various elements disclosed in the present application within the scope of the invention. In addition, it can not be said to the scope of the invention by the specific description will be described limits.
[22]
In addition, one of ordinary skill in the art may recognize or determine the number of equivalents for the particular embodiments of the invention described in this application using only routine experimentation. In addition, such equivalents are intended to be encompassed by the present invention.
[23]
[24]
One aspect of the present application for achieving the above object, in the amino acid sequence of SEQ ID NO: 1 as asparaginase Tokina the variant comprises one or more amino acid substitutions, said amino acid substitution comprises the 377 amino acid substituted by another amino acid , it aspartate to Tokina providing a first variant. Specifically, an object of the present application is to provide a first variant of the 377th amino acid in the amino acid sequence of SEQ ID NO: 1 replaced by L- lysine L- methionine or aspartate Tokina.
[25]
[26]
Term in this application, the "aspartate Tokina claim (aspartokinase, aspartic kinase)" is an enzyme that catalyzes the phosphorylation of the amino acid aspartate, "aspartate family" 3 kinds of L- methionine, L- lysine and L- threonine it is known to It acts on the first step in the biosynthesis of essential amino acids.
[27]
In this application aspartate Tokina agents, may be used interchangeably with "LysC" or "LysC protein". The LysC proteins can be obtained from the GenBank sequences of the known database NCBI. The LysC proteins Corey four may be tumefaciens in origin LysC, more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ) may be a polypeptide having the amino acid sequence shown as derived from SEQ ID NO: 1, but are not limited to, . Also, LysC in the present application may be a polypeptide consisting of the amino acid sequence having the amino acid sequence, or the 80%, 85%, 90%, 95%, or 97% or more homology or identity of SEQ ID NO: 1. Further, if the amino acid sequence has such homology or identity that represents the effect corresponding to the polypeptide, is included, it is obvious within the scope of the present application the polypeptide is part of the sequence having a deletion, modified, substituted or added in the amino acid sequence.
[28]
In the present application, a method for securing the LysC (aspartokinase) is applicable to a variety of methods well-known in the art. Examples of the method for biological information chemical method in a conventional well the enzyme from the genus Corynebacterium microorganism which is used contains the codon optimized to ensure a high efficiency gene synthesis techniques and based on the bulk dielectric information of a microorganism with the enzyme expressed It can be ensured by using the screening method of the useful enzymes and resources, without being limited thereto.
[29]
[30]
Term in this application, the terms "mutant (variant)" is one or more amino acids are conservative substitutions listed above in (conservative substitution), and / or modified (modification) sequence (the recited sequence) and different one, of the polypeptide function ( It refers to a polypeptide that functions) or characteristics (properties) are maintained. Variant polypeptides differ from the sequence (identified sequence) identified by the number of amino acid substitution, deletion or addition. Such variants may generally be to be identified and modifying the one of the above polypeptide sequences and evaluating the properties of the modified polypeptide. That is, the ability of the variant may or can be increased compared to the original protein (native protein), does not change, or decreases. This variant is generally one of the polypeptide sequences and variants, it may be identified by evaluating the reactivity of the modified polypeptide. Moreover, some variants may comprise an N- terminal leader sequence or makjeon domain (transmembrane domain) and at least one part is removed, such variants. Other variants may include a variant part is removed from the N- and / or C- terminus of the mature protein (mature protein).
[31]
The term "conservative substitution (conservative substitution)" in this application is meant a substitution with another amino acid that has the structural and / or chemical properties similar to the amino acid. The variant may, for conservative substitutions can have more than one instance, while still retaining at least one biological activity. These amino acid substitutions can occur usually based on the similarity in residues in polarity, charge, solubility, hydrophobic, hydrophilic and / or amphiphilic (amphipathic nature). For example, the positively charged (basic) amino acids in an amount includes with Al, lysine, and histidine; Charged (acidic) amino acids are negatively contains glutamic acid, and are Vaart; The aromatic amino acids are hydrophobic amino acids, include phenylalanine, tryptophan and tyrosine are include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine and tryptophan. Typically, conservative substitutions are not adversely or little effect on the activity of the resulting polypeptide or impact.
[32]
In addition, the variant may comprise a deletion or addition of amino acids having a minimal impact on the properties of the polypeptide, and the secondary structure. For example, polypeptide translation may after (post-translationally) signal of the N- terminal protein involved in the previous (transfer) of the protein (or leader) sequence and the conjugate - at the same time (co-translationally) or translation. In addition, the polypeptides can be conjugated with other sequences, or linker determine the polypeptide to be purified, or synthesized.
[33]
For example, aspartate Tokina the variants claimed herein is the genus Corynebacterium ( Corynebacterium sp . Means a variant of the LysC having the amino acid sequence set forth as one derived from a microorganism SEQ ID NO:) and amino acid sequence shown in SEQ ID NO: 1 in may comprise byeonyicheeul comprising at least one amino acid substitution. Specifically, there is a 377 amino acid residues from the N- terminus of the amino acid sequence shown in SEQ ID NO: 1 be a polypeptide comprising the amino acid substituted by another. The "other amino acids" is not limited if the amino acid other than leucine is an L- amino acid 377. Specifically, the exemplary example, the 377th amino acid residue may be substituted with lysine (lysine) or methionine (methionine). L- lysine as an example of a basic amino acid, a basic amino acid may be one of having and L- histidine L- lysine, L- al. L- methionine, is an example of a non-polar amino acids, nonpolar amino acids are L- methionine, L- phenylalanine, L- alanine, L- cysteine, L- glycine, L- isoleucine, L- leucine, L- proline, L- tryptophan, and L - it can be either a valine. However, without being limited thereto.
[34]
Term in this application, the "aspartate Tokina claim variant" is used interchangeably with "mutant aspartate Tokina claim" or "mutant LysC".
[35]
In this variant of the aspartate Tokina has the enhanced features Tokina asparaginase activity compared to the polypeptide having asparaginase activity of the Tokina of SEQ ID NO: 1.
[36]
In addition, even if it is described as "protein comprising the amino acid sequence set forth in a particular SEQ ID number, herein, in case with the peptide and the same or corresponding activity consisting of the amino acid sequence of the SEQ ID NO, some sequences are deleted, modified, substituted that, also proteins having conservative substitutions or added in the amino acid sequence may be used in the present application will be apparent. Specifically, mutations that may result from the amino acid sequences before and after added that do not change the function of the protein sequence, or naturally in its sequence number, conservative substitutions, or not intended to exclude its potential mutants (synonymous mutation), add this sequence or it is apparent that even when having a mutation within the scope of the present application, the term in the present application, "homology (homology)" or "identity (identity)" means the degree to which relative to each other and the two given amino acid sequence or nucleotide sequence and it can be expressed as a percentage. The term "homology" and "identity" can often be used interchangeably.
[37]
A conserved (conserved) polynucleotide or sequence homology or identity of polypeptides can be used with the default gap penalties established by the program that is determined by the standard arrangement algorithm used. In practice, has a homology or (homologous) or the same (identical) sequence is at least about 50% of the general sequence of all or a full-length in the medium or high stringent conditions (stringent conditions), 60%, 70%, 80% or more than 90 percent will be hybrid. The hybridization is also considered a polynucleotide containing a degenerate codons instead of the codons in the polynucleotide.
