Abstract: The present disclosure relates to a biosensor based system for identifying a strain of a gram negative bacterium in a sample for nucleic acid based detection of an infection and antimicrobial resistance. The system can comprise a sensor including one or more carbon-based electrodes screen printed on a paper and a set of hybridization probes comprising a capture probe and a detector probe. The hybridization probe may include oligonucleotides capable of independently hybridizing with each strand of the pair of strands of target nucleic acid sequence obtained after cell lysis of the bacterium to form a three-dimensional complex between the target nucleic acid and the set of hybridization probes, which is detected by the one or more electrodes by the oxidation-reduction process that enables generation of an electrical signal for identifying the strain of the gram negative bacterium in the sample.
[0001] The present disclosure pertains to a biosensor-based system to detect infection. In particular, the present disclosure provides a biosensor-based system for identifying infection causing strain of gram negative bacterium for performing nucleic acid based detection of an infection and drug resistance caused by the bacterium.
BACKGROUND
[0002] The background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.
[0003] Infections are one of the major causes of mortality all over the world, especially in third world countries. Intensive care units (ICUs) are an important source of infection in a country like India. Mortality rate due to infection is high and is still increasing due to misuse of antibiotics. To prevent infection, there are basically seven classes of antibiotics which are available and all of them are essentially based upon five types of mechanism of action that is on a cell wall, cell membrane, nucleic acid, ribosomal unit and folate synthesis. In 2010, India was the world’s largest consumer of antibiotics for human health. Due to over usage of these antibiotics, bacteria developed drug resistance using the same mechanism, on which drugs were discovered including an extended spectrum beta-lactamase (ESBL) resistance, carbapenems resistance and other types of resistance.
[0004] Being such a serious challenge, infection detection is still dependent on techniques such as bacterial culture, polymerase chain reaction (PCR), sequencing, matrix-assisted laser desorption/ionization (MALDI), which are very time consuming, lengthy, cumbersome, labour intensive and extremely costly, requiring highly specialized set up with very expensive instruments. Yet, such techniques and instruments do not provide results in shorter duration. Owing to these reasons, such instruments cannot be deployed in rural set-up and in urban regions for mass sample detection. Further, identification of gram-negative bacterium like Pseudomonas aeruginosa which is one of the top five organisms causing severe infection in ICU’s is even more problematic. The bacterial surface factors such as flagella, pili and lipopolysaccharide as well as active processes such as the secretion of toxins, biofilm formation, and quorum sensing are virulence determinants that impact the outcome of the detection test results and may give false positive. Besides, there are challenges with existing tools and techniques in discriminating between wild type strains, pathogenic strain, and drug resistant bacterial strains for detection of infection as well as drug resistance.
[0005] Therefore, there exists an urgent need to provide a point of care system which can identify various strains of gram negative bacteria to detect infection and antibiotic resistance and provide qualitative and quantitative test results in a simple, cost-effective and instantaneous manner.
OBJECTS OF THE PRESENT DISCLOSURE
[0006] Some of the objects of the present disclosure, which at least one embodiment herein satisfies are as listed herein below.
[0007] It is an object of the present disclosure to provide a biosensor based system for detection of a strains of gram negative bacteria.
[0008] It is an object of the present disclosure to provide a biosensor based system that can discriminate between wild type bacterial strain, pathogenic strain(s) and antibiotic resistant strains.
[0009] It is an object of the present disclosure to provide a system that can perform nucleic acid based detection of an infection and antibiotic resistance in shorter duration (within 2 hour).
[00010] It is an object of the present disclosure to provide biosensor-based system that can detect pathogenic and antibiotic resistant strains with high specificity and in cost effective manner.
[00011] It is an object of the present disclosure to provide a biosensor-based system with a simpler set-up that can be used in urban as well as rural areas for bulk detection of infection, or antibiotic resistance, or both.
[00012] It is an object of the present disclosure to provide a system that can be used as a point of care system/device for fast detection of infection or antibiotic resistance to enable a physician to arrive at an immediate and appropriate treatment regimen.
SUMMARY
[00013] In an aspect, the present disclosure provides a biosensor based system for identifying a strain of a gram negative bacterium in a sample for nucleic acid based detection of at least one of an infection and antimicrobial resistance caused by the bacterium due to prophylactic antibiotic course. The system includes a sensor including one or more carbon-based working electrodes capable of undergoing an oxidation-reduction process; and a set of hybridization probes. The working electrodes may be screen printed on a paper and may be functionalized with at least one protein selected from streptavidin and avidin. The set of hybridization probes may include at least one capture probe and at least one detector probe. The capture probe may be localized on the one or more working electrodes by conjugation interaction between biotin in the capture probe and the at least one protein functionalized the working electrode, The capture probe can include a first oligonucleotide sequence including a single-stranded oligonucleotide tagged with biotin and the detector probe can include a second oligonucleotide sequence including a single-stranded oligonucleotide tagged with fluorescein. In an embodiment, each of the first oligonucleotide sequence and the second oligonucleotide sequence can be single-stranded oligonucleotides that may be complimentary to each strand of a pair of strands in a target nucleic acid sequence of a gene corresponding to the strain of the gram negative bacterium, wherein each of the first oligonucleotide sequence and the second oligonucleotide sequence may be capable of independent hybridization with each strand of the pair of strands of target nucleic acid sequence obtained after cell lysis of the gram negative bacterium, wherein if the target nucleic acid sequence corresponding to the strain of the gram negative bacterium is present in the sample, the independent hybridization may occur that forms a three-dimensional complex between the target nucleic acid and the set of hybridization probes. The formation of the three-dimensional complex can be detected by the one or more electrodes by the oxidation-reduction process that may enable generation of an electrical signal for identifying the strain of the gram negative bacterium in the sample in the nucleic acid based detection of at least one of the infection and antimicrobial resistance caused by the bacterium selected from a strain of E.coli, Klebsiella pneumoniae and Pseudomonas aeruginosa that can be key dominating bacteria of many infections.
[00014] In an embodiment, the system can be used for identifying antibiotic resistant strain selected from wild type strain, an antibiotic resistant bacterial strain, a multidrug-resistant (MDR), extensively drug-resistant (XDR), and pan drug-resistant (PDR) strains of the gram negative bacteria.
[00015] In an embodiment, the first oligonucleotide sequence may be a single-stranded oligonucleotide tagged with biotin at 5-’ or 3’- end of the oligonucleotide, and wherein the second oligonucleotide may be a single-stranded oligonucleotide tagged with fluorescein at 5-’ or 3’- end of the oligonucleotide.
