Abstract: The present invention discloses stable lyophilized or frozen formulations of lumpy skin disease virus [LSDV] vaccine, that comprise a live attenuated virus, and combination of one or more stabilizers selected from amino acid-based stabilizers, Protein based stabilizers, sugar-based stabilizers, Sugar alcohol-based stabilizers, Polyethylene Glycol, Potassium dihydrogen phosphate Potassium hydrogen phosphate and Disodium Phosphate. Further the invention discloses the particular ratio of the combination of one or more stabilizers and virus antigen, which provide stability to the formulations. The LSD vaccine can be prepared by lyophilization and by reconstituting the formulations with the diluent. Further invention also discloses ready to use liquid vaccine against LSDV. Invention provides methods of upscaling the virus production with high titters. The present invention also discloses the manufacture of Lumpy Skin disease vaccine, stabilization of vaccine virus and methods of safety in particular non-reversion to virulence, efficacy dose range demonstration, superiority of LSD vaccine over other heterologous goat pox vaccines by protecting vaccinated animal by administration of vaccine against Lumpy Skin Disease.
1. A vaccine formulation for Lumpy skin disease (LSD) comprising lumpy skin disease virus antigen, and combination of one or more stabilizers selected from: amino acid-based stabilizers, Protein based stabilizers, sugar-based stabilizers, Sugar alcohol-based stabilizers, Polyethylene Glycol, Potassium dihydrogen phosphate, Potassium hydrogen phosphate and disodium phosphate and pharmaceutically acceptable carrier/diluent.
2. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the antigen is live attenuated lumpy skin disease virus.
3. A vaccine formulation for Lumpy skin disease as claimed in claim 2 wherein the said vaccine comprises of combination of one of more stabilizers to live attenuated lumpy virus in ratio of 1:3 to 1:1.
4. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein pharmaceutically acceptable carrier/diluent is IX PBS, 0.8% Sodium Chloride having the PH value of between 6.5 to 7.5.
5. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the diluent optionally contains PH indicator such as Phenol red indicator.
6. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises amino acid stabilizer such as L-glutamate at about 0.01% to 1%, preferably 0.083% - 1%.
7. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises Protein stabilizers such as gelatin at about 0.1% to 10%, preferably 0.3% - 2% or 5% to 10%; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% - 2.5%; Casein hydrolysate at about 5% to 20%, preferably 7% - 10%.
8. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises sugar-based stabilizer such as sucrose at about 2.5% to 10%, preferably 3% - 5%.
9. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises sugar alcohol-based stabilizer such as sorbitol at about 5% to 20%, preferably 15% to 20%.
10. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises stabilizer Polythene glycol at about 0.5% to 6%, preferably 1% - 3%.
11. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises stabilizers such as Potassium dihydrogen phosphate at molar range of 0.002M to 0.005M, preferably 0.0028M to 0.003M; Potassium hydrogen phosphate at range of 0.002M to 0.005M, preferably 0.0038 M to 0.004M and Di sodium phosphate at about 0.002M to 0.005M, preferably 0.0038M to 0.004M.
12. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%; L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%; gelatin at about 0.1% to 10%, preferably 0.3% to 2%; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5% ; Polythene glycol is present at about 0.5% to 6%, preferably 1% to 3%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
13. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%., casein hydrolysate at about 5% to 20%, preferably 7% to 10%, L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%, gelatin at about 0.1% to 10%, preferably 0.3% to 2%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%, Polythene glycol is present at about 0.5% to 6%, preferably 1% to 3%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
14. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%., gelatin at about 0.1% to 10%, preferably 0.3% to 2%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
15. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%; gelatin at about 0.1% to 10%, preferably 0.3% to 2%; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%; casein hydrolysate at about 5% to 20%, preferably 7% to 10%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
16. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% - 5%., gelatin at about 0.1% to 10%, preferably 0.3% - 2%; casein hydrolysate at about 5% to 20%, preferably 7% - 10%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M; and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
17. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, sucrose at about 2.5% to 10%, preferably 3% - 5%; L-glutamate at about 0.01% to 1%, preferably 0.083% - 1%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M – 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M – 0.004M.
18. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, sucrose at about 2.5% to 10%, preferably 3% - 5%; gelatin at about 0.1% to 10%, preferably 0.3% to 2%; L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
19. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, sucrose at about 2.5% to 10%, preferably 3% to 5%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%; gelatin at about 0.1% to 10%, preferably 0.3% - 2%, L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
20. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, sorbitol at about 5% to 20%, preferably 15% - 20%; gelatin at about 0.1% to 10%, preferably 5% - 10%; casein hydrolysate at about 5% to 20%, preferably 7% - 10% and Disodium phosphate at about 0.00035 to 0.014 M, preferably 0.0007 M – 0.007M.
21. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the said formulation is in the form of lyophilized formulation or frozen to be ready to reconstitute formulation or stable ready to use liquid vaccine formulation.
22. A vaccine formulation for Lumpy skin disease as claimed in claim 21 wherein dry formulation vaccine is stable at 50C±30C up to 12 months, at 250C±30C up to 6 months, at 350C ±20C up to 30 days and -200C.
23. A vaccine formulation for Lumpy skin disease as claimed in claim 21 wherein frozen formulation is stable at 50C±30C up to 12 months, at 250C±30C up to 6 months, at 350C ±20C up to 30 days and -200C.
24. A vaccine formulation for Lumpy skin disease as claimed in claim 21 wherein stable ready to use liquid vaccine is stable at 50C±30C up to 12 months, at 250C±30C up to 6 months, at 350C ±20C up to 30 days and -200C.
25. A vaccine formulation for Lumpy skin disease as claimed in claim 21 wherein moisture content of lyophilized formulation as per above mentioned embodiments is less than 5%, preferably 3% to 5%.
26. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the said formulation is in dry cake form.
27. A vaccine formulation for Lumpy skin disease of claim 19 comprising steps of mixing the combination of one of more stabilizers to live attenuated lumpy virus in 1:3 to 1:1 ratio and freeze drying.
28. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the said Lumpy Skin disease virus (LSDV) is of the family Poxviridae and genus Capri poxvirus.
29. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the said formulation is safe, effective and stable vaccine compositions to elicit immune response and protection against lumpy virus disease (LSD) in animals.
30. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the said formulation is safe, effective and stable vaccine compositions to elicit immune response and protection against lumpy virus disease (LSD) in Bovid.
31. A method of treating the disease caused by Lumpy Skin disease virus (LSDV) by administering a therapeutically effective amount of pharmaceutical vaccine formulation of claim 1 to cattle (Bos indicus and Bos taurus) and buffaloes (Bubalus bubalis).
32. A method of treating as claimed in claim 31 wherein the administration of vaccine formulation is by systemic administration, or by parenteral administration.
33. The method of treating as claimed in claim 31 wherein the administration volume is 0.2 and 2.0 mL, and 1.0 to 2.0 mL for intramuscular or subcutaneous administration.
34. A pharmaceutical vaccine formulation as claimed in claim 1 or 21 wherein the said vaccine composition comprises dry formulation or frozen formulation reconstituted with the pharmaceutical carrier/ diluent wherein virus titre per dose is from 10^3 TCID50/ml-10^5 TCID50/ml is efficacious in cattle.
35. A method to adapt and upscale the production of virus with high titters for large scale production of vaccine.
36. A method as claimed in claim 33 wherein upscaling live attenuated lumpy virus production, yielding high virus titre of not less than 10^6.5-7 TCID50/ml through cell stacks, Bioreactors using microbeads or microstrips and Roller drums.
37. A method as claimed in any of the preceding claims wherein virus titre loss is not more than 10^0.5 TCID50/ml after lyophilization.
38. A process of preparing live attenuated virus by using the Vero cells as the substrate by adapting the virus to cells, for further large-scale production of virus.
DESC:RELATED PATENT APPLICATION(S):
This application claims the priority to and benefit of Indian Provisional Patent Application No. 202341025034 filed on May 01, 2023; the disclosures of which are incorporated herein by reference.
FIELD OF THE INVENTION:
The present invention discloses formulations of Lumpy skin disease vaccine that comprises a live attenuated lumpy skin disease virus, and combination of one or more stabilizers selected from: amino acid-based stabilizers, Protein based stabilizers, sugar-based stabilizers, Sugar alcohol-based stabilizers, Polyethylene Glycol, Potassium dihydrogen phosphate, Potassium hydrogen phosphate and disodium phosphate. In particular, the invention provides stable formulations of vaccines; optimization of lyophilization cycle, lyophilized (freeze dried) or frozen to be reconstituted with diluent for administration to bovid. Present invention further provides methods of upscaling virus production with high titres. Invention further also provides stable ready to use liquid vaccine for eliciting the protection against Lumpy Skin Disease in bovid. Invention further provides update on efficacious dose range and indicates that the heterologous goatpox vaccine used in India didn’t provide clinical protection against LSDV, unlike homologous LSD vaccines.