[38]
Whether any two polynucleotide or polypeptide sequence of the has the homology, similarity or identity include, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: by using the default parameters as in 2444 may be determined using known computer algorithms such as the "FASTA" program. Alternatively, only the needles of the EMBOSS package programs carried out in (EMBOSS: 276-277: The European Molecular Biology Open Software Suite, Rice et al, 2000, Trends Genet 16..) (Preferably version 5.0.0 or later) , the needle only as is-flavor (Needleman-Wunsch) algorithm (.. Needleman and Wunsch, 1970, J. Mol Biol 48: 443-453) can be determined is used. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED,.] Academic Press, San Diego, 1994, and [CARILLO ETA /.] (1988) SIAM J Applied Math 48: 1073 contains) for example, you can use the BLAST, ClustalW or the National Center for Biotechnology information database to determine the homology, similarity or identity.
[39]
Polynucleotides or polypeptides of homology, similarity or identity, e.g., Smith and Waterman, Adv. Appl. Math (1981) 2: 482, as is known in, e.g., Needleman et al. (1970), J Mol Biol.48: can be determined by using the GAP computer program, such as 443 compares the sequence information. In summary, GAP program defines a value obtained by dividing the total number of symbols in the shorter of the two sequences from the number, the arrangement similar to sign (i.e., nucleotides or amino acids). The default parameters for the GAP program include: (1) one binary comparison matrix (1 and ratio to the identity-by containing a value of 0 for identity) and Schwartz and Dayhoff, eds, Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: the weighted comparison matrix of 6745 (or the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) addition of 0.10 penalty for each symbol in each gap, and the penalty of 3.0 for each gap (or gap opening penalty 10, gap extension penalty 0.5); And (3) may include no penalty for end gaps. Thus, as used herein, the term "homology" or "identity" refers to an association (relevance) between the sequences.
[40]
[41]
Another aspect of the present application provides a polynucleotide coding for the variant the aspartate Tokina.
[42]
For the "aspartate Tokina claim variant" as described above.
[43]
Term in this application, the terms "polynucleotide" is a nucleotide units (monomer) is a polymer (polymer) DNA or RNA strands over a predetermined length to the nucleotide long resulted in a chain shape by a covalent bond, specifically to the variant polypeptide than It means a polynucleotide fragment encoding.
[44]
The aspartate polynucleotide Tokina coding for the variant, in the amino acid sequence of SEQ ID NO: 1 as asparaginase Tokina the variant comprises at least one amino acid substitution, wherein the amino acid substitution is a polyester, comprising the 377th amino acid residue substituted by another amino acid It may be a polynucleotide encoding the peptide. Specifically, the representative may be, for example, in the amino acid sequence of SEQ ID NO: 1 has 377 amino acid residues polynucleotide encoding the polypeptide substituted with another or L- lysine L- methionine. More specifically, the polynucleotide may be a polynucleotide coding for lysC protein having an amino acid sequence consisting of SEQ ID NO: 3 or SEQ ID NO: 5. For example, it may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 6. The polynucleotides due to the degeneracy (degeneracy) of the codon in consideration of the codon-preferred organisms intended to express the protein, various changes in the coding region within a range that does not alter the amino acid sequence of the protein expressed from the coding region this can be done. therefore,
[45]
[46]
That codon degeneracy (codon degeneracy) to be translated into the polypeptide or the homologous or a polypeptide having an identity of the amino acid sequence consisting of the SEQ ID NO: 3 or SEQ ID NO: 5 polynucleotide can also be included by which it is apparent. Or a probe (probe) that can be prepared from the gene sequences of the known, e.g., by Hydride Chemistry under the complementary sequences and stringent conditions to all or a portion of the poly New Creo suited sequence, consisting of the amino acid sequence of SEQ ID NO: 1 If the sequence coding for a protein having the activity of a protein can be included without limitation.
[47]
Refers to conditions that permit the specific hybridization between the "stringent condition" is a polynucleotide. These conditions are described in detail in the literature (e.g., J. Sambrook et al., Above). For example, homology or identity with the high genetic each other, at least 80%, at least 85%, specifically, more specifically more than 90%, more than 95%, more specifically more than 97%, in particular specifically 99% or more homology or hybrid having the identity gene between shoes, rather homologous or conditions that do not flower identity hybrid between low gene, or a 60 ℃ ordinary washing condition of Southern hybridization, 1 X SSC, 0.1% SDS, and specifically at a salt concentration and temperature corresponding to the is 60 ℃, 0.1 X SSC, 0.1% SDS, more specifically, 68 ℃, 0.1 X SSC, 0.1% SDS, 1 times, specifically, the conditions of washing twice or three times the it can be enumerated.
[48]
[49]
Hybridization Although the mismatch (mismatch) between the base be possible depending on the stringency of hybridization, though, requires that the two nucleic acids having a complementary sequence. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, this application can also, as well as similar to the nucleic acid sequence substantially complementary to an isolated nucleic acid fragment comprising the sequence throughout.
[50]
Specifically, a polynucleotide having a homology or identity can be detected using hybridization conditions comprising a hybridization step at Tm value of 55 ℃ using the above-described conditions. Further, the Tm value can be 60 ℃, 63 ℃ or 65 ℃. However, it is not limited to, it can be properly adjusted by those skilled in the art according to the purpose.
[51]
Appropriate stringency for hybridizing polynucleotide is dependent on the degree of complementarity and the length of the polynucleotide and variables are well known in the art (see Sambrook et al., Supra, 9.50-9.51, 11.7-11.8).
[52]
[53]
As one more aspect of the present application, the present application also provides a transformed microorganism with a vector comprising a host cell and a polynucleotide coding for the aspartate Tokina the variant containing the aspartate Tokina first variant. More specifically, the present application provides a microorganism of the genus Corynebacterium that produces, L- aspartate-derived amino acid or amino acid derivative containing the aspartate Tokina first variant.
[54]
Microorganism containing aspartate Tokina first variant of the present application has an activity of aspartate Tokina enhanced characteristics as compared to wild-type or non-modified microorganism.
[55]
[56]
Term in this application, the terms "enhanced activity" is introduced, the activity of the protein or, means that the activity compared to the endogenous activity or modified before activation with the microorganism improved. "Introducing" in the activity, means that displayed the activity of natural or artificial specific protein microorganisms did not have the original. "Intrinsic activity" is, if the transformation of microorganisms changes in genetic variation due to natural or anthropogenic factors, says the changes before transfection activity of the parent strain specific protein that is inherent.
[57]
The term "vector" as used in this application refers to a DNA preparation containing the nucleotide sequence of the polynucleotide encoding the desired protein operably linked to suitable control sequences so as to express the desired protein in a suitable host. The control sequences may include any operator sequence, sequences that control the termination of the sequence, and a transcription and translation encoding a suitable mRNA ribosome-binding site for regulating the promoter, such that transcription can initiate transcription. Vector may then be transformed into a suitable host cell, replicate independently of the host genome, or functions, it may be integrated into the genome itself.
