Description:FORM 2
THE PATENT ACT, 1970
(39 OF 1970)
&
THE PATENTS RULES, 2003
COMPLETE SPECIFICATION
(See section 10 and rule 13)
1. Title of the invention: “Bioengineered copper oxide nanoparticles based coatings as a promising green approach for antiviral textiles”
2. Applicant:
NAME NATIONALITY ADDRESS
1. Marwadi University INDIAN Marwadi University, Rajkot-Morbi Highway, At Gauridad, Rajkot – 360003, Gujarat, India
2. Dr. Sejal Shah (GUJCOST Sponsored) Head & Associate Professor, Department of Computer Science and Bioscience, Faculty of Technology, Marwadi University, Rajkot - Gujarat, INDIA
3. Ms. Amisha Patel Department of Microbiology, School of Science, RK University, Rajkot-360020, Gujarat, INDIA
3. Preamble to the description
COMPLETE SPECIFICATION
The following specification particularly describes the invention and the manner in which it is to be performed:

Field of the Invention:
The present invention relates to bioengineered copper oxide nanoparticles-based coatings as a promising green approach for antiviral textiles. More specifically, the present invention relates to an antimicrobial/antiviral composition based on the copper oxide nanoparticles prepared from the Nigella sativa seed extract and Carica papaya leaf extract. The present invention also relates to the development of antimicrobial/antiviral textiles based on the antimicrobial property of the prepared copper oxide nanoparticles. The nanoparticles coated textile of the present invention is durable and sustain its antimicrobial properties up to 30 washes.
Background of the Invention:

Globally, the recent outbreak of coronavirus pandemic (i.e., COVID-19) and other emerging viral expansions have drawn attention to the design and develop the novel antimicrobial, antiviral and virucidal agents with a broad spectrum of antiviral and antibacterial activity. The spread of the infectious diseases caused by the viruses have constituted the forefront of global health concerns. The available therapeutics for COVID-19 such as drugs and vaccines have limited efficiency towards the genetic transformation of the viruses. Moreover, the efficacy of conventional antiviral therapies is gradually fading due to accelerated adaptations by peripheral viral proteins.

Recently, nanomaterials have paved their way as an effective antimicrobial and antiviral materials due to their extraordinary physico-chemical properties as compare to the conventional materials. Among all nanomaterials, metal oxide nanoparticles have been extensively studied as an effective candidate for numerous biomedical applications. Moreover, the elemental metal, Copper (Cu) has been very well adopted due to its broad spectrum of antimicrobial action against various bacteria, fungi, and viruses. Due to their versatility, Copper oxide nanoparticles (CuO NPs) have been already explored as an effective antimicrobial/antiviral coating material for biological surfaces in various forms such as wound dressings, medical devices, deodorant sprays, and fabrics. The CuO NPs have been also found to be effective against various human pathogenic viruses such as Respiratory syncytial virus (RSV), Influenza virus, Norovirus, and Hepatitis B virus (HBV) and Human immunodeficiency virus (HIV) and even SARS-CoV.

US10667521B2 discloses the antimicrobial material comprising synergistic combinations of metal oxides powders, comprising a mixed oxidation state oxide of a first metal and a single oxidation state oxide of a second metal, the powders being incorporated substantially uniformly within said polymer, wherein the powders have substantially different specific gravities and substantially similar bulk densities and wherein the ions of the metal powders are in ionic contact upon exposure of said material to moisture. There are further provided methods for the preparation of said materials and uses thereof, including in combating or inhibiting the activity of microbes or microorganisms.

US10717828B2 discloses the antimicrobial and antiviral polymeric master batch, processes for producing polymeric material therefrom and products produced therefrom comprising a slurry of thermoplastic resin, an antimicrobal and antifungal and antiviral agent consisting essentially of water insoluble particles of ionic copper oxide, a polymeric wax and an agent for occupying the charge of the ionic copper oxide.