BACKGROUND OF THE INVENTION:
The Lumpy skin disease (LSD) is a vector-borne pox disease transmitted by direct contact of blood-feeding insects like mosquitoes, flies, lice and wasps and also through contaminated food and water.
Lumpy Skin disease virus (LSDV) belongs to the family Poxviridae and genus Capri poxvirus. The LSDV is a double-stranded DNA virus. The genome size of LSDV is 151 kb. The genome consists of 156 putative genes of which 146 genes are conserved that encode proteins involved in transcription, mRNA biogenesis, virion structure, and assembly. The genes of LSDV are akin to the genes of other viruses of the Capri poxvirus genus, e.g., sheep pox virus (SPPV) and goat pox virus (GTPV).
It causes infection in cattle (Bos indicus and Bos taurus) and buffaloes (Bubalus bubalis). The clinical symptoms of LSD were first described in Zambia in 1929 and spread rapidly in the cattle population across African countries. Until 1984, LSD was maintained within the countries of sub-Sahara Africa. The first confirmed transcontinental spread of LSD from the African to Middle-East Asian countries occurred when the disease was reported in Israel in 1989. The disease has Endemic across Africa, Europe and the Asian countries.
LSD has devastating economic impact. Outbreaks of LSD cause substantial economic losses in affected countries, but while all stakeholders in the cattle industry suffer income losses, poor, small-scale, and backyard farmers are hit hardest. The disease impacts heavily on cattle production, milk yields, and animal body condition. It causes damage to hides, abortion, and infertility. Total or partial stamping-out costs add to direct losses. Indirect losses stem from restrictions on cattle movements and trade.
The incubation period of the disease is 4 - 12 days. Infection starts with fever (40 °C - 41.5°C) persisting for 1 - 3 days. The skin nodules appear within 1–2 days, which gradually become harder and necrotic thereby inducing severe discomfort, pain and lameness. The mortality rate is usually low (1 - 5%) but occasionally reported to be much higher. The morbidity varies from 50 - 100%. The high morbidity caused by LSD significantly lowers the productivity of animals.
The clinical signs of the disease include fever, enlarged lymph nodes, drop in milk production, anorexia, abortion, infertility, and characteristic nodules on the skin. Clinical signs such as skin nodules observed on the face, neck, udder, limbs etc., are used to diagnose LSD.
The laboratory diagnosis of LSDV is primarily based on qPCR approaches that are mostly genus-specific. Assays are also designed to differentiate between the wild-type and the vaccine strains. Serology is based on neutralization tests but cannot discriminate antibodies (raised by infection/immunization) or virus species (SPPV, GTPV, or LSDV).
During the last decade, LSD had spread to climatically new and previously disease-free countries, which also includes its recent emergence in the Indian subcontinent in 2019. First case of which was reported in India in Gujarat's Kutch region and since then the outbreak has spread in other Indian states including of Himachal Pradesh, Maharashtra, Jharkhand, Jammu and Kashmir, Uttar Pradesh, and Punjab, among others. Acknowledging the economic impact of LSD, the World Organization of Animal Health (OIE) categorized LSD as a notifiable disease. Due to the ability of this virus to spread rapidly, it is considered an agro-terrorism agent.
No chemotherapeutic drugs are available for the treatment of LSD and Currently, Goat and sheep Vaccines are being used with limited success, but still is restricted to those countries where there is an overlap between SPPV, GTPV and LSDV infection.
Further, LSD is also being controlled through live attenuated field isolate strain, therefore, there is an urgent need to provide the stable vaccine formulation and to scale up the vaccine production to meet the market demand and for benefit of farmers and agriculture industry. Current control of this disease is possible through vaccination with the stable live attenuated vaccine.
OBJECTS OF THE INVENTION:
With this background, the main objective of the invention is to provide the safe, effective and stable vaccine compositions to elicit immune response and protection against lumpy virus disease (LSD) in Bovid.
One more objective of the invention is to provide the stable vaccine compositions comprising lyophilized dry or frozen formulations to elicit immune response and protection against lumpy virus disease (LSD) in animals.
One more objective of the invention is to provide the stable vaccine compositions comprising one of more stabilizers and lumpy skin disease virus antigen at optimum ratios to provide the optimum stability.
One more objective of the invention is to provide the stable lyophilized dry formulation of vaccine composition in combination with one or more stabilizers to provide optimum moisture content for cake formation.
Another objective of the invention is to provide the lyophilized or frozen formulations of vaccine which is to be reconstituted with physiologically acceptable buffers/ diluent for administrating of the liquid vaccine to animals for eliciting the immune response.
One more objective of the invention is to provide stable, ready to use, liquid vaccine composition to elicit immune response and protection against lumpy virus disease (LSD) in animals.
Further objective of the invention is to adapt and upscale the production of virus with high titters for large scale production of vaccine.
One more objective of the invention is to method of quantification by qPCR of virus in terms of TCID50 value.
These and other objectives of the present invention will be apparent from the following description.
SUMMARY OF THE INVENTION
Recognizing the present circumstances and the urgent need for a safe and effective vaccine against lumpy Skin Disease Virus (LSDV); Present invention provides novel vaccine for protection against Lumpy Virus Disease in Bovid.
In one aspect of the invention provides formulation of a vaccine comprising live attenuated virus with combination of one or more stabilizers. The stabilizers may be selected from comprising of amino acid-based stabilizers, Protein based stabilizers, sugar-based stabilizers, sugar alcohol-based stabilizers, Polyethylene Glycol, Potassium dihydrogen phosphate, Potassium hydrogen phosphate and disodium phosphate. In another embodiment of the invention live attenuated virus is used for preparation of formulation against lumpy virus disease.
In another aspect of the invention, live attenuated virus was prepared using the Vero cells as the substrate by adapting the virus to cells, for further large-scale production of virus.
In one of the embodiments of the invention, formulation contains amino acid stabilizer such as L-glutamate at about 0.01% to 1%, preferably 0.083% - 1%.
In another embodiment of the invention, formulation utilizes Protein stabilizers such as gelatin at about 0.1% to 10%, preferably 0.3% - 2% or 5% to 10% as the case may be; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% - 2.5%; Casein hydrolysate at about 5% to 20%, preferably 7% - 10%.
In another embodiment of the invention, formulation utilizes sugar-based stabilizer such as sucrose at about 2.5% to 10%, preferably 3% - 5%.
In another embodiment of the invention, formulation further contains sugar alcohol-based stabilizer such as sorbitol at about 5% to 20%, preferably 15% to 20%.
In one embodiment of the invention, formulation for vaccine, utilizes stabilizer Polythene glycol at about 0.5% to 6%, preferably 1% - 3%.
In one embodiment of the invention, formulation further comprises stabilizers such as Potassium dihydrogen phosphate at molar range of 0.002M to 0.005M, preferably 0.0028M to 0.003M; Potassium hydrogen phosphate at range of 0.002M to 0.005M, preferably 0.0038 M to 0.004M and Di sodium phosphate at about 0.002M to 0.005M, preferably 0.0038M to 0.004M.
In one embodiments of the invention, formulation of vaccine, comprises of: live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%; L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%; gelatin at about 0.1% to 10%, preferably 0.3% to 2%; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5% ; Polythene glycol is present at about 0.5% to 6%, preferably 1% to 3%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
In another embodiment of the invention, formulation of a vaccine comprises of live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%., casein hydrolysate at about 5% to 20%, preferably 7% to 10%, L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%, gelatin at about 0.1% to 10%, preferably 0.3% to 2%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%, Polythene glycol is present at about 0.5% to 6%, preferably 1% to 3%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
In another embodiment of present invention, formulation of a vaccine comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%., gelatin at about 0.1% to 10%, preferably 0.3% to 2%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
Further in one more embodiment of the present invention, formulation of a vaccine comprises of live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%; gelatin at about 0.1% to 10%, preferably 0.3% to 2%; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%; casein hydrolysate at about 5% to 20%, preferably 7% to 10%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
In another embodiment of the invention, formulation of a vaccine comprises of live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% - 5%., gelatin at about 0.1% to 10%, preferably 0.3% - 2%; casein hydrolysate at about 5% to 20%, preferably 7% - 10%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M; and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
In another embodiment of the invention, formulation of a vaccine comprises of live attenuated lumpy virus, sucrose at about 2.5% to 10%, preferably 3% - 5%; L-glutamate at about 0.01% to 1%, preferably 0.083% - 1%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M – 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M – 0.004M.