[58]
Vector used in the present application as long as it can express in a host cell is not particularly limited, it is possible to use any vector known in the art. Examples of the normal vector to be used may be a naturally occurring or recombinant plasmid of the state, cosmid, virus and bacteriophage. For example, the phage vector or course as mid vector may be used. PWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, etc. Charon4A, and Charon21A, pBR series, pUC system, pBluescriptII system as plasmid vector It may be used based pGEM, pTZ-based, such as pCL and pET-based system. More specifically, but you can use the pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector such as, but not limited thereto.
[59]
The available vector herein is not particularly limited and may be a known expression vector. In addition, through the cell in a vector for chromosomal insertion it is possible to insert a polynucleotide encoding a protein of interest in the chromosome. Insertion into the chromosome of the above polynucleotides is any method known in the art, for example, but may be made by homologous recombination, but is not limited to this. It may further comprise a selectable marker (selection marker) to determine the chromosomal insertion. Selectable marker is designed to determine whether the insertion of the transformant screening the transformed cells with a vector, that is, the target nucleic acid molecule, drug resistance, nutritional requirement, given the selectable phenotype such as expression of the resistance or the surface protein on cytotoxic agent markers that can be used. Since the selective agent in a process environment (selective agent) survive only cells expressing a selectable marker, or reflect a different phenotype, it may be selected for transformed cells.
[60]
[61]
The term "transgenic" in this application is meant to allow the protein to the polynucleotide encoding the expression by introducing a vector comprising a polynucleotide encoding the target protein in the host cell in a host cell. If the transformed polynucleotide can be as long as expression in a host cell, is inserted in the chromosome of the host cell may be located, or include both of these positions in addition to the chromosome, or no matter what. In addition, the polynucleotides include DNA and RNA encoding the target protein. The polynucleotide so long as it can be expressed is introduced into a host cell, it does not matter whether it is to be introduced in any form. For example, the polynucleotide may be introduced into a host cell in the form of there is expressed by itself in an expression cassette (cassette expression) gene construct containing all the elements required. The expression cassette may include a promoter that is normally operably linked to the polynucleotide (promoter), a transcription termination signal, ribosome binding site and translation termination signal. The expression cassette may be an expression vector form a self-replicable. In addition, the polynucleotide is introduced into a host cell in the form of itself, and may be, which is possibly connected with the operation sequence necessary for the expression in a host cell, and the like. How to transform the above it can be carried out, and includes any method of introducing the nucleic acid into a cell, by selecting suitable standard techniques as known in the art depending on the host cell. For example, electroporation method (electroporation), calcium phosphate (CaPO 4) Precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection (microinjection), polyethylene glycol (PEG) method, but the like DEAE- dextran method, cationic liposome method, and a lithium acetate method -DMSO, but is not limited thereto.
[62]
In addition, this term means that at the "operably linked to" the promoter sequence and the expectation that the target protein of the present application to initiate and mediate the transcription of a polynucleotide encoding the polynucleotide sequences are functionally connected. Operative connection can be produced using known genetic recombination techniques in the art, site-specific DNA cleavage and connections, but can be manufactured using, for example, cutting and ligase in the art, not limited to this.
[63]
[64]
Term in this application, the "aspartate derived microorganism producing L- amino acids or amino acid derivatives" refers to microorganisms that naturally has the L- aspartate-derived amino acid or amino acid derivative-producing ability of the L- or aspartate-derived amino acids or amino acid derivatives aspartate derived from a parent strain means a microorganism not producing capability given production capability of L- amino acids or amino acid derivatives.
[65]
[66]
Term in this application, the "L- aspartate-derived amino acid or amino acid derivative, is aspartate means that can be biosynthesized by the material (Aspartic acid) as a precursor, and may be used interchangeably with 'aspartate-derived product. The "amino acid derivative" is intended to include a precursor of the substance or L- amino acid that can be produced from L- amino acids, if the material which can be produced by biosynthesis gwajeongreul to the aspartate in the precursor is not limited. Than is included without specifically, the material to be synthesized using acetyl phosphate as a common limit. For example, L- lysine, L- threonine, L- methionine, L- glycine, homoserine, O- acetyl homoserine, O- succinyl-homoserine, O- phospho-homoserine, L- isoleucine, and It may be a cadaverine, but not limited thereto.
[67]
Cadaverine may be biosynthesized directly to the aspartate as a precursor, it may be produced from lysine by lysine decarboxylase. The L- methionine biosynthesis may be directly to the aspartate in the precursor, it is converted from O- acetyl homoserine, O- succinyl homoserine may be generated.
[68]
The term "aspartate (Aspartic acid) in this application will be referred to as Asp or D, to aspartic acid, the α- amino acid used in the biosynthesis of proteins., As with all the other amino acid contains amino groups and the carboxylic acid. In general, aspartate is the back generated by the aspartyl phosphate (phosphate aspartyl) by aspartate Tokina claim (LysC), L- lysine in the body, L- methionine, L- homoserine, L- threonine, L- isoleucine, etc. It may be converted.
[69]
In order to enhance the biosynthesis of the aspartate-derived products, it is possible to use the aspartate Tokina variants of the present application. For example, L- lysine, L- threonine, L- methionine, L- glycine, homoserine, O- acetyl homoserine, O- succinyl-homoserine, O- phospho-homoserine, L- isoleucine and cadaverine introducing Tokina aspartate variant of the present application in order to enhance the biosynthesis of suberic or can enhance its activity. In addition, further, it is possible to introduce or enhance the activity of the particular protein, or the production capacity of the aspartate-derived product further improved by inactivating the activity of a particular protein.
[70]
Method for introducing the activity of the particular protein, enhance, inactivation can be performed using a suitable method known in the art, depending on the characteristics with the microorganism.
[71]
[72]
Microorganism producing the aspartate-derived product, L- amino acids or amino acid derivatives are available if all micro-organisms that can produce the aspartate-derived "amino acid, or amino acid derivatives, including aspartate variant of the present application. Specifically, for example, Escherichia ( Escherichia ) genus, Serratia marcescens ( Serratia ), An air Winiah ( Erwinia ) genus, Enterobacter bacteria ( Enterobacteria ) genus, Salmonella ( Salmonella ) genus Streptomyces ( Streptomyces ) genus Pseudomonas ( Pseudomonas ) genus Brevibacterium ( Brevibacterium ) in or Corynebacterium ( Corynebacterium may include a microbial strain, such as) in. It may be specifically the genus Corynebacterium microorganism, more specific examples include Corynebacterium glutamicum ( Corynebacterium glutamicum may be a) is not limited to this.
[73]
[74]
As one more aspect of the present application, the present application includes the steps of culturing the microorganism described and cultured microorganism or from the culture medium comprising the step of recovering the aspartate-derived amino acids or L- amino acid derivatives, aspartate-derived amino acid L- or it provides a method for producing amino acid derivatives.
[75]
A method of producing the aspartate-derived amino acids or L- amino acid derivatives can be readily determined by one skilled in the art from the optimized culture conditions, and the enzymatic activity conditions known in the art. Specifically, the step of culturing the microorganism, can be not specifically limited, known batch culture method, the continuous culture method, performed by a fed-batch culture method. At this time, the culture conditions, particularly for but not limited to, a basic compound to an appropriate pH using: (phosphoric acid or sulfuric acid for example) (for example, pH 5 to 9, in particular (for example, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound may be adjusted to pH 6 to 8, most specifically at pH 6.8), oxygen or oxygen-containing gas mixture is introduced to the culture to maintain the aerobic conditions. The culture temperature is 20 to 45 ℃, specifically, can be maintained for 25 to 40 ℃, but can be cultured for about 10 to 160 hours, without being limited thereto. The aspartate-derived amino acids or amino acid derivatives produced by the above culture may be secreted into the culture medium or remains in the cell.