[00016] In an embodiment, the detection of the sample for identifying the gram negative bacteria may be done in a time duration in the range of 1 minute to 120 minutes. In an embodiment, the sample may be a biological fluid selected from blood, urine and other biological fluids of a body. In an embodiment, the detection of the formation of the three-dimensional complex can be done by using one or more reagents selected from any or a combination of anti-fluorescein monoclonal Fab fragment, horseradish peroxidase, a buffer and detection reagents.
[00017] In another aspect, the present disclosure provides a kit for identifying a strain of a gram negative bacterium in a sample for nucleic acid or nucleic acid based biosensor detection of an infection and antimicrobial resistance. The kit can include a cocktail mixture capable of lysing the gram negative bacterium and releasing nucleic acid in a biological sample in a time period in the range of 20 to 40 minutes, wherein the cocktail mixture can include a combination of 1M sodium hydroxide solution, 10% Tween, 20mM Tris(hydroxymethyl)aminomethane hydrochloride (Tris HCl), 1 mM EDTA, Lysozyme (10mg/ml) in 10mM tris HCL in a volume ratio of 1:1:1:0.5:0.25; a panel of hybridization probes and one or more reagents, wherein the panel of hybridization probes can include capture probes and detector probes, each of the probes including one or more oligonucleotides complementary to and capable of independent hybridization to a target nucleic acid sequences of a gene corresponding to the bacterium for identification of infection causing and drug resistant strain(s) of the gram negative bacteria selected from E.coli, Klebsiella pneumoniae and Pseudomonas aeruginosa. The one or more reagents can be selected from any or a combination of streptavidin, biotin, anti-fluorescein monoclonal Fab fragment, horseradish peroxidase, a buffer and detection reagents.
[00018] The system and kit of the present disclosure provides a convenient, rapid and cost-effective way of identifying a strain of gram negative bacteria in a sample for detection of an infection and antimicrobial resistance.
[00019] Various objects, features, aspects and advantages of the inventive subject matter will become more apparent from the following detailed description of preferred embodiments.
BRIEF DESCRIPTION OF DRAWINGS
[00020] The accompanying drawings are included to provide a further understanding of the present disclosure, and are incorporated in and constitute a part of this specification. The drawings illustrate exemplary embodiments of the present disclosure and, together with the description, serve to explain the principles of the present disclosure.
[00021] The diagrams are for illustration only, which thus is not a limitation of the present disclosure, and wherein:
[00022] FIGs. 1A-1C illustrate cyclic voltammetry data in detection of an infection due to Pseudomonas aeruginosa, E.coli and Klebsiella pneumoniae respectively, in accordance with an embodiment of the present disclosure.
[00023] FIGs. 2A-2C illustrate cyclic voltammetry data in detection of antimicrobial resistance due to Pseudomonas aeruginosa, E.coli and Klebsiella pneumoniae respectively, in accordance with an embodiment of the present disclosure.
[00024] FIGs. 3A-3C illustrate cyclic voltammetry data in universal probe based detection of Pseudomonas aeruginosa, E.coli and Klebsiella pneumoniae respectively, in accordance with an embodiment of the present disclosure.
DETAILED DESCRIPTION
[00025] The following is a detailed description of embodiments of the present disclosure. The embodiments are in such detail as to clearly communicate the disclosure. However, the amount of detail offered is not intended to limit the anticipated variations of embodiments; on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the present disclosure as defined by the appended claims.
[00026] Unless the context requires otherwise, throughout the specification which follow, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense that is as “including, but not limited to.”
[00027] Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.
[00028] As used in the description herein and throughout the claims that follow, the meaning of “a,” “an,” and “the” includes plural reference unless the context clearly dictates otherwise. Also, as used in the description herein, the meaning of “in” includes “in” and “on” unless the context clearly dictates otherwise.
[00029] In some embodiments, the numbers expressing quantities of ingredients, properties such as concentration, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term “about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable.
[00030] The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.
[00031] All methods described herein can be performed in suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g. “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.
[00032] The headings and abstract of the invention provided herein are for convenience only and do not interpret the scope or meaning of the embodiments.
[00033] Various terms are used herein. To the extent a term used in a claim is not defined below, it should be given the broadest definition persons in the pertinent art have given that term as reflected in printed publications and issued patents at the time of filing.
[00034] The oxidation-reduction potential means the standard potential of an atom or ion that undergoes oxidation at the anode or reduction at the cathode in an electrochemical cell as compared to the redox potential of a standard carbon-based printed electrodes
[00035] The present disclosure relates to a biosensor based system for identifying a strain of a gram negative bacterium in a sample for nucleic acid (or DNA) based detection of an infection and antimicrobial resistance. The system can be designed and customized for detecting a wide range of infection causing gram negative bacteria in a sample, wherein the system can be customized to act as a species specific probe or a universal probe. In an embodiment, the system can detect a microbial strain selected from wild type strain, a pathogenic strain, an antibiotic resistant bacterial strain, a multidrug resistant bacterial strain, a drug-resistant strain, and pan drug-resistant strain. The system of the present disclosure can be an effective alternative for most of the existing modalities in term of time, experimental-expenditure, human labor and cost for infection detection and antibiotic resistance to obtain the results in a qualitative and quantitative manner.
[00036] As per an embodiment of the present disclosure, the system can include a sensor including one or more carbon-based working electrodes capable of undergoing an oxidation-reduction process and a set of hybridization probes. The working electrodes may be screen printed on a paper and may be functionalized with at least one protein. The functionalized protein on the electrodes may provide a platform for localization of the capture probe on the electrodes. In an exemplary embodiment, the functionalization may be done with proteins selected from streptavidin and avidin. These protein compounds have extraordinarily high affinity for conjugating compounds like biotin (tagged to capture electrodes) and hence can provide a good localization of the capture probes on the electrodes.
[00037] The capture probe can include a first oligonucleotide that may be a single-stranded oligonucleotide. The first oligonucleotide may be tagged with biotin so that the capture probe can be localised on the working electrodes, wherein biotin is capable of conjugating with the protein on the electrodes. In an exemplary embodiment, biotin may be tagged at 5-’ or 3’- end of the first oligonucleotide. In an embodiment, the detector probe can include a second oligonucleotide that may be a single-stranded oligonucleotide tagged with fluorescein. In an exemplary embodiment, fluorescein that may be tagged at 5-’ or 3’- end of the second oligonucleotide.