In another embodiment of the invention, A formulation of a vaccine comprises of live attenuated lumpy virus, sucrose at about 2.5% to 10%, preferably 3% - 5%;gelatin at about 0.1% to 10%, preferably 0.3% to 2%; L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
In another embodiment of present invention, formulation of a vaccine comprises of live attenuated lumpy virus, sucrose at about 2.5% to 10%, preferably 3% to 5%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%, gelatin at about 0.1% to 10%, preferably 0.3% - 2%, L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
Yet in another embodiment of the present invention formulation of vaccine comprises of live attenuated lumpy virus, sorbitol at about 5% to 20%, preferably 15% - 20%; gelatin at about 0.1% to 10%, preferably 5% - 10%; casein hydrolysate at about 5% to 20%, preferably 7% - 10% and Disodium phosphate at about 0.00035 to 0.014 M, preferably 0.0007 M – 0.007M.
In preferred embodiment of the invention, formulation of the vaccine comprises of combination of one of more stabilizers as referred in the above embodiments to live attenuated lumpy virus in ratio of 1:3 to 1:1.
In one of the preferred embodiments of the invention, vaccine is stable liquid ready to use vaccine, comprising formulation as per the above-mentioned embodiments and further contains pharmaceutically acceptable carrier/diluent.
In another embodiment of the invention, stable ready to use vaccine composition has virus titre per dose is from 10^3/ml-10^5/ml.
In another aspect of the invention, stable ready to use liquid vaccine is stable at 50C±30C up to 12 months, 250C±30C up to 6 months, 350C ±20C up to 30 days and -200C.
In another embodiment of the invention, formulation of vaccine as provided in one or more preferred embodiment is in the dry form. In another preferred embodiment of the invention, dry formulation is a lyophilized formulation. In another embodiment of the invention, dry formulation of a vaccine as provided in above embodiment is in cake form.
In another embodiment of the invention, moisture of the content of lyophilized formulation as per above mentioned embodiments is less than 5%, preferably 3% to 5%. In another embodiment of the invention virus titre loss is not more than 10^0.5 TCID50/ml after lyophilization. Another embodiment of the invention provides dry formulations which is stable at 50C±30C up to 12 months, 250C±30C up to 6 months, 350C ±20C up to 30 days and -200C.
Another aspect of the invention discloses method of preparation of stable dry formulation as per one or more embodiments, comprising steps of mixing the combination of one of more stabilizers to live attenuated lumpy virus in 1:3 to 1:1 ratio and freeze drying.
Another embodiment of the invention provides, formulation of the vaccine which is frozen formulation. In another embodiment of the invention, frozen formulation is stable at 50C±30C up to 12 months, 250C±30C up to 6 months, 350C ±20C up to 30 days and -200C.
Another aspect of the invention discloses the method of preparation of stable frozen formulation, comprising steps: mixing the combination of one of more stabilizers to live attenuated lumpy virus antigen in 1:3 to 1:1 ratio and freezing the formulation.
Another embodiment of the invention provides vaccine composition comprising of lyophilized formulation (freeze dried) and frozen formulation and further contains pharmaceutically acceptable carrier/ diluent.
In another embodiment of the invention, pharmaceutically acceptable carrier/diluent is IX PBS, 0.8% Sodium Chloride having the PH value of between 6.5 to 7.5. In another embodiment of the invention, diluent contains PH indicator such as Phenol red indicator.
In another embodiment of the invention, vaccine composition comprises dry formulation or frozen formulation reconstituted with the pharmaceutical carrier/ diluent wherein virus titre per dose is from 10^3 TCID50/ml-10^5 TCID50/ml is efficacious in cattle.
In another embodiment of the invention vaccine comprising dry formulation or frozen formulation reconstituted with the pharmaceutical carrier/ diluent and the composition is stable at 50C±30C up to 12 months, 250C±30C up to 6 months, 350C ±20C up to 30 days and -200C.
Another aspect of the invention provides method of upscaling live attenuated lumpy virus production, yielding high virus titre of not less than 10^6.5-7 TCID50/ml through cell stacks, Bioreactors using microbeads or microstrips and Roller drums.
Another aspect of the invention provides method of quantification Lumpy Skin Disease Virus (LSDV) through quantitative PCR (qPCR) in terms of TCID50/mL.
Another aspect of invention provides homologous LSD vaccine to provide complete protection against clinical disease of LSD unlike heterologous goatpox vaccines.
BRIEF DISCRIPTION OF THE DRAWING:
Figure 1: depicts the lyophilized cakes (freeze dried) after lyophilization process. (Example 5)
Figure 2: Clinical Score Card of vaccinated and unvaccinated control group. (Example 9)
DESCRIPTION:
The present invention provides safe and efficacious live attenuated lumpy virus vaccine composition that can be stored as dry formulations or frozen formulation still remain safe and efficacious.
Increased production of the live attenuated virus is necessary due to the increased demand for the Lumpy vaccine. Therefore, Biovet Private Limited acquired the live attenuated Lumpy Virus strain LSDV/India/2019/Ranchi (BV157) under a Technology Licensing Agreement with the National Research Centre for Equines of the Indian Council of Agricultural Research (ICAR) (NRCE).
The current invention describes several methods for systemically scaling viruses at optimal operating settings, including temperature, pH, and nutrition levels.
One aspect of the invention, provides method of upscaling live attenuated lumpy virus production, yielding high virus titre up to 10^7 TCID50/ml through cell stacking method.
Further upscaling was done through the use of Bioreactors. In bioreactors, compounds are transformed biologically using a variety of organisms, including enzymes, bacteria, fungi, yeast, algae, and cyanobacteria, as well as animal and plant cells, such as mosses. The bioreactor's functions include material transfer in a fluid phase (mixing), dispersion in a second phase, usually air, to create a broad phase boundary surface for efficient material transfer from gas to liquid, and thermal transfer for temperature management.
In one aspect of the invention aspect of the invention 200L or 10L Bioreactor were used for upscaling live attenuated lumpy virus production, where in virus production is upscaled to obtain not less than 10^6 TCID50/ml virus titre; which is further scalable up to 10,000L bioreactor volume with respective quantities of microbead or microstrips concentration and cell density in it.
Another aspect of the invention Roller drums was utilized to upscale the production of live attenuated lumpy virus, to obtain not less than 10^7 TCID50/ml virus titre.
STABILIZERS:
The high titters of the produces in large quantity was used for further formulation of the Lumpy Virus formulation preparation. In the formulation comprises of one or more stabilizers and virus antigen mixed in particular ratios. Different stabilizers have different effect on the stability and moisture content of the formulation.
In one aspect of the invention stabilizers are comprising of amino acid-based stabilizers, Protein based stabilizers, sugar-based stabilizers, sugar alcohol-based stabilizers, Polyethylene Glycol, Potassium dihydrogen phosphate, Potassium hydrogen phosphate and disodium phosphate.
The stabilizers were used in carefully constituted with different percentage to obtain the particular moisturization content. Stabilizers are chemical compounds added to the vaccine and are used in conjunction with either lower temperature storage or lyophilization methods. Chemical stabilizers, a stabilizer is described by Bovarnick et al., J. Bact. 59:509-522 (1950), as a liter of SPGA contains 0.218 M sucrose (74.62 g), 0.00376 M KH2P04 (0.52 g), K2HPO4 0.0071 M (1.25 g), potassium glutamate 0.0049 M (0.912 g) and 1% serum albumin (10 g). Further modification done by the person skilled in the art is also referred to SPGA.
In one of the embodiments the sugar stabilizer is sucrose. Particular embodiment contains the sucrose at about 2.5% to 10%, preferably 3% - 5%. Further embodiment may contain other sugar stabilizers such as but not limited to trehalose, raffinose, glucose and glycerol etc. In alternative embodiments the one or more combinations of sugar stabilizers may be used. In yet other embodiments, the sugar stabilizer is used in combination other types of stabilizers as provided in the description and embodiments.
In another embodiment of the invention, formulation further contains sugar alcohol-based stabilizers. In particular embodiment sugar alcohol-based stabilizer – sorbitol is used at about 5% to 20%, preferably 15% to 20%. Further sugar alcohol stabilizers may be comprised of but not limited to mannitol, isomalt, maltitol, lactitol, xylitol and erythritol. In alternative embodiments the one or more combinations of sugar alcohol stabilizers may be used. In yet other embodiments, the sugar alcohol stabilizer is used in combination other types of stabilizers.
In particular embodiments, the protein stabilizers are used. In particular embodiment protein stabilizer is gelatin. In other embodiments the protein stabilizer is a casein hydrolysate. In yet other embodiments the protein stabilizer is a lactalbumin hydrolysate. Particularly embodiments of the invention, formulation utilizes Protein stabilizers such as gelatin at about 0.1% to 10%; preferably 0.3% - 2%; In another embodiment gelatin is preferred to be 5% to 10%; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% - 2.5%; Casein hydrolysate at about 5% to 20%, preferably 7% - 10%.
Further the protein stabilizers may be comprised of but not limited to albumin, heat shock proteins (HSPs), valosin-containing protein (VCP), a-crystallin etc. In alternative embodiments the one or more combinations of protein stabilizers may be used. In yet other embodiments, the protein stabilizer is used in combination other types of stabilizers.