[76]
In addition, the medium for the culture to be used per a carbon source and a carbohydrate (such as glucose, sucrose trehalose, lactose, fructose, maltose, know three, starch and cellulose), maintenance, and fat (such as soybean oil, sunflower seed oil, peanut oil and coconut oil), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (for example, glycerol and ethanol) and organic acids (e.g. acetic acid) can be used by using individually or mixed, such as, but , but it is not limited thereto. The nitrogen source may include nitrogen-containing organic compounds (e.g., peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean bakbun and urea), or inorganic compounds (e.g., ammonium ammonium ammonium sulfate, chloride, phosphate, ammonium carbonate and ammonium nitrate), but it can be used by using individually or mixed, such as, but not limited thereto. Although the source of the phosphate can be individually used, or a mixture of monobasic potassium phosphate, potassium susoyi, such as the corresponding sodium-containing salts to, but is not limited thereto. In addition, the culture medium and other metal salts (such as magnesium sulfate or iron sulfate), essential amino acids, and growth, such as vitamins can include a promoting material.
[77]
The method for recovering the aspartate-derived amino acids or amino acid derivatives produced by the culturing step of the present application can be by using a suitable method known in the art according to the culture method to collect the desired amino acid from the culture broth. For example, this can be used centrifugation, filtration, anion exchange chromatography, crystallization and HPLC, etc., and can reclaim the aspartate-derived amino acids or amino acid derivatives of interest from the medium or the microorganism by using the appropriate method known in the art have.
[78]
In addition, the recovery step may include a further purification step, may be performed using a suitable method known in the art.
[79]
[80]
As one more aspect of the present application, the present application includes the steps of culturing the microorganism technology; Step to produce O- acetyl-homoserine or O- succinyl-homoserine from the cultured microorganism or the culture medium; And O- acetyl-homoserine or O- succinyl comprising the step of switching the homoserine as L- methionine, there is provided a method for producing L- methionine.
[81]
More specifically, the step of conversion to L- methionine, is said O- acetyl-homoserine or O- succinyl homoserine and O- acetyl homoserine kinase deurilra sulfinyl or O- succinyl-homoserine in the presence of the sulfinyl deurilra azepin sulfide reaction It may comprise. The "O- acetyl-homoserine or O- succinyl homoserine" is, or containing O- acetyl-homoserine or O- succinyl-homoserine by the microorganism described in this application produce a fermentation broth, it can be a tablet form . In addition, the above "sulfide" may contain tanil mercapto methyl example, the methyl mercaptan are as sodium methyl mercaptan (sodium methyl mercaptan, CH3S-Na) methylmercaptan (CH3SH) in the form of a gas or liquid state liquid rather may refer to both the International Patent Publication No. WO2010 / 098629 in the form referred to in paragraph D of methyl sulfide (DMS, Dimethylsulfide), methyl mercaptan, methyl Murray, which contains the type that can provide a sulfur atom mercaptan derivatives including . In addition, the 'O- acetyl homoserine kinase deurilra sulfinyl or O- succinyl homoserine kinase deurilra sulfinyl "may be a fermentation broth of a microorganism producing it, can be a tablet form.
[82]
A method of producing the L- methionine can be readily determined by one skilled in the art from the optimized culture conditions, and the enzymatic activity conditions known in the art. Specific culture method and culture medium are as described above.
[83]
Mode for the Invention
[84]
It is described in more detail by the following Examples in the present application. However, these examples are for explaining the present application by way of example, not intended to limit the scope of the present application to these examples.
[85]
[86]
Example 1. Example 1: lysC mutation introduced strain produced
[87]
[88]
Were screened for variation in the activity can be enhanced than the wild type with the structure model of the protein aspartate Tokina, it was produced by introducing the mutant strain as follows.
[89]
Corynebacterium glutamicum ATCC13032 (hereinafter WT) coding for aspartate Tokina the (SEQ ID NO: 1) derived from the lysC was selected for the 377th amino acid to target the gene (SEQ ID NO: 2) in variations positions, other amino acids for substitution representative examples of, and selection of a basic amino acid of L- lysine and a non-polar amino acid of L- methionine.
[90]
Said transition 5 around the mutation site to produce introduced vector 'primer one pairs for amplifying a top portion (SEQ ID NO: 7 and 8 or SEQ ID NO: 7 and 10) and 3' primer one pairs for amplifying a bottom region (SEQ ID NO: 9 and 12 or SEQ ID NO: 11 and 12) were designed (Table 1). SEQ ID NO: 7 and a primer of 12 was inserted into the (underlined) XbaⅠ restriction sites at each end, SEQ ID NO: 8 and 9 Primer one pairs or SEQ ID NOS: 10 and 11 of the primer one pairs of the nucleotide at a designed area to intersect each other, the substitution mutation (underlined) was positioned.
[91]
[92]
TABLE 1
SEQ ID NO: primer Sequence (5'-3 ')
7 Primer 1 tcctctagaGCTGCGCAGTGTTGAATACG
8 Primer 2 TGGAAATCttTTCGATGTTCACGTTGACAT
9 Primer 3 ACATCGAAaaGATTTCCACCTCTGAGATTC
10 Primer 4 TGGAAATCATTTCGATGTTCACGTTGACAT
11 Primer 5 ACATCGAAATGATTTCCACCTCTGAGATTC
12 Primer 6 gactctagaGTTCACCTCAGAGACGATTA
[93]
To the chromosome of WT as a template and SEQ ID NO: 7 SEQ ID NO: 8 or SEQ ID NO: 7 and SEQ ID NO: 10 was performed, PCR using primers of SEQ ID NO: 9 and SEQ ID NO: 12 or SEQ ID NO: 11 and SEQ ID NO: 12. On the 95 ℃ 5 bungan denaturation, 95 ℃ 30 seconds denaturation, annealing 55 ℃ 30 seconds, 30 seconds was repeated 72 ℃ polymerization 30 times, was carried out 7 minutes polymerization at 72 ℃. As a result lysC to give the 5 'region of the top of the 509 bp DNA fragment and the 3' 520 bp of a DNA fragment of the bottom portion around the mutation of the gene, respectively.
[94]
To the DNA fragments of the two amplified as the template, PCR was performed with primers of SEQ ID NO: 7 and SEQ ID NO: 12. In 95 ℃ 5 minutes after denaturation, 95 ℃ 30 cho denaturation, 55 ℃ 30 cho annealing, 60 seconds was repeated 72 ℃ polymerization 30 times, was carried out 7 minutes polymerization at 72 ℃. As a result, the 377th leucine is an asparaginase Tokina the mutant (SEQ ID NO: 3) encoding a substitution with lysine lysC the variation of the 1011 bp DNA fragment containing the (SEQ ID NO: 4) of the gene was amplified. In addition, 377 In order to confirm the importance of the amino acid position, the 377th leucine this variant the aspartate Tokina substituted with methionine claim (SEQ ID NO: 5) encoding lysC mutation of a gene (SEQ ID NO: 6) of 1011 bp containing the DNA fragment of the title compound.