[00038] In an embodiment, each of the first oligonucleotide and the second can be single-stranded oligonucleotide complimentary to each strand of a pair of strands in a target nucleic acid sequence of a gene corresponding to the strain of the gram negative bacterium to be identified. Upon lysis of the bacterium cell wall, the target nucleic acid sequence may be accessed for independent hybridization with the capture probe and the detector probe. In an embodiment, upon cell lysis, the detector probe may be hybridized with one strand of the pair of strands of the target nucleic acid sequence to form a target nucleic acid-detector probe complex, followed by hybridization of the capture probe with another strand of the pair of strands of the target nucleic acid sequence to form a target nucleic acid-capture probe-detector probe complex, which may be a three-dimensional complex between the target nucleic acid and the set of hybridization probes.
[00039] In an embodiment, formation of three-dimensional complex can be detected by the one or more electrodes by the oxidation-reduction process that enables generation of an electrical signal for identifying the strain of the gram negative bacterium in the sample in DNA-based detection of the infection and antimicrobial resistance. In an embodiment, the detection of the formation of the three-dimensional complex can be done by using one or more reagents selected from any or a combination of anti-fluorescein monoclonal Fab fragment, horseradish peroxidase, a buffer and detection reagents. The reagent anti-fluorescein monoclonal Fab fragment may be used for detection of fluorescein-labelled compounds whereas reagent horseradish peroxidase is a metalloenzyme that can catalyse the oxidation of various organic substrates. These reagents may be added after formation of the three-dimensional complex, wherein the anti-fluorescein monoclonal Fab fragment may interact with the fluorescein of the detector probe and enable detection of the three-dimensional complex. The reagent horseradish peroxidase may enable to promote the oxidation and reduction process to generate the electrical signal that may be measured using one or known techniques. Thus, these reagents may enable measurement of one or more attributes related to qualitative and/or quantitative analysis of the three-dimensional complex for effective identification of the type or the strain of the bacterium and their quantitative analysis.
[00040] In certain embodiments the present disclosure provides a capture probe and a detector probe specific to a target nucleic acid sequence of a specific gene(s) for identifying a specific bacteria; a capture probe and a detector probe specific to virulent nucleic acid sequence of a specific gene for identifying a pathogenic bacteria; a capture probe and a detector probe specific to a resistant nucleic acid sequence of DNA/Plasmid for identifying an antibiotic resistant bacterial strain, a multidrug resistant bacterial strain, an extensively drug-resistant strain; or pan drug-resistant strain. In an embodiment, the set of probes including capture probe and detector probe non-specific to any nucleic acid (positive for gram negative and gram-positive bacterial species) may be used as a positive control.
[00041] Based on the type of oligonucleotide being used in the capture probe and the detector probe, the type of bacterial strain may be identified. The formation of the three-dimensional complex may be confirmed by detection using one or more methods that can enable measurement of electrical signal due to formation of the complex, wherein the three-dimensional complex formation may depend on the nature of the target nucleic acid sequence and thus provide a qualitative data on the type of bacterium being detected. Based on the measurement, current output can provide an estimate of hybridization between capture probe, target nucleic acid sequence and the detector probe, wherein the result can indicate presence of the bacterium in a biological sample, wherein the number of bacterial cells in the sample may be directly proportional to current output. In an embodiment, the current output may be measured by using cyclic voltammetry. In an exemplary embodiment, a potential of ±2.5V may be applied for a time duration in the range of 30 second to 1.5 minutes with scan rate of 0.1 second to obtain the current output that may provide a quantitative idea regarding the number of bacterial cells in the sample.
[00042] In an embodiment, the system of the present disclosure can be used for identifying antibiotic resistant strain selected from wild type strain, an antibiotic resistant bacterial strain, a multidrug-resistant (MDR), extensively drug-resistant (XDR), and pan drug-resistant (PDR) strains of the gram negative bacteria selected from E.coli, Klebsiella pneumoniae and Pseudomonas aeruginosa.
[00043] In an embodiment, the set of hybridization probes may be capable of individually hybridizing to any of the target nucleic acid sequence of the gene selected from CTX-M, KPC gene, and NDM-1 gene of E.coli, Klebsiella pneumoniae and Pseudomonas aeruginosa strains. The system of the present disclosure may also enable identification of the strain resistant to antibiotics selected from carbapenem, amino glycosidase and colistin in detection of any or a combination of multi-drug resistance, extensively drug-resistance and pan drug-resistance.
[00044] In another embodiment, the set of hybridization probes may be capable of individually hybridizing to any of the target nucleic acid sequence of the gene selected from CTX-M, KPC and NDM-1 gene, of E.coli, Klebsiella pneumoniae and Pseudomonas aeruginosa. The system of the present disclosure may also to identify the strain resistant to antibiotics selected from carbapenem, amino glycosidase and colistin in detection of any or a combination of multi-drug resistance, extensively drug-resistance and pan drug-resistance. Pseudomonas aeruginosa may be considered as one of the top five microorganisms causing severe infection, wherein its bacterial surface factors such as flagella, pili and lipopolysaccharide as well as active processes such as the secretion of toxins, biofilm formation, and quorum sensing are virulence determinants that impact the outcome of infections caused by the bacterial strain. In an embodiment, the system of the present disclosure can detect pathogenic strain using 16sRNA genes for pathogenic Pseudomonas aeruginosa identification, whereas detection of NDM gene may be done to confirm resistance to antibiotics including carbapenem and amino glycosidase that may suggest detection of an extensively drug-resistant pseudomonas strain.
[00045] In an embodiment, the set of hybridization probes may be capable of individually hybridizing to 16S rRNA of Pseudomonas aeruginosa and the probes may be used as positive control to identify the wild type and discriminating from the pathogenic and drug-resistant strains of Pseudomonas aeruginosa.
[00046] In an embodiment, the set of hybridization probes may be capable of individually hybridizing to any of the target nucleic acid sequence of the gene selected from CTX-M, in extended spectrum beta-lactamase (ESBL) producing E. coli resistant to antibiotics selected from cephalosporins belonging to one to four classes, fluoroquinolones, and monobactam in detection of any or a combination of multi-drug resistance. In another embodiment, the set of hybridization probes may be capable of individually hybridizing to a target nucleic acid sequence of 16s RNA gene of E. coli and identifying the pathogenic E. coli strain to detect the infection. In another embodiment the present disclosure provides probes capable of individually hybridizing to a target nucleic acid sequence of bla CTXM-1 of E. coli and identifying the drug resistant strain, thereby detecting drug resistance.