US8183167B1 discloses the wash-durable, antimicrobial and antifungal textile substrates which are infused with or covalently bound to well-dispersed antimicrobial nanoparticles, such as silver and/or copper nanoparticles, which exhibit persistent and demonstrable bacteriocidal, bacteriostatic, fungicidal, fungistatic behavior through numerous wash cycles.

US20210352914A1 discloses the viral active and/or anti-microbial inks and coatings comprises (i) a carrier; (ii) graphene and/or graphene oxide particles dispersed in the carrier; and (iii) a viral active and/or anti-microbial component adhered to the graphene and/or graphene oxide particles.

CN203777163U discloses the novel antibacterial sanitary towel which comprises a sanitary towel body and wings on the two sides of the sanitary towel body. The sanitary towel body is composed of a surface anti-bacterial layer, an adsorption layer and a bottom layer, the wings on the two sides of the sanitary towel body are formed by connecting the surface layer and the bottom layer in an adhesive mode, and hydrochloric acid polyhexamethylene guanidine solutions are sprayed to the surface anti-bacterial layer of the sanitary towel body. Hydrochloric acid polyhexamethylene guanidine (PHMG) is used as sterilization disinfectants and is sprayed on the surface of the sanitary towel, and accordingly the novel antibacterial sanitary towel has the advantages of being safe, reliable, convenient to use and stable in antibacterial effect.

Based on the prior arts, there is no antimicrobial textile/fabric which is incorporated with environmentally friendly degradable materials for wash resistant antimicrobial properties. The cited prior arts deals with the use of toxic chemicals and also the sustainability of the fabric is also major concern. Hence, the present invention aimed to synthesize CuONps from two different plant sources and checked their antimicrobial (antibacterial and antiviral) potential. This composition is simple, cost effective, eco-friendly biological method for preparation of copper oxide nanoparticles for the development of antimicrobial textile which remains as it is even after multiple washes. Moreover, the CuO NPs have shown the demonstrated the ability to kill SARS-CoV and would be beneficial to inhibit the SARS-CoV-2 virus effectively. The copper oxide nanoparticles (CuONPs) have microbicidal property, it will be sprayed on fabric. This is recyclable, eco-friendly, low cost, scalable synthetic approach as anti-covid fabric technology. Anti covid fabric phase I for face mask followed by PPE at phase II if we get succeed. It also provides hydrophobicity on the fabric surface will be a value addition.

Object of the Invention:
The main objective of present invention is to synthesize eco-friendly, cost-effective and biogenic copper oxide nanoparticles using Nigella sativa seed extract and Carica papaya leaf extract as precursors.

Another objective of the present invention is to characterize the copper oxide nanoparticles using UV-Visible spectrophotometer, FT-IR (Fourier Transform Infrared), XRD (X-Ray diffraction), TEM (Transmission Electron Microscopy) and XPS (X-Ray Photoelectron Spectroscopy).

Yet another objective of the present invention evaluates the antimicrobial and antiviral activities of copper oxide nanoparticles against gram (+) and gram (-) bacterial and viral strains, respectively.

Yet another objective of the present invention is to develop copper oxide nanoparticles based antiviral coatings on fabrics to prevent the transmission of viral particulates.
Yet another objective of the present invention is to ascertain the cytotoxicity of the prepared coatings on fabrics/textiles and assess its antiviral properties and filtering efficiency.

Yet another objective of the present invention is to identify the tensile strength of the fabric/textile coated with the copper oxide nanoparticles.

Yet another objective of the present invention is to optimize & validate shelf life of the bioengineered face mask and decontamination technique for the re-use of masks.
Yet another objective of the present invention is to develop comfortable, cost-effective and re-usable facemask which would be fit to individuals of any age group including children below 12 years.
Summary of the Invention:

The present invention relates to bioengineered copper oxide nanoparticles-based coatings as a promising green approach for antiviral textiles. Especially, the present invention is related to the preparation of copper oxide nanoparticles from the Nigella sativa seed extract and Carica papaya leaf extract. The present invention, the prepared CuO NPs were coated on the cotton fabric using dip coating machine.