[95]
Corynebacterium glutamicum pDZ vector replication can not be in the after (Korea Patent Registration No. 0924065 No.) and processes the 1011 bp DNA fragment with restriction enzymes XbaⅠ, after connecting with a DNA joining enzymes, cloned by plasmid was obtained for this pDZ- lysC (L377K) and pDZ- lysC was named (L377M).
[96]
pDZ- lysC (L377K) and pDZ-lysC (L377M) electric pulse method the vector for each WT: After introduction of the (Appl Microbiol Biothcenol (1999) 52 ... 541-545) kanamycin (kanamycin) containing 25mg / L to obtain a transformant strain in the LB medium. Secondary recombination (cross-over) to by the DNA fragment inserted into the chromosomal lysC nucleotide mutation-introduced gene strains, WT :: lysC (L377K) and WT :: lysC was obtained a (L377M), it Corey Corynebacterium glutamicum as CA01-2307 and CA01-2308 were each named. Among CA01-2307 CA01-2308 and have been given an accession number and KCCM12000P KCCM12001P accession to the three international deposition firm Conservation Center Korea microorganisms under the Budapest Treaty with the date May 29 (KCCM) 2017.
[97]
[98]
Example 2. lysC mutation aspartate-derived amino acid-producing ability confirmation of the introduced strain
[99]
[100]
A CA01-2307 and CA01-2308 strains and aspartate-derived amino acid producing key to compare the ability to culture the culture medium components in the following way in the WT strain obtained in the above Example was analyzed.
[101]
250 ㎖ species containing medium 25 ㎖ corner - for each strain in the bapeul flask and inoculated, 37 ℃ for 20 hours, then this was cultured with shaking in 200 rpm. 250 ㎖ corner containing a production medium 24 ㎖ - from seed culture inoculated into the flask and 1 ㎖ in bapeul 37 ℃ for 24 hours, then this was cultured with shaking at 200 rpm. By HPLC was analyzed L- aspartate, aspartate-derived amino acids representative of L- lysine and L- threonine concentration, the concentration analysis is shown in Table 2.
[102]
[103]

[104]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 7H 2 O 0.5 g, biotin 100 ㎍, thiamine HCl 1000 ㎍, calcium- 2000 ㎍ pantothenate, nicotinamide 2000 ㎍ (in 1 liter of distilled water)
[105]
[106]

[107]
Glucose 100 g, (NH 4 ) 2 SO 4 40 g, soy protein 2.5 g, corn steep solids (Corn Steep Solids) 5 g, urea 3 g, KH 2 PO 4 1 g, MgSO 4 · 7H 2 O 0.5 g, 100 ㎍ biotin, thiamine hydrochloride 1000 ㎍, calcium pantothenate 2000 ㎍, nicotinamide ㎍ 3000, CaCO 3 30 g (per liter of distilled water).
[108]
[109]
[Table 2] CA01-2307 and CA01-2308 aspartate-derived amino acid-producing strains of the concentration
Strain / concentration L- aspartate (mg / L) L- lysine (mg / L) L- threonine (mg / L)
WT 20.3 8.0 340.3
CA01-2307 29.7 3647.7 402.7
CA01-2308 30.2 1572.3 385.4
[110]
Aspartate-derived amino acid concentration analysis, lysC compared with when introducing mutations WT particularly L- lysine concentration increased sharply and it was confirmed that the pattern is L- aspartate and L- threonine concentration. To compare based on the lysine-producing ability of strains CA01-2307 and CA01-2308 and WT strains Details of the results were cultured in the same manner as described above, were analyzed L- lysine concentration in the culture medium in the same manner as in Table 3 .
[111]
[112]
Table 3 concentration of the lysine-producing strain WT and CA01-2307 and CA01-2308
Strain / concentration L- lysine (g / L)
Placed one Placed second Placed third
WT 0.008 0.007 0.008
CA01-2307 3.664 3.665 3.598
CA01-2308 1.523 1.475 1.666
[113]
L- lysine concentration analysis, the same strain compared to WT with the existing evaluation lysC was found that L- lysine-producing ability greatly increases the CA01-2307 containing (L377K) mutation. Also lysC was found that L- lysine-producing ability also increased compared to WT strains CA01-2308 containing (L377M) mutation. By the 377th leucine this variant the aspartate Tokina substituted with lysine first screening in the present application on the basis of the result of (SEQ ID NO: 3) and the 377th leucine this variant the aspartate Tokina substituted with methionine claim (SEQ ID NO: 5) aspartate It confirmed that the greatly increased capability of producing L- lysine-derived amino acids.
[114]
[115]
Example 3. L- threonine production strains and strengthen L- threonine production capacity OK
[116]
[117]
Confirmed from the results of Example 2, than with a higher lysine-producing ability lysC used by L- (L377K) mutagenic Leo Nin to clearly determine the production capability change, L- threonine, L- isoleucine, L - the methionine and homoserine-di-homoserine dehydrogenase (dehydrogenase homoserin) to produce a common intermediate, homoserine (homoserine) derivative of biosynthetic pathways were introduced mutations in the gene encoding. Specifically, in Example 1 based on the CA01-2307 strains produced in known hom (G378E) mutation ( Appl . Microbiol . Biotechnol.　45, 612-620 (1996)) was produced in the strain introduced. In addition, the WT as its control hom was prepared FIG strain (G378E) mutation was introduced. hom (G378E) defend the sequence WT genomic DNA as a template to produce a vector for introducing a 13 and 14, was carried out the PCR using 15, and 16. PCR conditions were carried out for 5 min denaturation at 95 ℃, 95 ℃ was repeated 30 seconds denaturation, annealing 55 ℃ 30 seconds, 30 seconds 72 ℃ polymerization 30 times, in 72 ℃ polymerization 7 minutes of reaction.
[118]
As a result hom around the mutation of the gene to give the '220 bp DNA fragment and a 3 in the upper portion' of the 220 bp DNA fragment of the bottom part 5. The two PCR product was performed by PCR using SEQ ID NO: 13 and 16 as the template. On the 95 ℃ 5 bungan denaturation, 95 ℃ 30 seconds denaturation, annealing 55 ℃ 30 seconds, 30 seconds was repeated 72 ℃ polymerization 30 times, was carried out 7 minutes polymerization at 72 ℃. As a result, hom of the 440 bp DNA fragment containing the mutation of the gene was amplified.
[119]
[120]
TABLE 4
SEQ ID NO: primer Sequence (5'-3 ')
13 Primer 7 tcctctagaCTGGTCGCCTGATGTTCTAC
14 Primer 8 GCCAAAACCtCCACGCGATC
15 Primer 9 ATCGCGTGGaGGTTTTGGCT
16 Primer 10 gactctagaTTAGTCCCTTTCGAGGCGGA
[121]
After previously treating the pDZ vector and the 440 bp DNA fragment used in Example 1 with restriction enzymes XbaⅠ, after connecting with a DNA junction enzyme, it was obtained by a plasmid cloned pDZ- hom La (G378E) was named .