[00047] In an embodiment, for pan drug resistance confirmation, three strains of E.coli, Klebsiella pneumoniae and Pseudomonas aeruginosa may be done that can show combination of CTX-M1, KPC and NDM-1, genes presence. Thus, a wide variety of bacterial strains can be identified by the system of the present disclosure thus making the system versatile and effective as well as a fast detection technique than the conventional counterparts. In an embodiment, the first oligonucleotide sequence (capture probe) and the second oligonucleotide sequence (detector probe) can have a sequence selected from CTGCGGGTAACGTCAATGAGCAAA corresponding to E.coli, CCATGAAGTCGGAATCGCTAGTAAT corresponding to Klebsiella pneumoniae, CTGATACTGACACTGAGGTGCGAAA corresponding to Pseudomonas aeruginosa, GGCATTGATTAACACAGCAGATAA corresponding to CTX-M gene of E.coli, GTTTAATGTTGGAGGCTAAGTGATA corresponding to KPC gene of Klebsiella pneumoniae, ATGTCACTGAATACTCGTCCTAGAA corresponding to NDM gene of Pseudomonas aeruginosa. In an embodiment, the detection of the sample for identifying the strain of gram negative bacterium may be done in a time duration in the range of 1 min to 120 mins. In an exemplary embodiment, the detection may be done in a time period of less than 2 hours. In another exemplary embodiment, the sample may be detected for identification of the strain of the gram-negative bacterium in the range of 30 second to 1.5 minutes. The sample may be a biological fluid selected from blood, urine and other biological fluids of a body. The system of the present disclosure may enable a detection limit in the range of 10 to 10 10 CFU/ml in a sample such as blood and urine samples. The system may be very specific due to its gene specific probes hybridization to the target sequence.
[00048] In an embodiment, the system can be used for specific detection of a strain of a gram negative bacteria. In another embodiment, the system can be used to probe more than one strain of bacterium thereby enabling to be used as a universal probe.
[00049] In another aspect, the present disclosure provides a kit for identifying a strain of a gram-negative bacterium in a sample for nucleic acid based biosensor detection of an infection and antimicrobial resistance. The kit can include one or more carbon-based working electrodes screen printed on a paper, a panel of hybridization probes and one or more reagents, wherein the panel of hybridization probes can include capture probes and detector probes that have oligonucleotides complementary to and capable of hybridizing to a target nucleic acid sequences of a gene for identification of infection causing and drug resistant strain(s) of gram negative bacteria selected from E.coli, Klebsiella pneumoniae and Pseudomonas aeruginosa. The one or more reagents can be selected from any or a combination of streptavidin, biotin, anti-fluorescein monoclonal Fab fragment, horseradish peroxidase, a buffer and detection reagents (TMB substrate).
[00050] In an exemplary embodiment, the kit can include a cocktail mixture capable of lysing the gram negative bacterium and releasing nucleic acid in a biological sample in a time period in the range of 20 to 40 minutes, wherein the cocktail mixture includes a combination of 1M sodium hydroxide solution, 10% Tween, 20mM Tris(hydroxymethyl)aminomethane hydrochloride (Tris HCl), 1 mM EDTA, Lysozyme (10mg/ml) in 10mM tris HCL in a volume ratio of 1:1:1:0.5:0.25.
[00051] In an embodiment, the kit can include a panel of sets of hybridization probes (capture probes and detector probes), wherein each of the probes can be a single-stranded oligonucleotide tagged with biotin at 5’- or 3’- end, and a single-stranded oligonucleotide tagged with fluorescein at 5-’ or 3’- end, wherein the respective oligonucleotides of the probes can be complimentary to and capable of independent hybridization with target nucleic acid sequence of a specific gene corresponding to the bacterium in biological sample.
[00052] In another aspect, the present disclosure provides a method for preparation of the electrodes and probes for identification of infection-causing bacterial strain in a given sample. The method can include obtaining electrodes by microfabrication technology by printing carbon-based electrodes on paper, wherein the electrodes may be capable of undergoing and measuring oxidation-reduction; providing a set/panel of a single-stranded oligonucleotide capture probe, and a single-stranded oligonucleotide detector probe, each probe bearing oligonucleotides that can be complimentary to and capable of hybridizing to target nucleic acid sequence of a specific gene(s) of one or more of a wild type, infection causing and antibiotic resistant bacterial cells; functionalizing printed carbon-based electrodes with streptavidin; localizing a single-stranded oligonucleotide capture probe tagged with biotin on the DNA biosensor; lysing the bacterial cells in the given sample and releasing the target nucleic acid sequence; allowing the first hybridization to take place between a fluorescein tagged single stranded oligonucleotide detector probe capable of hybridizing with the target nucleic acid sequence at a specific temperature to form a detector probe-target nucleic acid complex; allowing the second hybridization to take place between the detector probe-target nucleic acid complex with the capture probe localized on the screen printed electrode-target nucleic acid sequence forming a three dimensional structure of the target nucleic acid sequence between the capture probe and the detector probe towards the sensor; adding anti-fluorescein monoclonal Fab fragment on the resultant three dimension structure of the capture probe-target nucleic acid sequence-detector probe; adding horseradish peroxidase; and measuring the oxidation-reduction response at the sensor electrodes on a suitable test equipment.
[00053] In an embodiment the hybridization between the fluorescein tagged single stranded oligonucleotide detector probe with the target nucleic acid sequence may be done at 65 degree Celsius in an incubator. The method in accordance with the present disclosure may be carried out by adopting cyclic voltammetry for measuring the reduction potential of a microbial species in the reaction solution. In an embodiment, the suitable equipment to measure the electrical signal/the oxidation-reduction response may be potentiostat/potentiometer, which being, a low cost equipment can add to the cost-effectiveness of the testing.
[00054] In an embodiment the hybridization may be carried out by applying current to the electrodes. The current applied can be of ±2.5V for about 30 seconds to 1.5 minutes, preferably from about 1 minute with a scan rate of 0.1 second to about 0.5 seconds. The current output may impart threshold of hybridization between capture probe-target nucleic acid sequence-detector probe. In an exemplary embodiment, the result may be generated in format of number of bacterial cells in the sample directly proportional to current output using suitable test equipment .
[00055] The localization of probes, and double hybridization between capture probe, target nucleic acid sequence and detector probe provide three-dimensional structure on screen printed electrode acting as a nucleic acid based or DNA biosensor, and thereby result in profound sensitivity in detecting infection causing and antibiotic resistant bacterium and thereby enables detection of infection and antibiotic or multidrug resistance. The method in accordance with the present invention is capable of detecting infection causing and antibiotic resistant bacteria within 1 minute to 120 minutes.