In particular embodiments, the amino acid stabilizers are used. In particular embodiments the amino acid stabilizer is L-glutamate. In one of the embodiments of the invention, L-glutamate is present at about 0.01% to 1%, preferably 0.083% - 1%. In yet other embodiments, the amino acid stabilizer can be arginine, aspartic acid, lysine and L-isoleucine. In related embodiments, formulations of the vaccines of the present invention can also comprise of two or more amino acid stabilizers. In yet other embodiments, the protein stabilizer is used in combination other types of stabilizers.
In one another embodiment of the invention, formulation for vaccine, utilizes stabilizer Polythene glycol. In particular embodiment of the present invention, the Polyethene glycol is present at about 0.5% to 6%, preferably 1% - 3%. In related embodiment, Polythene glycol is used in combination with other types of stabilizers.
In one more embodiment of the invention, formulation comprises stabilizers such as Potassium dihydrogen phosphate, Potassium hydrogen phosphate and Disodium Phosphate. Particularly the embodiments of the formulation of present invention, uses stabilizers such as Potassium dihydrogen phosphate at molar range of 0.002M to 0.005M, preferably 0.0028M – 0.003M, Potassium hydrogen phosphate at range of 0.002M to 0.005M, preferably 0.0038 M – 0.004M and Di-sodium Phosphate at range of 0.00035M to 0.014, preferably 0.0007 M to 0.007M; in combination of other types of stabilizers mentioned in the embodiment and the description of the invention.
In one of the preferred embodiments of the invention, formulation of vaccine, comprises of stabilizers selected from sucrose; L-glutamate; gelatin; lactalbumin hydrolysate; Polythene glycol; Potassium dihydrogen phosphate and Potassium hydrogen phosphate.
Particularly the preferred formulation of vaccine comprises the stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% - 5%; L-glutamate at about 0.01% to 1%, preferably 0.083% - 1%; gelatin at about 0.1% to 10%, preferably 0.3% - 2%; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% - 2.5% ; Polythene glycol at about 0.5% to 6%, preferably 1% - 3%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M-0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M - 0.004M.
In another preferred embodiment of the invention, formulation of a comprises the stabilizers selected from sucrose, casein hydrolysate, L-glutamate, gelatin, lactalbumin hydrolysate, Polythene glycol, Potassium dihydrogen phosphate and Potassium hydrogen phosphate.
Particularly the preferred embodiment of the invention, formulation of a comprises the stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% - 5%., casein hydrolysate at about 5% to 20%, preferably 7% -10%, L-glutamate at about 0.01% to 1%, preferably 0.083% - 1%, gelatin at about 0.1% to 10%, preferably 0.3% - 2%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% - 2.5%, Polythene glycol is present at about 0.5% to 6%, preferably 1% - 3%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M – 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M – 0.004M.
In one more preferred embodiment formulation of a vaccine comprises stabilizers selected from sucrose, gelatin, lactalbumin hydrolysate, Potassium dihydrogen phosphate and Potassium hydrogen phosphate.
Particularly the preferred embodiment of the formulation comprises the stabilizers Sucrose at about 2.5% to 10%, preferably 3% - 5%., gelatin at about 0.1% to 10%, preferably 0.3% - 2%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% - 2.5%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M – 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M – 0.004M.
One more preferred embodiment of the invention comprises formulation of a vaccine comprises the stabilizers selected from sucrose, gelatin, lactalbumin hydrolysate, casein hydrolysate, Potassium dihydrogen phosphate and Potassium hydrogen phosphate.
In particular the preferred embodiment of the invention comprises the formulation of a vaccine comprising stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% - 5%, gelatin at about 0.1% to 10%, preferably 0.3% - 2%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% - 2.5%, casein hydrolysate at about 5% to 20%, preferably 7% - 10%., Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M – 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M – 0.004M.
Another preferred embodiment of the invention, have the formulation of a vaccine comprises stabilizers selected from sucrose, gelatin, casein hydrolysate, Potassium dihydrogen phosphate and Potassium hydrogen phosphate.
Particularly the invention comprises the stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% - 5%., gelatin at about 0.1% to 10%, preferably 0.3% - 2%, casein hydrolysate at about 5% to 20%, preferably 7% - 10%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M – 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M – 0.004M.
Another preferred embodiment of the invention, have the formulation of a vaccine comprises stabilizers selected from sucrose, L-glutamate, Potassium dihydrogen phosphate and Potassium hydrogen phosphate.
Particularly the invention comprises the stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% - 5%; L-glutamate at about 0.01% to 1%, preferably 0.083% - 1%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M – 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M – 0.004M.
Another preferred embodiment of the invention, have the formulation of a vaccine comprises stabilizers selected from sucrose, gelatin, L-glutamate, Potassium dihydrogen phosphate and Potassium hydrogen phosphate.
Particularly the invention comprises the stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% - 5%; gelatin at about 0.1% to 10%, preferably 0.3% to 2%; L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
Another preferred embodiment of the invention, have the formulation of a vaccine comprises stabilizers selected from sucrose, lactalbumin hydrolysate, gelatin, L-glutamate, Potassium dihydrogen phosphate and Potassium hydrogen phosphate.
Particularly the embodiment of the present invention, have the formulation of a vaccine comprises of sucrose at about 2.5% to 10%, preferably 3% to 5%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%, gelatin at about 0.1% to 10%, preferably 0.3% - 2%, L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
Another preferred embodiment of the invention, have the formulation of a vaccine comprises stabilizers selected from sorbitol, gelatin, casein hydrolysate and Disodium Phosphate.
Particularly the embodiment of the present invention, have the formulation of a vaccine comprises of sorbitol at about 5% to 20%, preferably 15% - 20%; gelatin at about 0.1% to 10%, preferably 5% - 10%; casein hydrolysate at about 5% to 20%, preferably 7% - 10% and Disodium phosphate at about 0.00035 to 0.014 M, preferably 0.0007 M – 0.007M.
Mentioned classes of "stabilizer" further can encompasses one or more classes of stabilizers, specifically mentioned stabilizers are not intended to be limiting, unless otherwise specified.
FORMULATION OF THE VACCINE
The formulation of vaccine comprises the combination of one or more stabilizers as per the above-mentioned embodiments with live attenuated virus. Particularly the embodiments of the invention comprise of combination of one of more stabilizers to live attenuated virus in 1:3 to 1:1 ratio for the optimum stability.
The effects of stabilizers on the virus stability have been thoroughly evaluated at accelerated temperatures. The stable formulations were further Screened and evaluated for the final vaccine preparations.
DRY FORMULATION
The dry formulation of the present invention comprises the combination of one or more stabilizers as per the above-mentioned embodiments to be mixed with live attenuated virus. Particularly the invention contains combination of one of more stabilizers to live attenuated lumpy virus in 1:3 to 1:1 ratio followed by lyophilization (freeze drying).
As used herein a "dry formulation" of a vaccine is prepared by removing the liquid of a vaccine that from the formulated solution. The removal of the liquid can be accomplished by sublimation such as by lyophilization (freeze-drying). In the present invention, the experiments were performed with the formulation as mentioned in the examples and description of the invention of the commercial batch and using a freeze dryer. Modifications were made in the physical properties of the current freeze-drying cycle (temperature, pressure and time) and the loading temperature of the product, without changing the formulation of the vaccine or primary loading. Samples of the lyophilized product trial were analyzed for their appearance, performance, residual moisture, strength and accelerated thermostability.
In one of the embodiments of the present invention the formulation prepared by mixing the stabilizers in one or more embodiment is in the dry form. In another preferred embodiment of the invention, dry formulation is a lyophilized formulation (freeze dried).
The shape of the lyophilized formulation can be a shape of vials, alternatively it can be a power or dried as a foam. In one of preferred embodiment of the invention, formulation of a vaccine is in cake form.
The moisture content of the dry formulation was evaluated for stability screening. The low moisture provided the better stability to the lyophilized formulations. In one of the embodiments of the present invention, moisture of the content of lyophilized formulation is less than 5%, preferably 3% to 5%. In another embodiment of the invention provides not more than 10^0.5 TCID50/ml loss after lyophilization of the formulation.
The temperature stability profile of the formulation was evaluated. The same is useful for storage and shipping purposes. In one aspect of the invention, the dry formulation as per the above-mentioned embodiments, is stable at 50C±30C up to 12 months, 250C±30C up to 6 months, 350C ±20C up to 30 days (accelerated temperature) and -200C.
FROZEN FORMULATION
The frozen formulation of the present invention comprises the combination of one or more stabilizers as per the above-mentioned embodiments to be mixed with live attenuated virus. Particularly the invention contains combination of one of more stabilizers to live attenuated lumpy virus in 1:3 to 1:1 ratio followed by freezing the formulation.
In one or more embodiments of the present invention, the temperature stability profile of the frozen formulation was evaluated; the same is useful for storage and shipping purposes. In one aspect of the invention, the frozen formulation as per the above-mentioned embodiments, is stable at 50C±30C up to 12 months, 250C±30C up to 6 months, 350C ±20C(accelerated temperature) up to 30 days and -200C.