Brief Description of drawings:

For the better understanding of the present invention, there are shown in the drawings as below:

Figure 1 shows the synthesis of copper oxide nanoparticles (CuO NPs) using Nigella sativa seed extract as precursor.
Figure 2 shows the UV–Visible spectrum of CuO NPs synthesized from Nigella sativa seed extract.
Figure 3 shows the FT-IR spectrum of CuO NPs synthesized from Nigella sativa seed extract.
Figure 4 shows the PXRD pattern of CuO NPs synthesized from Nigella sativa seed extract and Carica papaya leaf extract.
Figure 5 shows the XPS sepctra of CuO NPs (a) XPS survey showing Cu, O and C, (b) XPS spectra of Cu and (c) XPS spectra of O1s.
Figure 6 shows the TEM and EDAX analysis of CuO NPs obtained from (a-c) Carica papaya seed extract and (d-f) Nigella sativa seed extract.
Figure 7 shows the antimicrobial activity for CuO NPs of Nigella sativa against Gram’s Positive and Gram’s Negative strains.
Figure 8 shows the antimicrobial activity for CuO NPs of Nigella sativa against (A. Bacillus subtilis, B. Bacillus thuringiensis, C. Bacillus epidermis, D. Stayphylococcus aureus, E. Pseudomas aeruginosa, F. Serratia, G. Klebsiella pneumonia and H. E. coli).
Figure 9 shows the antimicrobial activity for CuO NPs of Carica papaya against Gram’s Positive and Gram’s Negative strains.
Figure 10 shows the antimicrobial activity for CuO NPs of Carica papaya against (A. Bacillus subtilis, B. Bacillus thuringiensis, C. Bacillus epidermis, D. Stayphylococcus aureus, E. Pseudomas aeruginosa, F. Serratia, G. Klebsiella pneumonia and H. E. coli).
Figure 11 shows the antimicrobial activity for CuO NPs of Nigella sativa coated cotton fabric against (A. Bacillus subtilis, B. Bacillus thuringiensis, C. Bacillus epidermis, D. Stayphylococcus aureus, E. Pseudomas aeruginosa, F. Serratia, G. Klebsiella pneumonia and H. E. coli).
Figure 12 shows the antimicrobial activity for CuO NPs of Carica papaya coated cotton fabric against (A. Bacillus subtilis, B. Bacillus thuringiensis, C. Bacillus epidermis, D. Stayphylococcus aureus, E. Pseudomas aeruginosa, F. Serratia, G. Klebsiella pneumonia and H. E. coli).
Figure 13 shows flow chart for preparation of copper oxide nanoparticles-based coating material