[00056] The system and kit in accordance with the present disclosure is capable of detecting microbial cells from 101 to 10 10 CFU/ml from a given sample, the sample preferably being blood and urine samples. The system and kit of the present disclosure may be capable of providing results in terms of number of bacterial cells causing infection and antibiotic resistant in the sample, are accordingly more sensitive as compared to the conventional culture tools and method used to detect infection. Further, due to ability to identify specific bacterial cells due to specificity to target nucleic acid, the system and kit of the present disclosure are contemplated to be superior to the existing PCR and sequencing tools and techniques. The system and kit in accordance with the present disclosure can be used by a physician to prescribe specific antibiotic course to patients who are suffering from infection based on the output received. The system and kit of the present disclosure can also be used by a physician to identify infection in each and every disease where it can be used as monitoring tool to treat infection, thus providing faster and cost-effective analysis that can overcome the disadvantages of the conventional systems.
[00057] The present disclosure is further explained in the form of following examples. However, it is to be understood that the foregoing examples are merely illustrative and are not to be taken as limitations upon the scope of the invention. Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications may be made without departing from the scope of the invention.
General Example-1 Formation and detection of complex between target nucleic acid sequence and the set of hybridization probes
Step 1: Immobilization of capture probe
An electrode for biosensor-based detection system was prepared for detecting pathogens (E. coli, Klebsiella pneumonia and Pseudomonas aeruginosa) by microfabrication technology by printing carbon-based electrodes on paper. The printed carbon-based electrodes were functionalized with 10µL of 0.5mg/ml streptavidin at room temperature for 10 minutes inside a biosensor cassette. 10µL of species specific targeted capture probe (E.coli, Klebsiella pneumonia and pseudomonas aeruginosa) was immobilized on the screen printed electrode at room temperature for 30 minutes, after which the probe was then washed with phosphate buffer saline (having19ml of 1M Na2HPO4 and 81ml of 1M K2HPO4) having pH of 7.4.
Step 2: Nucleic acid release and formation of a first complex between target nucleic acid sequence of biological sample and detector probe (first hybridization)
A biological sample containing human urine was taken. 1 ml urine sample was centrifuged at 14000 rpm for 15 minutes at room temperature to obtain a sedimented portion/pellet which was used for further analysis whereas the supernatant was discarded. Further a 350µL cocktail mixture was prepared for adding to the pellet obtained from the urine sample for carrying out cell lysis of the gram negative bacterium to be detected. The cocktail mixture included 1 molar sodium hydroxide solution, 10% Tween+ 20mM Tris(hydroxymethyl)aminomethane hydrochloride (Tris HCl), 1 mM EDTA, Lysozyme (10mg/ml) in 10mM tris HCL, wherein the volume ratio of all the four ingredients was 1:1:1:0.5:0.25. Upon adding the cocktail mixture to the pellet obtained by the centrifugation of the urine sample, the urine sample released target nucleic acid sequence after cell lysis. The resultant mixture was centrifuged at 14000 rpm for 15 minutes and the resultant supernatant solution was taken. A complex based hybridization between nucleic acid sequence and detector probe was obtained by adding a species specific detector probe to the supernatant solution inside a 65° C incubator for 10 minutes. The detector probe was designed and prepared by tagging a single-stranded oligonucleotide with fluorescein. A first hybridization was allowed between a fluorescein tagged single stranded oligonucleotide detector probe and the target nucleic acid sequence at 650 C for 10 minutes to form a detector probe-target nucleic acid complex.
Step 3: Formation and detection of a second complex formed between the first complex obtained in step-2 and the capture probe on the working electrode (second hybridization)
After first hybridization between released nucleic acid and species specific detector probe, the complex (detector probe-target nucleic acid complex) was allowed to undergo second hybridization with the capture probe localized on the screen printed electrode as prepared in the step-1, that lead to formation of a three dimensional structure of the target nucleic acid sequence with the capture probe and the detector probe in 4° C box at inside a 65° C incubator for 15 minutes.. To this 3-dimensional complex on the electrode, reagents such as 30ul anti-fluorescein monoclonal Fab fragments in 1ml 0.5% casein was added for 10minutes and further washed with 1ml PBS to remove unwanted binding. Further 50 µL horseradish peroxidase was added to the electrode with the 3-dimensional complex to measure the oxidation-reduction response at the electrodes in term of current at constant voltage between (±2.5V).
Example 2: Detection of infection causing bacterium:
a) Detection of infection caused by E. coli strain infection sensor:
For purpose of detection of infection caused by E-coli, a specific strain of E-coli i.e. MTCC 4296 was used that was purchased from Microbial Type Culture Collection and Gene Bank, India. This bacterial culture was grown in Luria broth over night at 37°C at 180 rpm in an incubator cum shaker. The cells were isolated in log phase where OD between (0.5-1) at 600nm was used, and further spiked individually with blood and urine sample wherein the urine sample was used in undiluted form whereas blood sample was diluted with water in 1:1. The sensor
was standardized for E.coli in culture using standard E.coli bacterial isolates and later implemented in experiment for detection in the blood and urine spiked with E.coli strain up to 101 to 1010 CFU. Same protocol was followed for rest of sensor development.
b) Detection of infection caused by Klebsiella Pneumonia infection sensor:
Same protocol was followed as in experiment (a) except that Klebsiella Pneumonia strain was used from a repository at Indian Institute of Technology using specific probes.
c) Detection of infection caused by Pseudomonas aeruginosa infection sensor:
Same protocol was followed as in experiment (a) except that Pseudomonas aeruginosa strain (NCIMB-8626) was used that was from purchased from NuLife Consultants & Distributors (Pvt.) Ltd., New Delhi India.