[122]
pDZ- hom (G378E), electric pulse method, and the vector in WT strains CA01-2307 (Appl Microbiol Biothcenol (1999, 52 :... a selection medium containing the introduced 541-545) after kanamycin (kanamycin) 25mg / L transformants were obtained from the conversion strain secondary recombination (cross-over) to by the DNA fragment inserted into the chromosome hom with a mutagenic oligonucleotide to genetic strains, WT :: hom (G378E) and CA01-2307 :: hom was obtained (G378E). obtained a WT :: hom (G378E) and CA01-2307 :: hom (G378E) threonine was cultured in the same manner as in example 2 to compare the production capacity of, used in the culture medium Leo we analyzed the non-concentration.
[123]
[124]
Table 5 used in the WT :: hom (G378E) and CA01-2307 :: hom (G378E) strains produced non-Leo concentration
Strain / concentration L- threonine (g / L)
Placed one Placed second Placed third
WT::hom(G378E) 0.456 0.475 0.432
Chha0l-2307 :: Home (G378a) 1.210 1.132 1.211
[125]
L- threonine concentration analysis, lysC was confirmed that the L- threonine production dramatically increased ability in strains containing the mutations Table 5.
[126]
[127]
Example 4. L- isoleucine L- isoleucine producing ability and enhanced strains making comparison
[128]
[129]
lysC (L377K) mutant group known to determine the effect of neunge L- isoleucine produced by introducing threonine di Hydra hydratase (L-threonine dehydratase) gene coding for ILVA (V323A) mutation ( Appl . Enviro . Microbiol . , Dec. 1996, p.4345-4351) was produced in the vector to enhance expression.
[130]
ilvA 5 around the mutation site to produce a mutation introduction vector with the target genes 'primer one pairs for amplifying a top portion (SEQ ID NO: 17 and 18) and 3' primer one pairs for amplifying a bottom region (SEQ ID NO: 19 and 20) it was designed for. SEQ ID NO: 17 and 20 primers were insert (underlined) BamHⅠ restriction sites at each end, SEQ ID NO: 18 and a primer of 19 nucleotides in the intended area to be cross with each other (underlined) substitution mutations are to be located in the It was.
[131]
[132]
TABLE 6
SEQ ID NO: primer Sequence (5'-3 ')
17 Primer 11 AC GGATCC CAGACTCCAAAGCAAAAGCG
18 Primer 12 ACACCACG g CAGAACCAGGTGCAAAGGACA
19 Primer 13 CTGGTTCTGcCGTGGTGTGCATCATCTCTG
20 Primer 14 ACGGATCCAACCAAACTTGCTCACACTC
[133]
To the chromosome of WT as a template and SEQ ID NO: 17 SEQ ID NO: 18, PCR was performed using primers of SEQ ID NO: 19 and SEQ ID NO: 20. PCR conditions were carried out for 5 min denaturation at 95 ℃, 95 ℃ was repeated 30 seconds denaturation, annealing 55 ℃ 30 seconds, 30 seconds 72 ℃ polymerization 30 times, in 72 ℃ polymerization 7 minutes of reaction. As a result ilvA around the mutation of the gene to give the '627 bp DNA fragment and a 3 in the upper portion' of the 608 bp DNA fragment of the bottom part 5.
[134]
To the DNA fragments of the two amplified as the template, PCR was performed with primers of SEQ ID NO: 17 and SEQ ID NO: 20. In 95 ℃ 5 minutes after denaturation, 95 ℃ 30 cho denaturation, 55 ℃ 30 cho annealing, 60 seconds was repeated 72 ℃ polymerization 30 times, was carried out 7 minutes polymerization at 72 ℃. As a result, the 323rd valine encoding the variant IlvA substituted with alanine ilvA of the 1217 bp DNA fragment containing the mutation of the gene was amplified.
[135]
pECCG117 (Republic of Korea Patent No. 10-0057684 No.) processes the vector and the 1011 bp DNA fragment with restriction enzymes BamHⅠ and, after the connection is established using DNA junction enzyme, was obtained by cloning the plasmid it pECCG117- ilvA La (V323A) It was named.
[136]
pECCG117- ilvA (V323A) produced the vector in Example 3 :: WT hom (G378E) and CA01-2307 :: hom (G378E) after a strain introduced by the electric pulse method in containing kanamycin (kanamycin) 25mg / L transformants were obtained by the conversion main plated on selective medium.
[137]
Example 2 and cultured in the same manner as shown in the flask culture were analyzed L- isoleucine concentration in the culture medium [Table 7].
[138]
[139]
Table 7
Strain L- isoleucine (g / L)
Placed one Placed second Placed third
WT::hom(G378E)/ pECCG117-ilvA(V323A) 0.102 0.072 0.062
:: CA01-2307 Hom (G378E) / PECCG117- IlvA (V323A) 0.876 0.900 0.918
[140]
L- isoleucine concentration analysis, lysC in strains containing the mutation was confirmed that the significant increase in production capability L- isoleucine.
[141]
[142]
Example 5: O- acetyl-homoserine and enhance the strain produced O- acetyl-homoserine -producing ability compared
[143]
lysC (L377K) O- acetyl-mutagenic by-homo-O- acetylation to determine the effect on the production of serine-homoserine degradation pathways cis tachioh non-gamma-encoding the synthase metB gene and O- acetyl-homoserine (thiol), - encoding the first rayiah metY encoding a dehydratase line-homoserine O- acetyltransferase homoserine biosynthesis enzyme-deficient genes and O- acetyl metX to express the gene and O- acetyl-homoserine-producing strain prepared It was. First metB of WT derived to defect genes metB based on the nucleotide sequence information of the gene metB 5 of the gene, primers for amplifying the top part one pairs (SEQ ID NO: 21 and 22) and 3 'primer for amplifying a bottom portion one pairs was designed (SEQ ID NO: 23 and 24).
[144]
[145]
Table 8
SEQ ID NO: primer Sequence (5'-3 ')
21 Primer 15 TCTAGATGCGCTGATTATCTCACC
22 Primer 16 ACTGGTGGGTCATGGTTGCATATGAGATCAACTCCTGTAA
23 Primer 17 TTACAGGAGTTGATCTCATATGCAACCATGACCCACCAGT
24 Primer 18 TCTAGACCTTGAAGTTCTTGACTG
[146]
To the chromosome of WT as a template and SEQ ID NO: 21 SEQ ID NO: 22, PCR was performed using primers of SEQ ID NO: 23, and SEQ ID NO: 24. In 95 ℃ 5 minutes after denaturation, 95 ℃ 30 cho denaturation, annealing 55 ℃ cho 30, 72 ℃ After repeating 90 seconds to polymerization 30 times, was carried out 7 minutes polymerization at 72 ℃. As a result metB to give a 450 bp DNA fragment and 3 467 bp DNA fragment of the "lower end portion of the 5` top portion of the gene.
[147]
To the DNA fragments of the two amplified as the template, PCR was performed with primers of SEQ ID NO: 21 and SEQ ID NO: 24. In 95 ℃ 5 minutes after denaturation, 95 ℃ 30 cho denaturation, annealing 55 ℃ 30 cho, was repeated 30 times for 3 minutes 72 ℃ polymerization was carried out for 7 minutes polymerization at 72 ℃. As a result, metB the central portion of the gene defect has been amplified, the 917 bp DNA fragment containing only the top and bottom.