Detailed Description of the Invention:
Various aspects of the present application will be described in detail in connection with the accompanying drawings, in order to provide a better understanding of the present invention.
Green synthesis of copper oxide nanoparticles (CuO NPs)
Preparation of Nigella sativa seed extract
Nigella sativa seeds were thoroughly washed with running tap water to remove dust particles followed by dried in sunlight to remove the moisture. The seed extract was prepared by placing 5.0 gm of dried seed powder in 100 ml of sterile distilled water followed by the boiling of mixture at 60°C for 20 minutes. The mixture was cooled at room temperature and filtered out with Whatman No. 1 filter paper and stored at room temperature.
Preparation of Carica papaya leaf extract
The Carica papaya leaves were washed with distilled water and dried to remove the residual moisture for the formulation of the extract. The dried leaves were finely ground using a mixer. The leaf extract was prepared by using 6.0 gm of dried powder in 100 ml of sterile distilled water followed by the boiling of mixture at 60°C for 10 minutes with continuous stirring. The mixture was cooled at room temperature and filtered out with Whatman No. 1 filter paper and stored at room temperature.
Synthesis of copper oxide nanoparticles from Nigella sativa seed extract
CuO Nano-powder was prepared by the Sol-Gel method by using Copper Sulfate pentahydrate (CuSO4.5H2O), Sodium hydroxide (NaOH), and Nigella sativa seed extract. Briefly, 100 ml of aqueous solution of 2.0 M CuSO4.5H2O and 50 ml of Nigella sativa seed extract was heated at 80°C with constant stirring which resulted in the color change from blue to black. Then, 0.1 M NaOH was added to the resultant mixture in order to maintain pH within the range of 9 to 12). The precipitated nanoparticles were centrifuged at 1800 rpm for 5 minutes followed by the washing with the distilled water and methanol and filtered with Whatman No.1 filter paper. Subsequently, the washed precipitate was dried at 80°C for overnight. Finally, the product was calcined at 800°C for 3 hrs. The black colored copper oxide nanoparticles were collected and stored for further analysis. Figure 2 shows the synthesis of copper oxide nanoparticles (CuO NPs) using Nigella sativa seed extract as precursor.
Synthesis of copper oxide nanoparticles from Carica papaya leaf extract
CuO NPs were synthesized using reduction process via addition of 0.01 M CuSO4 solution to the Carica papaya leaf extract in the ratio of 95:5 (v/v) with the 15 min of continuous stirring followed by the 5-10 min incubation at room temperature to get the colloidal suspension which turned green from blue with brownish-black precipitate. Further, the resultant mixture was centrifuged and washed several times with distilled water and dried at 50°C in a hot air oven to obtain the CuO NPs. Based on the color change and other characterization techniques, it was observed that the Carica papaya leaves have the best reduction capability against copper sulfate when compared to other parts of the plants (seeds and fruit).
Characterization of copper oxide nanoparticles (CuO NPs) prepared from Nigella sativa seed extract
UV-Visible analysis
The bioreduction of CuSO4 to CuO NPs from Nigella sativa was monitored periodically by UV– visible spectroscopy (Figure 2). The sharp peak at 274 nm could be attributed to the CuO NPs with smaller particle size. The position and sharp peak could arise due to the following factors, (i) an increase in the reducing agent concentration, (ii) pH of the solution, (iii) size of the nanoparticles and, (iv) stabilizing agent used for the synthesis.
FT-IR analysis
Fourier transform infrared (FTIR) spectroscopy was used to identify the possible biomolecules, and the functional group was responsible for the reduction of Cu+2 ions and capping of the reduced CuO NPs. FT-IR samples were prepared by mixing 1% (w/ w) specimen with 100 mg of KBr powder and pressed into a sheer slice. An average of 32 scans were collected for each measurement with a resolution of 2 cm-1. The FT-IR spectrometric readings were recorded in the range of 4000–650 cm-1 (Figure 3).
Powder X-ray diffraction analysis (PXRD)
The materials purity and crystallinity of the CuO NPs were analyzed by subjecting the NPs to the X-ray diffractometer with a scan rate ranging from 5 to 80o. The obtained PXRD spectra is a base centered monoclinic phase of CuO (tenorite) nanoparticle which corresponds to the JCPDS card number 48-1548. As evidenced from Figure 4, it is clear that the synthesized CuO nanoparticles from Nigella sativa seed and Carica papaya leaf extract are pure and highly crystalline in nature. The crystallite size of CuO NPs derived from Nigella sativa seed was smaller than the CuO NPs derived from Carica papaya leaf extract (Figure 4).
X-ray Photoelectron Spectroscopy (XPS) analysis
The synthesized CuO NPs were characterized by XPS in order to gain a better knowledge of the chemical and oxidation states of the synthesized CuO NPs (Figure 6). According to the results of the XPS survey depicted in Figure 6a, Cu, O, were present with C as a reference. Using the distinctive peaks at 933.5 eV and 953.4 eV, it was determined that the presence of Cu 2p3/2 and Cu 2p1/2, which are the features of the Cu2+ ion. In addition, the presence of CuO composite was confirmed by the presence of satellite peaks positioned at 941 eV, 943.3 eV, and 961.9 eV, which was observed in Figure 6b. The presence of O1s, was confirmed by the peaks situated at 529.5 eV, which also refers to the Cu-O bond. The oxygen atoms in the -OH groups of the copper oxide surface could be responsible for the peak observed at 530.9 eV (Figure 5c).
Morphological analysis
The CuO NPs derived from seed extract and leaf extract were characterized by TEM and EDAX analysis to understand the morphology of the nanoparticles. It was observed that the synthesized nanoparticles are highly agglomerated and they tend to form clusters (Figure 6). The TEM analysis revealed that the structure of CuO NPs obtained from seed extract and leaf extract are irregular and possesses different sizes which vary from 15 to 50 nm. The EDAX spectra clearly indicated the purity of the nanoparticles with no impurities and confirming that the CuSO4. 5H2O completely reduced to CuO.