The sensing results for all the 3 strains (Pseudomonas aeruginosa, E. coli and Klebsiella pneumonia) were obtained by cyclic voltammetry as provided in FIGs. 1A-1C as well as in Table 1 below
Table 1: Cyclic voltammetry results in detection of infection caused by gram negative bacterium
Pathogenic strains of Pseudomonas aeruginosa, E.coli and Klebsiella pneumonia
Pseudomonas aeruginosa E. coli Klebsiella Pneumonia
Voltage Current-µA Voltage Current-µA Voltage Current-µA
0.15 -25.2 0.17 -24 0.22 -22
0.16 -22.7 0.19 -21 0.21 -25
Example 2: Detection of antibiotic resistance:
The antibiotic sensitivity of gram negative bacteria was tested by employing the Kirby-Bauer’s technique as suggested by the Clinical & Laboratory Standards Institute (CLSI) guidelines.
i. Pseudomonas drug resistance sensor
For the Pseudomonas aeruginosa drug resistance (NDM) sensor, clinical sample was grown and validated in our lab using culture for MBL (Metallo beta lactamase production), which was confirmed by disc diffusion and estrip (Estrip is E-test (imipenem 0.002-32µg/ml and colistin 0.064-1024 µg/ml) was conducted based on the guidelines of the manufacturer). The tests were considered positive for imipenem and colistin when the ratio was = 8 µg/ml . The E-test method was used to specify the minimum inhibitory concentrations (MICs) of imipenem and colistin (for colistin, MIC was detected only in resistant isolates by using Kirby-Bauer’s technique). Further MBL (Metallo beta lactamase) producing Pseudomonas aeruginosa antibiotic Resistant clinical strain (NDM gene resistant) was subjected to antibiotic susceptibility tests that were performed on Mueller Hinton agar plates using standard method. The antibiotics used were Ceftazidime 30µg /ml, Ciprofloxacin5µg /ml, Cefepime 30µg /ml, Meropenem 10µg/ml, Imipenem 10µg/ml, colistin (10 µg), aztreonam (30 µg), levofloxacin (5 µg). The detection results as measured by testing instrument (potentiostat arrangement of electrodes), wherein the results are as shown in FIG. 2A and Table 2.
ii. E.coli drug resistance sensor:
E. coli drug resistance (CTX-M1) sensor was developed. ESBL producing E. coli drug resistant NCIM-2571 strain was purchased from NCL (National chemical Laboratory Pune, India). In the present experiment, the antibiotic sensitivity was tested for several class of antibiotics i.e. Cefotaxime 10µg/ml, Rifampicin 50µg/ml, Ciprofloxacin 1µg/ml, Trimethoprim 0.5 µg/ml. The NCIM-2571 was used as marker for CTX-M resistance in ESBL producing E. coli during the sample analysis of biological sample. The results of the detection as derived by testing instrument (potentiostat arrangement of electrodes)is depicted in FIG. 2B. The detection results as measured by cyclic voltammetry are as shown in FIG. 2B and Table 2.
iii. Klebsiella drug resistance sensor:
To develop the Klebsiella drug resistance (KPC) sensor, carbepenamase resistant (KPC gene resistant) Klebsiella pneumonia MDR/XDR strain ATCC (BAA-1705) was purchased from NuLife Consultants & Distributors (Pvt.) Ltd., New Delhi India. The antibiotic sensitivity was tested using standard method for Klebsiella pneumonia MDR/XDR strain ATCC (BAA-1705) in incubator overnight at 37° C in presence of antibiotics ( Meropenem 10µg/ml, Imipenem 10µg/ml, Ceftazidime30µg /ml, Levofloxacin 5µg /ml, Piperacillin-Tazobactam 100:10µg /ml, Ciprofloxacin 5µg /ml, Cefepime30µg /ml) with standard guideline. MDR/XDR strain ATCC (BAA-1705) was used as marker for KPC resistance in drug resistant Klebsiella pneumonia. The detection results as measured by testing instrument (potentiostat arrangement of electrodes) are as shown in FIG. 2C and Table 2.
Table 2: Cyclic voltammetry results in detection of antibiotic resistance caused by gram negative bacterium
Antibiotic resistant strains of Pseudomonas aeruginosa, E.coli and Klebsiella pneumonia
Pseudomonas aeruginosa E.coli Klebsiella Pneumonia
Voltage Current-µA Voltage Current-µA Voltage Current-µA
0.16 -34 0.16 -23 0.16 -23
0.18 -29 0.17 -26 0.17 -20
Detection of gram negative bacteria panel – universal probe (panel of hybridization probes):
A panel of key dominating gram negative bacteria panel (E.coli, Klebsiella pneumonia, and pseudomonas aeruginosa) was developed. For purpose of detection of either infection or antibiotic resistance, a specific strain of bacteria was used as positive control. A universal probe was developed usable as a positive control for all bacteria i.e. gram positive and gram negative bacteria and PBS was used as negative control for all the experiments as shown in FIGs. 3A-3C. The bacterial cultures were grown in Luria broth over night at 37°C at 180 rpm in an incubator cum shaker as per standard guidelines. Cells were isolated in log phase where OD between 0.5-1 was used and further spiked with blood and urine sample, wherein the urine sample was used in undiluted form whereas blood sample was diluted with water in 1:1. After standardization of all sensors (pseudomonas aeruginosa, E.coli, Klebsiella pneumonia) both for infection and antibiotic resistance in culture using standard bacterial isolates, experiment was repeated in blood and urine with spiking of bacterial strain up-to 101-1010 CFU. The results are summarized in FIGs. 3A-3C and in Table 3.
Table 3: Results for universal probe detection in different species
Pseudomonas aeruginosa E.coli Klebsiella Pneumonia
Pathogenic resistant Pathogenic resistant Pathogenic resistant
Voltage
(V) Current-µA Voltage
(V) Current-µA Voltage
(V) Current-µA Voltage
(V) Current-µA Voltage
(V) Current-µA Voltage
(V) Current-µA
0.17 -28 0.17 -22 0.21 -23 0.14 -28 0.13 -28 0.19 -19
0.17 -25 0.16 -21 0.20 -22 0.13 -26 0.17 -25 0.19 -17
The specificity of various probes/sensors (as described above) was also evaluated as provided in Tables 4 and 5 below. As observed in Table 4, the E-coli probe displays no prominent peaks at the specific voltages, as otherwise obtained using universal probe and K. Pneumonia probe. As observed in Table 5, the E-coli probe displays no prominent peaks at the specific voltages, as otherwise obtained using universal probe and Pseudomonas Aeruginosa probe. This indicates the precision and selectively/specificity of the K. Pneumonia probe as well as the workability/flexibility of the universal probe.