[148]
After processing the pDZ vector and the 917 bp DNA fragment with restriction enzymes XbaⅠ, after connecting with a DNA junction enzyme, was obtained by a plasmid cloned pDZ- △ metB was named.
[149]
pDZ- △ metB the WT :: vector produced in Example 3 hom (G378E) and CA01-2307 :: hom (G378E) after the strain introduced into the electric pulse method in a selection medium containing kanamycin (kanamycin) 25mg / L a transformant strain was obtained. Secondary recombination the DNA fragment on a chromosome by insertion into (cross-over) metB the WT with a gene-deficient strain :: hom (G378E) △ metB and CA01-2307 :: hom (G378E) △ metB was obtained .
[150]
O- acetyl-homo Another degradation route of the serine metY to defect the WT gene derived metY based on the nucleotide sequence information of the genes metY primer for amplifying the 5 'region of the top of one pairs of genes (SEQ ID NO: 25 and 26) and the 3 'primer was designed a pair (SEQ ID NO: 27 and 28) for amplifying the bottom portion.
[151]
[152]
Table 9
SEQ ID NO: primer Sequence (5'-3 ')
25 Primer 19 TCTAGAAGTAGCGTTGCTGTACAC
26 Primer 20 ATCAATGGTCTCGATGCCCATATGGCATTTGGAGGTCCTTAAG
27 Primer 21 CTTAAGGACCTCCAAATGCCATATGGGCATCGAGACCATTGAT
28 Primer 22 TCTAGATGGAACCGTTGCAACCAC
[153]
To the chromosome of WT as a template and SEQ ID NO: 25 SEQ ID NO: 26 was performed to SEQ ID NO: 27, and SEQ ID NO: 28 PCR using the primers. In 95 ℃ 5 minutes after denaturation, 95 ℃ 30 cho denaturation, annealing 55 ℃ cho 30, 72 ℃ After repeating 90 seconds to polymerization 30 times, was carried out 7 minutes polymerization at 72 ℃. As a result, metY to give a 512 bp DNA fragment and 3 of the 520 bp DNA fragment of the "lower end portion of the 5` top portion of the gene.
[154]
To the DNA fragments of the two amplified as the template, PCR was carried out in SEQ ID NO: 25 and a primer of SEQ ID NO: 28. In 95 ℃ 5 minutes after denaturation, 95 ℃ 30 cho denaturation, annealing 55 ℃ 30 cho, was repeated 30 times for 3 minutes 72 ℃ polymerization was carried out for 7 minutes polymerization at 72 ℃. As a result, metY the central portion of the gene defect has been amplified, the 1032 bp DNA fragment containing only the top and bottom.
[155]
After processing the pDZ vector and the 1032 bp DNA fragment with restriction enzymes XbaⅠ, after connecting with a DNA junction enzyme, was obtained by a plasmid cloned pDZ- △ metY was named.
[156]
pDZ- △ metY produced the vector to the WT :: hom (G378E) △ metB and CA01-2307 :: hom (G378E) △ metB introduced by electrical pulse method Angular the strain after containing kanamycin (kanamycin) 25mg / L to obtain a transformant strain in a selective medium. Secondary recombination the DNA fragment on a chromosome by insertion into (cross-over) metY the WT with a gene-deficient strain :: hom (G378E) △ metB △ metY and CA01-2307 :: hom (G378E) △ metB △ metY was obtained.
[157]
O- acetyl-homoserine for generating maximum, metX prepare a vector for enhancing gene expression. Homoserine O- acetyl transferase dehydratase (MetX) coding primer for amplification (about 100bp bottom stop codon) terminator region from the promoter region (the initiation codon top about 300bp), based on the reported sequence derived from WT to amplify the gene It was designed by inserting a BamHI restriction site on both ends of the (SEQ ID NO: 29 and 30).
[158]
[159]
[Table 10]
SEQ ID NO: primer Sequence (5'-3 ')
29 Primer 23 ggatccCCTCGTTGTTCACCCAGCAACC
30 Primer 24 ggatccCAAAGTCACAACTACTTATGTTAG
[160]
To the chromosome of WT as a template, PCR was performed using SEQ ID NO: 25, 26, a single primer. In 95 ℃ 5 minutes after denaturation, 95 ℃ 30 cho denaturation, annealing 55 ℃ cho 30, 72 ℃ After repeating 90 seconds to polymerization 30 times, was carried out 7 minutes polymerization at 72 ℃. As a result metX to give the 1546 bp DNA fragment containing the gene.
[161]
After pECCG117 (Republic of Korea Patent No. 10-0057684 No.) processes the vector DNA fragment by restriction enzyme and metX BamHⅠ and connected using DNA junction enzyme, was obtained by a plasmid cloned pECCG117- metX was named.
[162]
pECCG117- metX produced the vector to the WT :: hom (G378E) △ metB △ metY and CA01-2307 :: hom (G378E) △ metB △ metY kanamycin (kanamycin) 25mg / L was introduced into the electric pulse method in and it containing smeared on a selection medium to obtain the respective transformants.
[163]
The strains of O- acetyl-produced in the-by to compare homoserine (hereinafter, O-AH) producing ability cultured in the following way were analyzed O- acetyl-homoserine concentrations in the culture medium.
[164]
O-AH 250 ㎖ corner containing a production medium 25 ㎖ - these strains, one platinum loop inoculated in bapeul flask, and the mixture was cultured at 37 ℃ 20 hours, with shaking at 200 rpm. Using HPLC O- acetyl-homoserine concentrations were analyzed, the analyzed concentration is shown in Table 11.
[165]
[166]

[167]
Glucose 100 g, (NH 4 ) 2 SO 4 40 g, soy protein 2.5 g, corn steep solids (Corn Steep Solids) 5 g, urea 3 g, KH 2 PO 4 1 g, MgSO 4 · 7H 2 O 0.5 g, ㎍ biotin 100, thiamin hydrochloride [1000 ㎍, calcium pantothenate 2000 ㎍, nicotinamide ㎍ 3000, CaCO 3 30 g, L-methionine 0.3g (per liter of distilled water).
[168]
[169]
[Table 11]
Strain O- acetyl-homoserine (g / L)
Placed one Placed second Placed third
WT::hom(G378E)△metB△metY/pECCG117-metX 0.135 0.209 0.175
Chha0l-2307 :: Home (G378a) △ Metb △ Metya / Pecrcrgll7- metX 2.312 2.045 2.532
[170]
As shown in the results of the O- acetyl homoserine concentration analysis, lysC produce homo O- acetyl-homoserine by the mutation was confirmed to be increased.
[171]
[172]
Example 6: O- succinyl homoserine enhanced strain produced and O- succinyl-homoserine -producing ability compared
[173]
[174]
lysC (L377K) mutation was produced O- succinyl-homoserine-producing strain to determine the Impact on the capabilities of the production O- succinyl-homoserine by the introduction. Corey four bacterium glutamicum wild-type strain for natural O- succinyl produced in Example 5 because it does not produce the homoserine O- acetyl transferase dehydratase (MetX) O- through the substrate junction amino acid substitution in the enzyme azepin-succinyl transferase (MetA) to branch to modify the activity was to create an O- succinyl homoserine. In the WT-derived metX gene sequence-based embodiment metX devised a one pairs of primers (SEQ ID NO: 31 and 32) to produce a vector for introducing byeonyieul.