Antimicrobial activity of CuO NPs:
Antimicrobial potential of CuO NPs with standard antibiotic tetracycline was tested against various gram-positive strains such as Bacillus subtilis, Bacillus thurungiensis, Bacillus epidermis, Staphylococcus aureus and gram-negative strains such as Pseudomonas aeruginosa, Serratia, E.coli., Klebsiella pneumonia by using standard agar well diffusion method. All the organisms were inoculated in Luria-Bertani (LB) broth medium and kept overnight at 37°C and 180 rpm in the orbital shaker. 100 µl overnight grown activated cultures was spread on LB agar plates. To check antimicrobial potential agar wells were inoculated with 30 µl distilled water as a negative control, antibiotic tetracycline (30 µg/disk) as a positive control, 30 µl of plant extract, 30 µl 0.01 M CuSO4 solution and 30 µg/ml CuO NPs synthesized from Nigella sativa and Carica papaya plant extract. The plates were incubated for 24 hours at 37° C followed by the observation of zone of inhibition on the next day.
It was observed that the CuO NPs derived from the Nigella sativa seed extract (Table 1) and Carica papaya leaf extract (Table 2) have higher antimicrobial potential as compared to their plant extract and similar antimicrobial activity with positive control tetracycline. (Figure 8 & 10) The contrast in size for the zone of inhibition might be due to the cell wall composition of gram-positive and gram-negative bacteria.
Table 1: Antimicrobial activity of CuO NPs derived from Nigella sativa
Zone of Inhibition (mm)
Organisms CuO NPs CuSO4 Plant
extract Tetracycline Distilled
water
Bacillus subtilis 4 15 1 3 0
Bacillus
thuringiensis 2 8 1 3 0
Bacillus epidermis 3 9 2 3 0
Stayphylococcus
aureus 0 5 0 2 0
Pseudomas
aeruginosa 2 5 1 3 0
Serratia 0 6 0 0 0
Klebsiella
pneumoniae 2 5 1 3 0
E.coli 2 8 1 3 0

Table 2: Antimicrobial activity of CuO NPs derived from Carica papaya
Zone of Inhibition (mm)
Organisms CuO NPs CuSO4 Plant
extract Tetracycline Distilled
water
Bacillus subtilis 5 12 2 4 0
Bacillus
thuringiensis 1 4 0 3 0
Bacillus epidermis 3 6 1 2 0
Stayphylococcus
aureus 3 6 1 4 0
Pseudomas
aeruginosa 2 6 0 3 0
Serratia 2 5 1 0 0
Klebsiella
pneumoniae 3 5 0 3 0
E.coli 3 4 1 3 0