Table 4: Cyclic voltammetry results in evaluation of specificity of Klebsiella probe in K. Pneumonia Strain
E.coli probe in K. Pneumonia Strain Universal probe in K. Pneumonia Strain K. Pneumonia probe in K. Pneumonia Strain culture K. Pneumonia probe in K. Pneumonia Strain spiked urine
Voltage
(V) Current
(µA) Voltage
(V) Current
(µA) Voltage
(V) Current
(µA) Voltage
(V) Current
(µA)
0.13 -3 0.13 -28 0.13 -33 0.17 -14
0.13 -7 0.17 -25 0.13 -30 0.17 -12
0.17 -21 0.17 -14 0.18 -17.6
Table 5: Cyclic voltammetry results in evaluation of specificity of Pseudomonas Aeruginosa probe in Pseudomonas Aeruginosa Strain
E.coli probe in Pseudomonas Aeruginosa Strain
Universal probe in Pseudomonas Aeruginosa Strain
(Pathogenic ) Universal probe in Pseudomonas Aeruginosa Strain
(Resistant) Pseudomonas Aeruginosa probe in Pseudomonas Aeruginosa Strain
(Pathogenic ) Pseudomonas Aeruginosa probe in Pseudomonas Aeruginosa Strain
(Resistant)
Voltage
(V) Current
(µA) Voltage
(V) Current (µA) Voltage
(V) Current (µA) Voltage
(V) Current
(µA) Voltage
(V) Current
(µA)
-0.21 -0.0032 0.17 -28 0.17 -22 0.19 -28 0.16 -34
-0.22 -0.0042 0.17 -25 0.16 -21 0.20 -30 0.18 -29
[00058] In accordance with the experiments as elaborated hereinabove, it is clear that developing drug resistant sensor can prove to be a helpful tool for any physician. In particular. if a physician utilizes the system/sensor of the present invention, he/she may be able to understand/conclude about an infection or anti-biotic resistance as the presence of such an infection/resistance may be evident from a positive result (in terms of a signal as detected by cyclic voltammogram), for example, if the detection indicates NDM gene for Pseudomonas Aeruginosa in Blood or urine sample of patients, it may be useful to suggest based on the drug resistance of a patient for several class of antibiotics like Ceftazidime, Ciprofloxacin, Cefepime, Meropenem, Imipenem, colistin, aztreonam, levofloxacin. Further, drug resistant strains such as MDR/ XDR/PDR bacteria can be easily detected using the present system/sensor, that allow immediate antibiotic treatment with resistant gene specific sensor based test. In addition, utilization of the present system/sensor also enables a physician to immediately initiate treatment (such as within 1-2 hours) after receiving the sample without needing to wait for relatively longer period such as 3-5 days as required by conventional testing equipment. Thus the present disclosure not only saves time and efforts of testing but also can be very effective in prescribing a correct medication by physicians/doctors based on the availability of accurate and instantaneous results as made possible by the system/sensor of the present disclosure.
[00059] While the foregoing describes various embodiments of the invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof. The scope of the invention is determined by the claims that follow. The invention is not limited to the described embodiments, versions or examples, which are included to enable a person having ordinary skill in the art to make and use the invention when combined with information and knowledge available to the person having ordinary skill in the art.
ADVANTAGES OF THE PRESENT DISCLOSURE
[00060] The present disclosure provides a biosensor-based system that can discriminate between wild type bacterial strain, pathogenic strains and antibiotic resistant strains of gram-negative bacteria simultaneously.
[00061] The present disclosure provides a biosensor-based system for nucleic acid-based detection of microbial infection, antibiotic susceptibility and one or more antibiotic resistance selected from MDR, XDR, and PDR.
[00062] The present disclosure provides a system comprising hybridization probes, and functionalized electrodes that can detect infection and antibiotic resistance in shorter duration for example less than 2 hours.
[00063] The present disclosure provides a biosensor-based system that can detect pathogenic and antibiotic resistant strains with high specificity and in cost effective manner.
[00064] The present disclosure provides a biosensor-based system with a simpler set-up that can be used in urban as well as rural areas for bulk detection of infection, or antibiotic resistance, or both.
[00065] The present disclosure provides a system that can be used as a point of care device for fast detection of infection or antibiotic resistance to enable an immediate and appropriate treatment regimen.
CLAIMS:1. A biosensor-based system for identifying a strain of a gram negative bacterium in a sample for nucleic acid based detection of at least one of an infection and antimicrobial resistance caused by the bacterium, said system comprising:
a sensor comprising one or more carbon-based working electrodes capable of undergoing an oxidation-reduction process; and
a set of hybridization probes,
wherein said working electrodes are screen printed on a paper and are functionalized with at least one protein compound selected from streptavidin and avidin; and
wherein said set of hybridization probes comprise at least one capture probe and at least one detector probe,
wherein the capture probe comprises a first oligonucleotide sequence including a single-stranded oligonucleotide tagged with biotin, wherein said capture probe is localized on said one or more working electrodes by conjugation interaction between biotin in the capture probe and said at least one protein functionalized on the capture probe, wherein the detector probe comprises a second oligonucleotide sequence including a single-stranded oligonucleotide tagged with fluorescein; and
wherein each of the first oligonucleotide sequence and the second oligonucleotide sequence are single-stranded oligonucleotides that are complimentary to each strand of a pair of strands in a target nucleic acid sequence of a gene corresponding to the strain of the gram negative bacterium,
wherein each of the first oligonucleotide and the second oligonucleotide are capable of an independent hybridization with each strand of said pair of strands of target nucleic acid sequence obtained after cell lysis of the gram-negative bacterium,
wherein if said target nucleic acid sequence corresponding to the strain of the gram- negative bacterium is present in the sample, the independent hybridization occurs that forms a three-dimensional complex between said target nucleic acid and the set of hybridization probes, and
wherein the formation of the three-dimensional complex is detected by the one or more electrodes by the oxidation-reduction process that enables generation of an electrical signal for identifying the strain of the gram negative bacterium in the sample in the nucleic acid based detection of at least one of the infection and the antimicrobial resistance caused by the bacterium selected from a strain of E.coli, Klebsiella pneumoniae and Pseudomonas aeruginosa.
2. The system as claimed in claim 1, wherein said first oligonucleotide sequence and said second oligonucleotide sequence comprise a sequence selected from CTGCGGGTAACGTCAATGAGCAAA corresponding to E.coli, CCATGAAGTCGGAATCGCTAGTAAT corresponding to Klebsiella pneumoniae, CTGATACTGACACTGAGGTGCGAAA corresponding to Pseudomonas aeruginosa, GGCATTGATTAACACAGCAGATAA corresponding to CTX-M gene of E.coli, GTTTAATGTTGGAGGCTAAGTGATA corresponding to KPC gene of Klebsiella pneumoniae and ATGTCACTGAATACTCGTCCTAGAA corresponding to NDM gene of Pseudomonas aeruginosa.