VACCINE:
A "vaccine" is a composition that is suitable for application to an animal which upon administration to the animal induces an immune response strong enough for aiding in the prevention of the clinical disease, and/or preventing, ameliorating, or curing the clinical disease.
Vaccine composition, comprise a pharmaceutically acceptable carrier/ diluent. The term "carrier" refers to a “diluent” with which the compound is administered. As used herein, the term pharmaceutically acceptable carrier or diluent is compound compatible with the other ingredients of the composition and not disadvantageously deleterious to the intended recipient. In one embodiment of the present invention the vaccine, comprise a pharmaceutically acceptable carrier/ diluent.
In one embodiment of the present invention, A vaccine diluent / pharmaceutically acceptable carrier is mixed with a lyophilized (freeze-dried) vaccine in order to reconstitute the lyophilized vaccine and provide the final vaccine for administration to the animal.
In another embodiment of the present invention, A vaccine diluent / pharmaceutically acceptable carrier is mixed with a frozen vaccine in order to reconstitute the frozen vaccine and provide the final vaccine for administration to the animal.
In one embodiment of the present invention, pharmaceutically acceptable carrier/ diluent is selected from (1X) PBS, 0.8% Sodium Chloride with PH value of between 6.5 to 7.5.
The inoculate vaccine in vials were monitored for the growth of bacteria or fungus for 14 days by visual observation with respect to the control.
In another embodiment of the present invention, the pharmaceutically acceptable carrier/ diluent as mentioned in above embodiment can further comprise the PH indicator. Yet in another embodiment of the present invention, PH indicator is a Phenol red indicator.
The present invention may also involve the use of other diluents such as but not limited to Sucrose, anhydrous lactose, lactose monohydrate, and sugar alcohols such as sorbitol, xylitol and mannitol. Yet in another embodiment of the present invention, pharmaceutically acceptable carriers can be Water or aqueous solution, sterile liquids saline, adjuvants etc.
Vaccine Administration
Vaccine can be administrated to the subject animal, live stocks, cattle or bovid following mixing with a carrier. The vaccine may be administrated by systemic administration, or by parenteral administration. Systemic administration can be performed through intramuscular, intradermal, transdermal, or supradermal, subcutaneous, submucosal, intravenous etc. Parenteral administration can be performed through subcutaneous, submucosal injections, intravenous, intramuscular, intradermal, and infusion etc.
A typical range for the administration volume in 0.2 and 2.0 mL, and 1.0 to 2.0 mL for intramuscular or subcutaneous administration.
As provided in the experiment 8 of the description Dose finding studies were conducted to find out the safe and effective dose dilution. The studies included the vaccinating the animals with different doses of the vaccine. The animals were further inoculated with challenged virus to find the minimum protective dose/therapeutic effective dose. The animals were clinically examined daily, rectal temperatures and lesions are recorded.
Further the dose to be given to animal can be more than minimum protective dose. In one of the preferred embodiments of the present invention, vaccine should not have virus titre than 10^3.5/ml. It is contemplated that the vaccine may be administered to the live stocks or animals or bovid at a single time or alternatively, two or more times on yearly basis. Determining such dosage adjustments is generally within the skill of those in the art of vaccine development.
Reference to the term’s 'animal" and "bovid" are used interchangeably and includes the cattle.
The present invention may be better understood by reference to the following non-limiting Examples, which are provided as exemplary of the invention. The following Examples are presented in order to more fully illustrate embodiments of the invention. They should in no way be construed, however, as limiting the broad scope of the invention.
EXAMPLES:
Materials and Methods:
L- Glutamic acid potassium salt with purity > than 99% was purchased from Sigma Aldrich. Lactalbumin hydrolysate with a purity > than 98% was purchased from Sigma Aldrich. Gelatin of IP grade with purity 90% was purchased from Gelatin India. Potassium dihydrogen phosphate and Potassium hydrogen phosphate with the purity more than 99.8% was purchased from BioArtha Labs. Sucrose with the purity more than 99% was purchased from LABORT. Polyethene Glycol and Casein Hydrolysate solution were prepared from the best available commercial suppliers. Disodium phosphate dihydrate with the purity> than 995-100% were purchased from HIMEDIA, Sodium chloride and phenol red was purchased from HIMEDIA. Dulbecco's Modified Eagle Medium (DMEM) was obtained from Biowest. New Born Calf Serum was purchased from REGATE, Roller Bottle, 1700 cm2 were obtained from Corning catalog # 430852; 200L Bioreactor was purchased from Equipment Fabricator, Microbeads were purchased from Cytiva (Cytodex 1 - approx. 4440 cm2 after soaking).
Example 1:
Large Scale production of live attenuated Lumpy Skin Disease (LSD) Virus using Cell Stacking Method
Extensively characterized Vero cells (ATCC No. CCL-81) was used as substrate for the culture of Lumpy Skin Disease Virus; to be used for pilot and large-scale production. Vero cells were grown in DMEM (Dulbecco's Modified Eagle Medium) with 5% New Born Calf Serum (NBCS); PH 7.2 and incubated at 35°C to 37°C until reaching 80 - 100 % confluence of the monolayer.
For the Pilot scale culture, Vero cells were systematically scaled up from T-175 cell culture flasks to CS 1 (cell stack 1), to culture chambers and then CS40 (cell stack 40) culture chambers. After 4-5 days observation (85-95 % confluency) in CS40 culture chambers, cells monolayers were washed with IX PBS and then trypsinized (0.2%), not less than 360 million Vero cells were seeded in at least 15 x CS40 flask culture chambers.
All the monolayers in CS40 Cells stacks culture chambers were infected with live attenuated LSD Virus in medium (1.5 litre each CS40) containing DMEM (Dulbecco's Modified Eagle Medium) with Virus seed inoculum of Optimised to 0.005 to 0.5 multiplicity of infection MOI per cell, and incubated for virus 35°C to 37°C for virus adsorption. Following adsorption, 4.5L of virus infection medium was transferred using (0.45 + 0.2µ) capsule filter, and was incubated for 3 to 5 days at 35°C to 37°C.
At about 50-70% Cytopathic effect, culture chambers were transferred to freezer room (<-30°C) for not less than 12 hours, and subsequently brought to room temperature of 20±2°C about 12 hours for thawing. At least two cycles of freeze-thawing done for each lot of culture chambers. The flasks were transferred and surface sterilized with 70% isopropyl alcohol and shifted to celling mount Laminar air flow unit and about 90L volume was harvested and dispensed in 1Liter to 10L aliquots in PETG or PP containers for the storage at <-40°C until further process. Sample of virus aliquots are tested for all the quality control parameters.
Lumpy Skin Disease virus produces cytopathic effect (CPE) in Vero cells, and at the optimal Multiplicity of Infection (Mol) and harvest conditions, virus titters upto 10^7 TCID50/ml could be attained.
Example 2:
Large Scale production of live attenuated Lumpy Virus using Bioreactors
(A) Microcarrier beads appropriate for use in a bioreactor was used to culture virus infected Vero Cells, and to obtain high yield Virus Titres.
220 g micro carrier beads (surface area of 4400cm2/gram after soaking) were weighed and transferred to 10 litre of PBS (1X) for 120-180 minutes to soak, then PBS was removed and 10 litre of fresh PBS (1X) was added, beads were allowed to sediment for 120 minutes, finally beads were transferred to 10 L of PBS (1X) for sterilization in autoclave.
Incubation of Vero cells to the microcarrier beads: 17600 X 106 cells Vero cells was added to microcarrier beads (autoclaved and cooled), after PBS was removed, in 12.5 Litres of growth medium consisting of DMEM (Dulbecco's Modified Eagle Medium) with 5% -10% New born Calf Serum (NBCS) for 60 minutes for attachment at 35°C to 37°C without disturbing the cells and beads.
The cells were subsequently, seeded to the 200L Bioreactor (Equipment Fabricator, Bengaluru. India). The beads with attached cells were pushed into the 200 L for 48 -72 h to form the monolayer at the PH of 7.25, at 37°C and Dissolved Oxygen (DO) of 50-70%.
Infection of Vero cells with live attenuated Lumpy Skin Disease Virus: once monolayers are complete on beads on day 2-3, of seeding cells, cells were counted for increment of 3 to 4 times, for the infection with live attenuated virus.
Vero cells was washed with Virus infection medium once, followed by removal of supernatant virus infection media and 75 litres of fresh virus infection medium consisting of Dulbecco's Modified Eagle Medium; with Virus seed inoculum of Optimised between 0.05 to 0.5 MOI) was added. The infected cells were incubated further for 60 minutes, followed by further top up of 75 L of virus infection medium, and operation of bioreactor for 72 hours with the PH 7.45 at 34.50C±1.0 and DO 30-50 %.