Main objective of the present invention, a Bioengineered copper oxide nanoparticles based coatings as a promising green approach for antiviral textiles comprising of:
(a) Copper Oxide nanoparticles prepared from Nigella sativa seed extract and Carica papaya leaf extract; and
(b) Cotton fabric has size of 1cm X 1cm and concentration is 30 µg/mL;
Wherein said nanoparticles coated textile is durable, eco-friendly, cost-effective, comfortable, re-usable and sustain antimicrobial properties up to 30 washes.
Another embodiment of the present invention, the antiviral copper oxide nanoparticles for coatings is prepared from Nigella sativa seed extract comprising the steps of:
(a) Heating of 100 ml of aqueous solution of 2.0 M CuSO4.5H2O and 50 ml of Nigella sativa seed extract at 80°C with constant stirring;
(b) Maintaining the pH from 9-12 of the reaction using 0.1 N NaOH until the precipitation of nanoparticles with black color indicating successful formation of copper oxide nanoparticles;
(c) Centrifugation of the mixture at 1800 rpm for 5 minutes followed by the filtration;
(d) Overnight drying at 80?C followed by the calcination at 800?C for 3 hrs to obtained oxide nanoparticles.
Another embodiment of the present invention, the antiviral copper oxide nanoparticles for coatings is prepared from Carica papaya leaf extract comprising the steps of:
(a) Addition of 0.01 M CuSO4.5H2O and Carica papaya leaf extract extract in the volume ratio of 95:5 by a reduction process;
(b) Stirring for 15 minutes followed by the 5-10 min incubation at room temperature resulting the color change from blue to brownish-black precipitate which confirms the formation of copper oxide nanoparticles; and
(c) Centrifugation of the mixture and followed by the drying at 50?C.
Another embodiment of the present invention, the coated cotton fabric is dried in hot –air oven for 15-20 min at 80?C.
Another embodiment of the present invention, the warpwise and weftwise tensile strength of copper oxide nanoparticles coated fabric is 375.47 N and 434.55 N respectively.
Another embodiment of the present invention, copper oxide nanoparticles synthesized from Nigella sativa seed extract exhibit high anti-viral potential and higher tensile strength.
Evaluation of antimicrobial activity of CuO NPs coated cotton fabric
1cm X 1cm sized cotton fabric coated with the colloidal solution of CuO NPs (30 µg/ml) derived from Nigella sativa and Carica papaya using dip coating instrument and dried in hot air oven for 15-20 min at 80° C. Antimicrobial activity of CuO NPs coated cotton fabric was assessed against gram-positive strains such as Bacillus subtilis, Bacillus thurungiensis, Bacillus epidermis, Staphylococcus aureus and gram-negative strains such as Pseudomonas aeruginosa, Serratia, E.coli., Klebsiella pneumonia. Briefly, 100 µl overnight grown activated bacterial culture spread over Luria-Bertani (LB) agar plates and each one of CuO NPs coated cotton fabric was placed at the centre of agar plates and plates were incubated for 24 hours at 37° C followed by the observation of zone of inhibition.
Usually normal cotton fabric doesn’t exhibit any bactericidal potential and accumulates the bacterial growth besides that CuO NPs coated cotton fabric shows tremendous antibacterial potential. Certain studies on CuO NPs reveals that Cu+2 ion discharge from the CuO NPs interact with cell membrane of microorganisms and leads to rapid degradation of DNA moreover bacterial respiration also decreased. In certain gram’s negative microbes copper ion change the electron transferase and conformation of reduces and prevent the cytochrome in the cell membrane. In addition, CuO NPs disrupt the cell wall and destruction of the cell membrane occurs, this phenomenon induces the death of microbes. Current study proves that CuO NPs synthesized from Nigella sativa (Figure 11) and Carica papaya (Figure 12) using green chemistry approach exhibit effective bactericidal potential on cotton fabric. (Table 3).
Table 3: Antimicrobial activity of CuO NPs coated cotton fabric
Zone of Inhibition (mm)
Organisms CuO NPs
Nigella sativa CuO NPs
Carica papaya
Bacillus subtilis 3 5
Bacillus thuringiensis 4 2
Bacillus epidermis 0 3
Stayphylococcus aureus 5 4
Pseudomas aeruginosa 4 4
Serratia 3 2
Klebsiella pneumoniae 0 3
E.coli 7 5