3. The system as claimed in claim 1, wherein said system is used for identifying antimicrobial resistance caused by any or a combination of a pathogenic strain, an antibiotic resistant bacterial strain, a multidrug-resistant (MDR) strain, extensively drug-resistant (XDR) strain, and pan drug-resistant (PDR) strains of the gram negative bacteria.
4. The system as claimed in claim 1, wherein the set of hybridization probes are capable of individually hybridizing to any of the target nucleic acid sequence of the gene selected from CTX-M, KPC gene, and NDM-1 gene of Klebsiella pneumoniae strains to identify the strain resistant to antibiotics selected from carbapenem, amino glycosidase and colistin in detection of any or a combination of multi-drug resistance, extensively drug-resistance and pan drug-resistance, and
wherein the set of hybridization probes are capable of hybridizing to the target nucleic acid sequence of 16s RNA gene of Klebsiella pneumoniae to identify a virulent strain and to detect the infection.
5. The system as claimed in claim 1, wherein the set of hybridization probes are capable of individually hybridizing to any of the target nucleic acid sequence of the gene selected from CTX-M, KPC, and NDM-1 of Pseudomonas aeruginosa, to identify the strain resistant to antibiotics selected from carbapenem, amino glycosidase and colistin in detection of any or a combination of multi-drug resistance, extensively drug-resistance and pan drug-resistance.
6. The system as claimed in claim 1, wherein the set of hybridization probes are capable probes capable of individually hybridizing to 16S rRNA of E.coli, Klebsiella pneumonia and Pseudomonas aeruginosa and said probes are used as marker to identify the pathogenic strain and discriminating from the pathogenic and drug-resistant strains of Pseudomonas aeruginosa.
7. The system as claimed in claim 1, wherein the set of hybridization probes are capable of individually hybridizing to any of the target nucleic acid sequence of the gene selected from CTX-M, NDM-1, and KPC in extended spectrum beta-lactamase (ESBL) producing E. coli resistant to antibiotics selected from cephalosporins belonging to one to four classes, fluoroquinolones, and monobactam in detection of any or a combination of multi-drug resistance.
8. The system as claimed in claim 1, wherein said first oligonucleotide is a single-stranded oligonucleotide tagged with biotin at 5-’ or 3’- end of the oligonucleotide, and wherein said second oligonucleotide is a single-stranded oligonucleotide tagged with fluorescein at 5-’ or 3’- end of the oligonucleotide.
9. The system as claimed in claim 1, wherein the detection of the sample for identifying the gram negative bacteria is done in a time duration in the range of 1 minute to 120 minutes, and wherein the sample is a biological fluid selected from blood, urine and other biological fluids obtained from a human body, wherein the electrical signal is measured by a potentiostat or a potentiometer based arrangement, and wherein the detection of the formation of the three-dimensional complex is done by using one or more reagents selected from any or a combination of anti-fluorescein monoclonal Fab fragment, horseradish peroxidase, a buffer and detection reagents.
10. A kit for identifying a strain of a gram negative bacterium in a sample for nucleic acid based biosensor detection of an infection and antimicrobial resistance, said kit comprising:
a cocktail mixture capable of lysing the gram negative bacterium and releasing nucleic acid in a biological sample in a time period in the range of 20 to 40 minutes, wherein the cocktail mixture includes a combination of 1M sodium hydroxide solution, 10% Tween, 20mM Tris(hydroxymethyl)aminomethane hydrochloride (Tris HCl), 1 mM EDTA, Lysozyme (10mg/ml) in 10mM tris HCL in a volume ratio of 1:1:1:0.5:0.25;
a panel of hybridization probes comprising capture probes and detector probes, each of the probes including one or more oligonucleotides complementary to and capable of independent hybridization to a target nucleic acid sequence of a gene corresponding to the bacterium for identification of infection causing and drug resistant strain(s) of the gram negative bacteria selected from E.coli, Klebsiella pneumoniae and Pseudomonas aeruginosa; and
one or more reagents selected from any or a combination of streptavidin, biotin, anti-fluorescein monoclonal Fab fragment, horseradish peroxidase, a buffer and detection reagents.
| # | Name | Date |
|---|---|---|
| 1 | 201911049728-STATEMENT OF UNDERTAKING (FORM 3) [03-12-2019(online)].pdf | 2019-12-03 |
| 2 | 201911049728-PROVISIONAL SPECIFICATION [03-12-2019(online)].pdf | 2019-12-03 |
| 3 | 201911049728-FORM FOR STARTUP [03-12-2019(online)].pdf | 2019-12-03 |
| 4 | 201911049728-FORM FOR SMALL ENTITY(FORM-28) [03-12-2019(online)].pdf | 2019-12-03 |
| 5 | 201911049728-FORM 1 [03-12-2019(online)].pdf | 2019-12-03 |
| 6 | 201911049728-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [03-12-2019(online)].pdf | 2019-12-03 |
| 7 | 201911049728-EVIDENCE FOR REGISTRATION UNDER SSI [03-12-2019(online)].pdf | 2019-12-03 |
| 8 | 201911049728-DECLARATION OF INVENTORSHIP (FORM 5) [03-12-2019(online)].pdf | 2019-12-03 |
| 9 | 201911049728-Proof of Right (MANDATORY) [28-12-2019(online)].pdf | 2019-12-28 |
| 10 | 201911049728-FORM-26 [28-12-2019(online)].pdf | 2019-12-28 |
| 11 | 201911049728-ENDORSEMENT BY INVENTORS [02-12-2020(online)].pdf | 2020-12-02 |
| 12 | 201911049728-DRAWING [02-12-2020(online)].pdf | 2020-12-02 |
| 13 | 201911049728-CORRESPONDENCE-OTHERS [02-12-2020(online)].pdf | 2020-12-02 |
| 14 | 201911049728-COMPLETE SPECIFICATION [02-12-2020(online)].pdf | 2020-12-02 |
| 15 | 201911049728-Covering Letter [14-12-2020(online)].pdf | 2020-12-14 |
| 16 | 201911049728-FORM 3 [11-05-2021(online)].pdf | 2021-05-11 |
| 17 | 201911049728-FORM 18 [25-05-2021(online)].pdf | 2021-05-25 |
| 18 | 201911049728-FER.pdf | 2025-08-26 |
| 19 | 201911049728-FORM 3 [22-11-2025(online)].pdf | 2025-11-22 |
| 1 | 201911049728_SearchStrategyNew_E_BIOSENSORSEARCHSTRATEGYE_17-07-2025.pdf |