At the end of 72-96 hours Post infection once cytopathic effects were observed, cells were harvested with beads and frozen at -300C. After the freezing clear supernatant was harvested. At the optimal Multiplicity of Infection (Mol) and harvest conditions, virus titters not less than 10^6 TCID50/ml could be attained. This is scalable up to 10,000L bioreactor volume with respective quantities of microbead concentration and cell density in it.
(B) Microstrips appropriate for use in a bioreactor was used to culture virus infected Vero Cells, and to obtain high yields.
A 60 g micro carrier strips (surface area of 2200cm2/gram) were weighed and transferred to 5 L of PBS(IX) for 120 minutes to soak, old PBS was removed and fresh 5 liter of PBS (IX) was added. Beads were allowed to sediment for 120 minutes, finally beads are transferred to 5 L of PBS (1X) for autoclave.
Incubation of Vero cells with microcarrier strips: 6000 X 106 cells Vero cells was added to microstrips (autoclaved and cooled), after PBS was remove; in 12.5 litre of growth medium consisting of DMEM (Dulbecco's Modified Eagle Medium) with 5% New Born Calf Serum (NBCS) for 60 minutes without disturbing the cells and strips, allowed for attachment at 35°C to 37°C.
The cells were subsequently, seeded to the 10L Bioreactor. The microstrips with attached cells were pushed into the 10 L for 48-72 h to form the monolayer at the PH of 7.25, at 37.0±1.0°C and Dissolved Oxygen of 50-70%.
Infection of Vero cells with live attenuated Lumpy Skin Disease Virus: On day 2-3 of seeding cells, cells were counted for increment of 3 to 4 times, for the infection with live attenuated virus. Vero cells was washed with 4 litres Virus infection medium once, followed by removal of supernatant virus infection media and 4 litres of fresh virus infection medium was added with Virus seed inoculum of Optimised 0.05 to 0.5 MOI.
The infected cells were incubated further for 60 minutes, followed by further top up of 4 L of virus infection medium, and operation of bioreactor for 72-96 hours with the PH 7.45 at 34.50C ±1.00C and DO 20-50 %.
At the end of 72-96 h Post infection once cytopathic effects were observed, cells were harvested with microstrips and freezed at -300C or below. After the freeze-thawing clear supernatant was harvested.
At the optimal Multiplicity of Infection (Mol) and harvest conditions, virus titters not less than 10^6 TCID50/ml could be attained. which is further scalable up to 10,000L bioreactor volume with respective quantities of microstrips concentration and cell density in it.
Example 3:
Large Scale production of live attenuated Lumpy Virus using Roller Bottles
The 200 X 106 Vero cells are harvested in roller bottles containing the 200mL of DMEM growth medium with 5% NBCS; 350C - 37°C and rotated for 48 hours monolayer confluence up to 80%.
The cells were washed with Virus infection medium and Vero cells were infected with 90mL virus infection medium; 0.05-0.5 MOI live attenuated lumpy virus.
The infected cells were further incubated for 60 minutes for adsorption of virus to the cells. Followed by addition of 90 mL of Virus infection medium was added, and roller apparatus was operated for 72 hours.
At the end of 72 hours Post infection once complete cytopathic effect was observed; cells along roller bottle was harvested and kept at -300C or below for freezing purpose. After the complete freeze thawing that the clear supernatant was harvested.
At the optimal Multiplicity of Infection and harvest conditions, virus titters not less than 10^7 TCID50/ml could be attained.
Example 4:
Preparation of dry Formulation:
(A) Preparation of the Stabilizers
All the components of the formulations were weighed in 2X concentration of the required in the dry formulation. Sucrose, Lactalbumin hydrolysate, L-Glutamate potassium salt, Casein hydrolysate, sorbitol, Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, Disodium Phosphate were dissolved in 200C-250C WFI, the components were dissolved by mixing and sterilized using the 0.22µm filter.
Gelatin, Polyethylene glycol were weighed in 2X concentration of the requirement in the dry formulation were dissolved in hot WFI and mixed till dissolved and further sterilized by autoclaving at 1210C for 20 minutes and cool to room temperature before its use in the stabilizer formulation.
Sucrose, Lactalbumin hydrolysate, L-Glutamate potassium salt, Casein hydrolysate, Sorbitol, Potassium dihydrogen phosphate, dipotassium monohydrogen phosphate, Disodium Phosphate were mixed with Gelatin and Polythene glycol, as per requirement of the composition, the PH was adjusted to 7.2 ± 2 using 1M Potassium dihydrogen phosphate, Dipotassium monohydrogen phosphate and Disodium Phosphate aseptically. At large scale preparation, the mixing was done using blending Stainless steel vessel. Final stabilizing mixtures were sterilized by aseptic filtration method using 0.22µm filter cartridge.
Virus antigens 0.5ml (titer: 10^4.5 TCID50) and stabilizers (0.5ml of 2X preparation) are blended to the final concentration of each component as provided in the embodiments of present invention. All the components are mixed thoroughly by stirring for at least 10 minutes on a stirring plate. The formulations were subjected to accelerated temperature treatment to select the suitable compositions for the lyophilization.
(B) Preparation of diluent:
The diluent was prepared by mixing Disodium phosphate dihydrate 1.28 mg; Potassium Dihydrogen phosphate 0.52 mg; Sodium chloride 5.69 mg; Phenol red 0.016 mg water for injection I.P for per ml diluent preparation.
EXAMPLE 5
OPTIMIZATION OF FREEZE-DRYING PROCESS FOR VIRUS STABILIZATION IN DIFFERENT FORMULATIONS
All the components are mixed thoroughly by stirring for at least 10 minutes on a stirring plate. To prepare the formulations as freeze-dried cakes in glass vials, the vaccine blend was dispensed into 3ml glass vials for 1ml volume per vial / or 5ml glass vials @ 2 ml of volume per vial under cold chain conditions.
The filled vial was transferred to the 4°C pre-chilled shelf in the freeze-dryer. Samples were freeze-dried in a lyophilizer using a defined lyophilization cycle developed and optimized as shown in below table. After freeze-drying, the vacuum was released and the vials were completely stoppered filled with nitrogen gas. Vials were tightly sealed with aluminium caps and then stored at 20C-80C.
Steps Final temp Ramp duration (min) Soak duration (min) Vacuum (mbar) Process time (min)
420
Freezing Step 1 -550C 150 270
Primary drying 960
Step:1 -180C 120 480 0.12
step:2 00C 120 240 0.12
Secondary drying Step:1 +100C 60 180 0.12 660
Step:2 +300C 60 360 0.005
Total minutes or hours 2,040 minutes
(34 hours)
TABLE 1
Composition as listed in Table 2 were subjected for lyophilization cycles in lyophilizer. Figure 1 depicts the representation of lyophilized cakes.
Formulation Composition
Formulation A Sucrose 5% +L-Glutamate 0.83% + Potassium dihydrogen phosphate at 0.002M to 0.005M + Potassium hydrogen phosphate at 0.002M to 0.005M
Formulation B Sucrose 2%+ L-Glutamate 0.83% + Gelatin 0.1% + Potassium dihydrogen phosphate at 0.002M to 0.005M + Potassium hydrogen phosphate at 0.002M to 0.005M
Formulation C Sucrose 2% +LAH 1.5%+ Gelatine 0.15% + Potassium dihydrogen phosphate at 0.002M to 0.005M + Potassium hydrogen phosphate at 0.002M to 0.005M
Formulation D Sucrose 5% + Lactalbumin 2.5%+ Gelatin 0.3% + L-Glut 0.083% + Potassium dihydrogen phosphate at 0.002M to 0.005M + Potassium hydrogen phosphate at 0.002M to 0.005M
Formulation E Sucrose 5% + Lactalbumin 2.5%+ Gelatin 0.3% + L-Glut 0.083% + PEG 2% + Potassium dihydrogen phosphate at 0.002M to 0.005M + Potassium hydrogen phosphate at 0.002M to 0.005M
Formulation F Sucrose 5% + Lactalbumin 2.5% + Gelatin 0.3% + L-Glut 0.83g/L + PEG 1% + Potassium dihydrogen phosphate at 0.002M to 0.005M + Potassium hydrogen phosphate at 0.002M to 0.005M
TABLE 2
Example 6:
Quantitative Estimation of Moisture Content in the lyophilised cake
Moisture content of cake in vials was estimated by using Karl fisher titration method; instrument used was Metrohm Titrando 888_1. Karl fisher reagent was poured into reservoir bottles and methanol was added to titration vessel. The KF factor was analysed using 150mg to 300mg Disodium Tarrate (DST).
The samples from freeze dried cake in vails were collected (not less than 100mg) and transferred to the titration vessel and then moisture content was analysed. The residual moisture content was found to vary from 1% to 5%.