[175]
[176]
[Table 12]
SEQ ID NO: primer Sequence (5'-3 ')
31 Primer 25 tctagaATGCCCACCCTCGCGCCTTC
32 Primer 26 tctagaTTAGATGTAGAACTCGATG
[177]
To the chromosome of WT as a template, PCR was performed using primers of SEQ ID NO: 27 and SEQ ID NO: 28. In 95 ℃ 5 minutes after denaturation, 95 ℃ 30 cho denaturation, annealing 55 ℃ cho 30, 72 ℃ After repeating 90 seconds to polymerization 30 times, was carried out 7 minutes polymerization at 72 ℃. As a result metX to give a DNA fragment of 1146 bp coding region of the gene.
[178]
After treatment the DNA fragment of 1146 bp and the vector pDZ XbaⅠ with restriction enzymes, and then ligated using the DNA junction enzyme, was obtained by a plasmid cloned pDZ- metX was named. pDZ- metX the 176th amino acid to the 313th amino acid asparagine-based vector to make the disparity vector is replaced by arginine 176th variation given one pairs of primers (SEQ ID NO: 33 and 34) and the 313th one pairs of variation given primer (SEQ ID NO: It devised a 35 and 36).
[179]
[180]
[Table 13]
SEQ ID NO: primer Sequence (5'-3 ')
33 Primer 27 ACGCGCCAGCGCCTGGaacATCGGCATTCAATCCG
34 Primer 28 CGGATTGAATGCCGATgttCCAGGCGCTGGCGCGT
35 Primer 29 TAGATACCGATATTcgGTACCCCTACCACCAG
36 Primer 30 CTGGTGGTAGGGGTACcgAATATCGGTATCTAC
[181]
Position with the respective primer using a specific mutation kit (site-directed mutagenesis kit, stratagene , USA) metX to prepare a mutant gene. Original wild-type plasmids pDZ- metX mutant plasmid is based on the pDZ- metX was named (Q176N, L313R). The pDZ- making the metX (Q176N, L313R) the WT produce a vector in Example 5 :: hom (G378E) △ metB △ metY and CA01-2307 :: hom (G378E) △ metB △ metY electric pulse method in the strain introduced after it obtains a transformant strain in a selection medium containing kanamycin (kanamycin) 25mg / L. Secondary recombination by the DNA fragment inserted into the chromosome by (cross-over) metX gene metX ( Q176N , L313R ) replaced with :: WT hom (G378E) metX ((Q176N, L313R) △ metB △ metY and :: CA01-2307 hom (G378E) metX ((Q176N, L313R) △ metB △ metY obtain the strain.
[182]
O- succinyl-homoserine for generating maximum, metX (Q176N, L313R) mutation to prepare a vector for enhancing gene expression. One embodiment pECCG117- produced in Example 5 metX based on using O- succinyl transferase kinase having the activity of SEQ ID NO: 176 amino acid mutation primer that is 313 amino acid substituted with arginine to asparagine (33-36) metX variation was produced overexpression vector. Specifically, co-located with each primer was used for specific mutation kit (site-directed mutagenesis kit, stratagene , USA) was prepared vector pECCG117- metX was named (Q176N, L313R).
[183]
pECCG117-metX (Q176N, L313R) and the empty vector pECCG117 vector said O- succinyl production of the-in-homoserine-producing strain :: WT hom (G378E) metX ((Q176N, L313R) △ metB △ metY and CA01-2307 :: hom (G378E) metX ((Q176N, L313R) △ metB △ metY then introduced into the electric pulse method in the spread on a selective medium containing kanamycin (kanamycin) 25mg / L to obtain a transformed cell line.
[184]
And to compare O- succinyl-homoserine-producing ability of the strain cultured in the following way were analyzed O- succinyl-homoserine concentrations in the culture medium.
[185]
Example 5 250 ㎖ corner containing 25 ㎖ with the same O-AH production medium composition used in - this strain, one platinum on bapeul inoculated flask, and at 37 ℃ for 20 hours, then this was cultured with shaking in 200 rpm. Was analyzed by HPLC O- succinyl-homoserine concentrations, the concentration analysis is shown in Table 14].
[186]
[187]
[Table 14]
Strain O- succinyl-homoserine (g / L)
Placed one Placed second Placed third
WT::hom(G378E)metX((Q176N, L313R)△metB△metY/ pECCG117-metX(Q176N, L313R) 0.052 0.120 0.087
:: CA01-2307 Hom (G378E) △ MetB △ MetY / PECCG117- MetX (Q176N, L313R) 1.529 1.632 1.874
[188]
As shown in the results of said O- succinyl-homoserine concentration analysis, lysC is O- succinyl-homoserine produced by the mutant was confirmed to be increased.
[189]
[190]
These results are intended to suggest that the variants of the present invention can increase the production of the aspartate-derived amino acids and / or derivatives thereof.
[191]
[192]
From the above description, those skilled in the filed will appreciate that this application without changing the technical spirit or essential features may be embodied in other specific forms. In this regard, the embodiments described above are only to be understood as exemplary rather than limiting in all aspects. The scope of the present application should be construed as the meaning and scope, and all such modifications as derived from the equivalent concepts of the claims to be described later, rather than the description above within the scope of the present application.

WE Claims

The aspartate Tokina claim substituted variant 377 amino acid in the amino acid sequence of SEQ ID NO: 1 or a L- lysine L- methionine.
[Claim 2]
The polynucleotide encoding the variant of claim 1.
[Claim 3]
Paragraph (1) aspartate genus Corynebacterium microorganism Tokina producing aspartate-derived amino acids or L- amino acid derivatives containing the variant.
[Claim 4]
4. The method of claim 3, wherein the aspartate-derived from L- amino acids or amino acid derivative is the group consisting of lysine, threonine, methionine, homoserine, O- acetyl homoserine, O- succinyl-homoserine, isoleucine, and cadaverine the genus Corynebacterium microorganism selected ones.
[Claim 5]
The method of claim 3, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum of microorganisms.
[Claim 6]
Comprising the steps of culturing a microorganism in a culture medium 3 above; And a method of production of said microorganism or from the cultured medium, comprising the step of recovering the aspartate-derived amino acids or L- amino acid derivatives L- aspartate-derived amino acids or amino acid derivatives.
[Claim 7]
7. The method of claim 6, wherein the aspartate-derived from L- amino acids or amino acid derivative is the group consisting of lysine, threonine, methionine, homoserine, O- acetyl homoserine, O- succinyl-homoserine, isoleucine, and cadaverine the method of production is chosen.
[Claim 8]
The method of claim 6, wherein the production of said microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
[Claim 9]
Comprising the steps of culturing a microorganism in a culture medium 3 above; Step to produce O- acetyl-homoserine or O- succinyl-homoserine from the cultured microorganisms or culture medium; And L- methionine production method comprising the step of converting the O- acetyl-homoserine or O- succinyl homoserine into L- methionine.
[Claim 10]
10. The method of claim 9, wherein the production of said microorganism of the genus Corynebacterium is Corynebacterium glutamicum.