Measurement of tensile strength of CuO NPs coated cotton fabric
Tensile strength of 5cm X 20 cm sized CuONPs coated fabric and Non-coated fabric was measured with the Universal testing machine (UTM) by using ISO 13934-1 test method. Warp wise and weft wise tensile strength were measured.
It was observed that the wrapwise and weftwise tensile strength of non-coated fabric is 354.21 N and 222.23 N respectively, whereas warpwise and weftwise tensile strength of CuO NPs coated fabric is 375.47 N and 434.55 N respectively.
Table 4: Tensile strength of Non-coated and CuO NPs coated cotton fabric
Sample Warpwise Weftwise
Noncoated fabric 354.21 222.23
Coated fabric 375.47 434.55

Cell line and virus
Vero (African green monkey kidney epithelial cells) cell line was procured from NCCS, Pune. Cells were maintained in Dulbecco’s modified Eagle’s medium, supplemented with 10% Fetal bovine serum (FBS), Gentamycin and Penicillin-streptomycin. ILS-03 strain of SARS-CoV-2 was successfully adapted and isolated in Vero cells at ILS, Bhubaneswar and used for the study.
Cytotoxicity Assay
MTT assay was performed to determine the cytotoxicity of CuNS1 (Copper nanoparticles from Nigela Sativa plant) and CuCP1 (Copper nanoparticles from Carica papaya plant) (ILS-BV 2021-033) using EZcount™ MTT cell assay kit in Vero cells according to the manufacturer’s protocol. In brief, Vero E6 cells were seeded in a 96 well plate at the density of approximately 10000 cells per well. After reaching 70% confluency, cells were treated with different concentrations of CuNS1 and CuCP1 in triplicate form in the respective wells along with DMSO as a reagent control. After 22 hours, plate was washed with 1X PBS and subsequently 10µl MTT reagent (5.0 mg/mL) was added to the cells and incubated for 2-3 hours at 37?C. Next, the media was removed and 100µl of solubilization buffer was added followed by incubation at 37°C for 15 min to dissolve the Formazan crystals. Finally, the absorbance was measured at 570 nm wavelength using a multimode plate reader and the metabolically active cell percentage was compared with the control cells to determine the cellular cytotoxicity. For infection, the Vero cells were infected with SARS-CoV2-19 as per the protocol mentioned in the website. After infection, the cells were treated with 10 µg/ml of CuNS1 and CuCP1, whereas Fabric coated with NSCF1 (Nigela Sativa cotton fabric 1 composition) was directly placed in the cell, followed by collection of respective supernatants at 22 hpi.
It was observed that the maximum non-toxic dose of CuNS1 and CuCP1 was obtained at 10µg/ml. (80% and 85% of viability respectively)
Table 5: MTT assay
Sr. No. Compounds Concentration % Cell Viability
1 CuNS1 1 µg/mL >90%
2 CuNS1 5 µg/mL >90%
3 CuNS1 10 µg/mL 80%
4 CuNS1 50 µg/mL 53%
5 CuCP1 1 µg/mL 90%
6 CuCP1 5 µg/mL 90%
7 CuCP1 10 µg/mL 85%
8 CuCP1 50 µg/mL 60%

The MTT assay is a colorimetric assay for assessing cell metabolic activity. The MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide] Assay.
Viral Infection
At 80% confluency, Vero cells were infected with SARS-CoV-2 at Multiplicity of Infection (MOI) 0.1 followed by 90 min incubation with shaking at every 10 to 15 min interval. After infection, the cells were washed with 1X sterile PBS followed by treatment with 10 µg/mL of CuNS1 and CuCP1, diluted in complete DMEM. In case of Fabric coated with NSCF1, the fabric was placed into cells after PBS-wash. Remdisivir (100 µM) was taken as a positive control. The supernatants were collected for RNA extraction at 22 hours post infection (hpi).
RNA extraction and qRT-PCR:
To determine the viral copy number and anti-viral effect, qRT-PCR was performed. For this, viral RNA was isolated from the supernatants using the TAN Bead Maelstrom 4800 automated RNA extraction platform and cDNA was synthesized using random hexamers by the Prime Script First strand cDNA synthesis kit. The synthesized cDNA was used to amplify the Nucleocapsid (NC) gene using specific primers [Nucleocapsid Forward Primer (NCFP): GTAACACAAGCTTTCGGCAG and Nucleocapsid Reverse Primer (NCRP): GTGTGACTTCCATGCCAATG)] by qRT-PCR. The viral copy number was determined for the above-mentioned samples by generating the standard curve of SARS CoV-2 NC gene. The percentage of copy number/mL was calculated from the corresponding Ct values of all the samples.
It was observed that the mean Ct value of positive control is 25.6 whereas the percent reduction of Viral copy number with Remdisivir (Positive control) was found to be approximately 99.99% as compared to control.
Table 6: Mean Ct Value
Sample Concentration Ct value Copy number/ml % inhibition
Infection (0.1 MOI) 25.6 38196.42
CuNS1 10 µg/ml 27.8 8992.53 76
CuCP1 10 µg/ml 27.3 12492.26 67