Example 7:
Stability studies of the formulations and LSD live attenuated vaccine
To investigate the integrity of freeze-dried formulation at various temperature conditions, stability profiles were analysed. The cake was solubilized using 1 ml of sterile PBS aseptically and it which was mixed by vertexing. The cake sample vials incubated/maintained at 37 0C, 250C and 20C - 80C and -200C. TCID50 value was calculated using conventional method and Quantitative PCR (qPCR). Results were tabulated and compared with that of day 0 values.
Similarly, the stability profiles of frozen, reconstituted vaccine formulation (frozen and freeze dried) and ready to use vaccine were analysed. qPCR probes and tag were designed and process was optimized to calculate the results in TCID50 value.
Forward primer sequence is CCAAGATCCGACCAAAAGCC and
Reverse primer sequence is TGTTATCGTTGGTTCCCGTT.
The target probe sequence is 5-FAM-CCTCGATTGATAGTTGTGCCA- BHQ-1.
Initial denaturation is for 950C for 10 min, followed by 35 cycle of 95oC for 15 seconds and 600C for 30 seconds.
Temperature Time Cycle
95oC 10 min One cycle
95oC 15 sec 35 cycles
60oC 30 sec/ data acquisition
Samples Virus titre by TaqMan Virus titre by TCID50 Average Standard Deviation Coefficient of Variation (5%)
Sample 1 7.50 7.3 7.40 0.14 1.96
Sample 2 7.66 7.1 7.38 0.40 5.38
Sample 3 7.46 7.1 7.28 0.25 3.49
Sample 4 7.11 7.5 7.31 0.28 3.77
Sample 5 6.88 7.1 6.99 0.15 2.20
Sample 6 6.80 7.3 7.05 0.35 5.00
Various Virus samples were tested for TCID value through conventional methods. The qPCR results were optimized to provide results in terms of TCID50 value by optimizing the PCR conditions.
Initial studies suggested the vaccine composition and formulation were stable at 50C±30C up to 12 months, 250C±30C up to 6 months, 35±20C up to 30 days (accelerated temperature) and -200C.
Example 8:
Evaluation of immunogenic dose response of homologous Lumpy skin disease live attenuated Vaccine, and its comparison with heterologous goatpox live vaccine for effective vaccination in Cattle
These studies were conducted to find out the immunogenic dose response of homologous LSD vaccine and its further comparison with that of heterologous goatpox vaccine in the vaccinated cattle. 5 groups of cattle with each group comprising 6 seronegative animals for LSDV with age above 6 months, were chosen for above studies. 3 groups were inoculated with three different doses of the vaccine log 10 3.0/mL, log 10 4.0/mL and log 10 5.0/mL respectively.
One vaccine control group were inoculated with commercially available goatpox Vaccine, currently used for preventing LSDV disease in India. Another group kept as unvaccinated control group and were inoculated with sterile diluent PBS.
The animals are clinically examined daily, rectal temperatures and lesions are recorded till 30th day of vaccination. On 30th day after vaccination, the animals were serum sampled and inoculated with 2 ml of virus intravenously and 0.25 ml intradermally on both sides of flank region at two sites, so that a total of 3 ml of challenge virus is administered into each cattle. Rectal temperature and clinical observations were recorded on the following 14-21 days.
Further the blood samples are collected on 3, 7, 14 and 21 days for viremia to be assessed by PCR. Serum samples are collected on day 51 after vaccination and then tested by SNT.
Compared to Vaccinated animals, control and unvaccinated animals developed local and /or generalized skin nodule, fever and viremia specific to LSDV. The cattle groups which received three different doses of LSD vaccine, live attenuated (log103.0 , log104.0 and log105.0/dose) is found to be safe even at log105.0/ dose and efficacious and protected. Therefore, the heterologous commercial goat vaccine was not able to provide protection against Lumpy Skin disease virus disease.
Group Test Number of animals per group Different dose
1 Potency 6 Control vaccines (Commercial Goat Vaccine)
2 6 log 10 3.0/mL
3 6 log 104.0/mL
4 6 log 10 5.0/mL
5 Unvaccinated Control 6 Only PBS
Examples 9:
IMMUNIZATION
Eleven sera negative LSDV cattle (> 6 months) were chosen for safety and efficacy evaluation. The cattle were divided into 3 groups; group 1 with 5 cattle, group 2,3 with 3 cattle each.
Group 1 lot were vaccinated with 1X efficacy dose (103.5 TCID50) in 1 mL volume and group 2 with 10X safety dose (104.5 TCID50) in 1 mL volume by subcutaneous injection. The group 3 were kept as unvaccinated control animals and inoculated with sterile diluent PBS.
On day21 post-vaccination, sera collected from all 3 groups and then challenge virus (105.5 TCID50/mL) infection with 2 ml intravenously and 0.25 ml intradermally at 4 sites, two sites on both sides of flank region, so that a total of 3 ml of challenge virus is administered into each animal.
The blood samples are collected on 3, 7, 14 and 21 days post-challenge for viremia to be assessed by PCR. Serum samples are again collected on day 51 after vaccination towards end of challenge experiment and then tested by SNT.
All the vaccinated animals seroconverted and LSDV antibody titres were =1:32. The body temperature was within the range 37.80C - 38.9 0C; with no clinical signs of illness, local or systemic reactions. The feeding behaviour and overall health was found to be normal.
Post challenge the body temperatures were found higher in control group up to 40.20C. than vaccinated groups with severe local reactions. The group 1 and group 2 vaccinated animals developed mild local reactions for transient period.
The group 3 control animals developed generalised clinical signs of LSDV. No generalised LSDV infection and clinical signs were observed in vaccinated groups. Viremia observed in both control animals but not in the vaccinated animals. Therefore, the dosage of log103.5 TCID50 per animal is recommended.
Parameter Clinical Score for normal Clinical Score for adverse event Total Clinical Score
Fever 0 1 1
Feed intake / Anorexia 0 0.5 0.5
Water Intake/ Weakness 0 0.5 0.5
Viremia 0 1 1
Local reaction/ Local inflammatory response 0 0.5 0.5
Localized Skin Nodules 0 1 1
Generalized Skin Nodules 0 4 4
Total 8.5
Example 10:
Evaluation of Reversion to virulence of Lumpy skin disease Vaccine, live attenuated in Cattle
Twenty sera negative cattle for LSDV were segregated into 5 five lots with four animals per group. The 10X field dose (104.5 TCID50) of the LSDV live attenuated vaccine was injected in first lot (2 animals) by subcutaneous route and intradermal route. Remaining two animals was selected as sentinels to rule out the vaccine virus spread to in contact animals.
The blood samples (4ml) were collected up to 7th day from the day of administration of vaccine from each of the vaccinated animals and sentinels for checking viremia, if any. The local reaction scab, if any was also collected. The blood samples (300ul) was used to test the presence of virus by RT PCR. Remaining blood was feezed at -80OC.
After confirmation of virus, respective sample of blood/tissue homogenate was inoculated to second lot of animals. The procedure followed in lot 1 group was repeated for lot 2 group. Same procedure was repeated for the next three lots of animals also. Fifth lot of animals for development of LSD related disease specific clinical signs up to 14 days.
Virus was detected till second passage by RT PCR, however the virus could not be isolated in all the 5 passages in animals. No clinical signs of LSDV in any of the 5-back passages in cattle was observed.
Live attenuated lumpy skin disease virus has not reverted back to virulent LSDV. Hence safe to use LSD vaccine of Ranchi strain developed in India. Preliminary results suggested that both 10X field dose (104.5 TCID50) are safe to administer.
Example 11:
Evaluation of safety of Lumpy skin disease live attenuated Vaccine in Cattle
Vaccine produced was tested for its Safety to ascertain whether the vaccine is safe to use in animals without any adverse reaction in the vaccinated animals. Eighteen seronegative LSDV cattle (>6 month) divided into 9 groups, with 2 animals in each group were chosen for safety evaluation. All the groups were administrated with dose of (log 104.5/mL), and further subjected to clinical examination by daily monitoring the Rectal temperature, adverse local and generalized reactions and feeding behaviour and overall health the following 30 days.
All the animals had normal temperature (37.5-38.9°C), feeding behaviour and the overall health was found normal up to 30 days with no clinical signs of LSD. Therefore, the vaccine dosage tested for safety was found to be safe, without any adverse local or generalized reactions in the vaccinated animals even with 10 times (104.5 TCID50) vaccination doses.
,CLAIMS:1. A vaccine formulation for Lumpy skin disease (LSD) comprising lumpy skin disease virus antigen, and combination of one or more stabilizers selected from: amino acid-based stabilizers, Protein based stabilizers, sugar-based stabilizers, Sugar alcohol-based stabilizers, Polyethylene Glycol, Potassium dihydrogen phosphate, Potassium hydrogen phosphate and disodium phosphate and pharmaceutically acceptable carrier/diluent.
2. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the antigen is live attenuated lumpy skin disease virus.
3. A vaccine formulation for Lumpy skin disease as claimed in claim 2 wherein the said vaccine comprises of combination of one of more stabilizers to live attenuated lumpy virus in ratio of 1:3 to 1:1.
4. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein pharmaceutically acceptable carrier/diluent is IX PBS, 0.8% Sodium Chloride having the PH value of between 6.5 to 7.5.
5. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the diluent optionally contains PH indicator such as Phenol red indicator.
6. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises amino acid stabilizer such as L-glutamate at about 0.01% to 1%, preferably 0.083% - 1%.
7. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises Protein stabilizers such as gelatin at about 0.1% to 10%, preferably 0.3% - 2% or 5% to 10%; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% - 2.5%; Casein hydrolysate at about 5% to 20%, preferably 7% - 10%.
8. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises sugar-based stabilizer such as sucrose at about 2.5% to 10%, preferably 3% - 5%.
9. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises sugar alcohol-based stabilizer such as sorbitol at about 5% to 20%, preferably 15% to 20%.
10. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises stabilizer Polythene glycol at about 0.5% to 6%, preferably 1% - 3%.
11. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises stabilizers such as Potassium dihydrogen phosphate at molar range of 0.002M to 0.005M, preferably 0.0028M to 0.003M; Potassium hydrogen phosphate at range of 0.002M to 0.005M, preferably 0.0038 M to 0.004M and Di sodium phosphate at about 0.002M to 0.005M, preferably 0.0038M to 0.004M.
12. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%; L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%; gelatin at about 0.1% to 10%, preferably 0.3% to 2%; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5% ; Polythene glycol is present at about 0.5% to 6%, preferably 1% to 3%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
13. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%., casein hydrolysate at about 5% to 20%, preferably 7% to 10%, L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%, gelatin at about 0.1% to 10%, preferably 0.3% to 2%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%, Polythene glycol is present at about 0.5% to 6%, preferably 1% to 3%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
14. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%., gelatin at about 0.1% to 10%, preferably 0.3% to 2%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
15. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% to 5%; gelatin at about 0.1% to 10%, preferably 0.3% to 2%; lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%; casein hydrolysate at about 5% to 20%, preferably 7% to 10%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
16. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, and stabilizers selected from sucrose at about 2.5% to 10%, preferably 3% - 5%., gelatin at about 0.1% to 10%, preferably 0.3% - 2%; casein hydrolysate at about 5% to 20%, preferably 7% - 10%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M; and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
17. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, sucrose at about 2.5% to 10%, preferably 3% - 5%; L-glutamate at about 0.01% to 1%, preferably 0.083% - 1%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M – 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M – 0.004M.
18. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, sucrose at about 2.5% to 10%, preferably 3% - 5%; gelatin at about 0.1% to 10%, preferably 0.3% to 2%; L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%; Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
19. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, sucrose at about 2.5% to 10%, preferably 3% to 5%, lactalbumin hydrolysate at about 0.1% to 4%, preferably 1% to 2.5%; gelatin at about 0.1% to 10%, preferably 0.3% - 2%, L-glutamate at about 0.01% to 1%, preferably 0.083% to 1%, Potassium dihydrogen phosphate at 0.002M to 0.005M, preferably 0.0028M to 0.003M and Potassium hydrogen phosphate at 0.002M to 0.005M, preferably 0.0038 M to 0.004M.
20. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the formulation comprises live attenuated lumpy virus, sorbitol at about 5% to 20%, preferably 15% - 20%; gelatin at about 0.1% to 10%, preferably 5% - 10%; casein hydrolysate at about 5% to 20%, preferably 7% - 10% and Disodium phosphate at about 0.00035 to 0.014 M, preferably 0.0007 M – 0.007M.
21. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the said formulation is in the form of lyophilized formulation or frozen to be ready to reconstitute formulation or stable ready to use liquid vaccine formulation.
22. A vaccine formulation for Lumpy skin disease as claimed in claim 21 wherein dry formulation vaccine is stable at 50C±30C up to 12 months, at 250C±30C up to 6 months, at 350C ±20C up to 30 days and -200C.
23. A vaccine formulation for Lumpy skin disease as claimed in claim 21 wherein frozen formulation is stable at 50C±30C up to 12 months, at 250C±30C up to 6 months, at 350C ±20C up to 30 days and -200C.
24. A vaccine formulation for Lumpy skin disease as claimed in claim 21 wherein stable ready to use liquid vaccine is stable at 50C±30C up to 12 months, at 250C±30C up to 6 months, at 350C ±20C up to 30 days and -200C.
25. A vaccine formulation for Lumpy skin disease as claimed in claim 21 wherein moisture content of lyophilized formulation as per above mentioned embodiments is less than 5%, preferably 3% to 5%.
26. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the said formulation is in dry cake form.
27. A vaccine formulation for Lumpy skin disease of claim 19 comprising steps of mixing the combination of one of more stabilizers to live attenuated lumpy virus in 1:3 to 1:1 ratio and freeze drying.
28. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the said Lumpy Skin disease virus (LSDV) is of the family Poxviridae and genus Capri poxvirus.
29. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the said formulation is safe, effective and stable vaccine compositions to elicit immune response and protection against lumpy virus disease (LSD) in animals.
30. A vaccine formulation for Lumpy skin disease as claimed in claim 1 wherein the said formulation is safe, effective and stable vaccine compositions to elicit immune response and protection against lumpy virus disease (LSD) in Bovid.
31. A method of treating the disease caused by Lumpy Skin disease virus (LSDV) by administering a therapeutically effective amount of pharmaceutical vaccine formulation of claim 1 to cattle (Bos indicus and Bos taurus) and buffaloes (Bubalus bubalis).
32. A method of treating as claimed in claim 31 wherein the administration of vaccine formulation is by systemic administration, or by parenteral administration.
33. The method of treating as claimed in claim 31 wherein the administration volume is 0.2 and 2.0 mL, and 1.0 to 2.0 mL for intramuscular or subcutaneous administration.
34. A pharmaceutical vaccine formulation as claimed in claim 1 or 21 wherein the said vaccine composition comprises dry formulation or frozen formulation reconstituted with the pharmaceutical carrier/ diluent wherein virus titre per dose is from 10^3 TCID50/ml-10^5 TCID50/ml is efficacious in cattle.
35. A method to adapt and upscale the production of virus with high titters for large scale production of vaccine.
36. A method as claimed in claim 33 wherein upscaling live attenuated lumpy virus production, yielding high virus titre of not less than 10^6.5-7 TCID50/ml through cell stacks, Bioreactors using microbeads or microstrips and Roller drums.
37. A method as claimed in any of the preceding claims wherein virus titre loss is not more than 10^0.5 TCID50/ml after lyophilization.
38. A process of preparing live attenuated virus by using the Vero cells as the substrate by adapting the virus to cells, for further large-scale production of virus.
| # | Name | Date |
|---|---|---|
| 1 | 202341025034-STATEMENT OF UNDERTAKING (FORM 3) [01-04-2023(online)].pdf | 2023-04-01 |
| 2 | 202341025034-PROVISIONAL SPECIFICATION [01-04-2023(online)].pdf | 2023-04-01 |
| 3 | 202341025034-POWER OF AUTHORITY [01-04-2023(online)].pdf | 2023-04-01 |
| 4 | 202341025034-FORM 1 [01-04-2023(online)].pdf | 2023-04-01 |
| 5 | 202341025034-DRAWINGS [01-04-2023(online)].pdf | 2023-04-01 |
| 6 | 202341025034-DECLARATION OF INVENTORSHIP (FORM 5) [01-04-2023(online)].pdf | 2023-04-01 |
| 7 | 202341025034-Proof of Right [26-09-2023(online)].pdf | 2023-09-26 |
| 8 | 202341025034-PostDating-(28-03-2024)-(E-6-109-2024-CHE).pdf | 2024-03-28 |
| 9 | 202341025034-APPLICATIONFORPOSTDATING [28-03-2024(online)].pdf | 2024-03-28 |
| 10 | 202341025034-Request Letter-Correspondence [27-04-2024(online)].pdf | 2024-04-27 |
| 11 | 202341025034-Power of Attorney [27-04-2024(online)].pdf | 2024-04-27 |
| 12 | 202341025034-FORM 3 [27-04-2024(online)].pdf | 2024-04-27 |
| 13 | 202341025034-Form 1 (Submitted on date of filing) [27-04-2024(online)].pdf | 2024-04-27 |
| 14 | 202341025034-ENDORSEMENT BY INVENTORS [27-04-2024(online)].pdf | 2024-04-27 |
| 15 | 202341025034-DRAWING [27-04-2024(online)].pdf | 2024-04-27 |
| 16 | 202341025034-Covering Letter [27-04-2024(online)].pdf | 2024-04-27 |
| 17 | 202341025034-CORRESPONDENCE-OTHERS [27-04-2024(online)].pdf | 2024-04-27 |
| 18 | 202341025034-COMPLETE SPECIFICATION [27-04-2024(online)].pdf | 2024-04-27 |