CuONPs have been successfully synthesized using N.Sativa seed extract and C. papaya leaf extract. Various characterization techniques were used to study CuONPs morphology, structure and mechanical properties. CuoNPs synthesized from N.sativa seed extract exhibit high anti-viral potential. Moreover, cotton fabric coated with CuoNPs from N. sativa has shown higher tensile strength. Hence, fabric coated with CuONPs with N. sativa might be used to prepare the anti-viral mask. , Claims:We claim,
1. A Bioengineered copper oxide nanoparticles based coatings as a promising green approach for antiviral textiles comprising of:
(a) Copper Oxide nanoparticles prepared from Nigella sativa seed extract and Carica papaya leaf extract; and
(b) Cotton fabric has size of 1cm X 1cm and concentration is 30 µg/mL;
Wherein said nanoparticles coated textile is durable, eco-friendly, cost-effective, comfortable, re-usable and sustain antimicrobial properties up to 30 washes.
2. The bioengineered copper oxide nanoparticles based coatings as claimed in claim 1, wherein the antiviral copper oxide nanoparticles for coatings is prepared from Nigella sativa seed extract comprising the steps of:
(a) Heating of 100 ml of aqueous solution of 2.0 M CuSO4.5H2O and 50 ml of Nigella sativa seed extract at 80°C with constant stirring;
(b) Maintaining the pH from 9-12 of the reaction using 0.1 N NaOH until the precipitation of nanoparticles with black color indicating successful formation of copper oxide nanoparticles;
(c) Centrifugation of the mixture at 1800 rpm for 5 minutes followed by the filtration;
(d) Overnight drying at 80?C followed by the calcination at 800?C for 3 hrs to obtained oxide nanoparticles.
3. The bioengineered copper oxide nanoparticles based coatings as claimed in claim 1, wherein the antiviral copper oxide nanoparticles for coatings is prepared from Carica papaya leaf extract comprising the steps of:
(a) Addition of 0.01 M CuSO4.5H2O and Carica papaya leaf extract extract in the volume ratio of 95:5 by a reduction process;
(b) Stirring for 15 minutes followed by the 5-10 min incubation at room temperature resulting the color change from blue to brownish-black precipitate which confirms the formation of copper oxide nanoparticles; and
(c) Centrifugation of the mixture and followed by the drying at 50?C.
4. The bioengineered copper oxide nanoparticles based coatings as claimed in claim 1, wherein the coated cotton fabric is dried in hot –air oven for 15-20 min at 80?C.
5. The bioengineered copper oxide nanoparticles based coatings as claimed in claim 1, wherein the warpwise and weftwise tensile strength of copper oxide nanoparticles coated fabric is 375.47 N and 434.55 N respectively.
6. The bioengineered copper oxide nanoparticles based coatings as claimed in claim 1, wherein copper oxide nanoparticles synthesized from Nigella sativa seed extract exhibit high anti-viral potential and higher tensile strength.

Dated 25th Apr, 2023

Chothani Pritibahen Bipinbhai
Reg. No.: IN/PA-3148
For and on behalf of the applicant