Sign In to Follow Application
View All Documents & Correspondence

Brinjal (Solanum Melongena) Event Ee 6726, Kit And Method Of Detection Of Event Ee 6726

Abstract: The invention provides brinjal event EE-6726, and plants, plant cells, seeds and plant parts comprising event EE-6726 which confers resistance to Lepidopteran insect damage. The invention also provides nucleic acid sequences specific for event EE-6726 and plants, plant cells, seeds and plant parts comprising nucleic acids specific for event EE-6726. This invention also provides methods for detection the presence of the event EE-6726 based on DNA sequence of the recombinant construct inserted into the brinjal genome that resulted in the EE-6726 event and/or the genomic sequences flanking the insertion site.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
02 January 2020
Publication Number
28/2021
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
info@krishnaandsaurastri.com
Parent Application

Applicants

MAHYCO PRIVATE LIMITED
19, Raj Mahal, 84, Veer Nariman Road, Mumbai -400020, Maharashtra, India

Inventors

1. Narendran Madhavan Nair
2BHK B, Mahyco Housing, Dawalwadi, Jalna-Aurangabad Road, Jalna- 431203, Maharashtra, India
2. Ratnapal Popatlal Gandhi
RH1, Mirajgave nagri near Mahkse petrol pump Beed bypass, Aurangabad- 431001, Maharashtra, India
3. Bharat Char
RH2-D, Mahyco Housing, Dawalwadi, Jalna-Aurangabad Road, Jalna- 431203, Maharashtra, India

Claims

1. A recombinant DNA comprising at least one junction sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and /or SEQ ID NO: 14, complements or fragments thereof comprising a transgene insertion and flanking genomic DNA of the brinjal event EE6726.

2. The recombinant DNA as claimed in claim 1, comprising at least one junction sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and /or SEQ ID NO: 14 comprises a sequence as set forth in SEQ ID NO: 12 and / or its complement thereof, or a portion of SEQ ID NO: 12 or its complement thereof.

3. The recombinant DNA as claimed in claim 1, wherein the nucleic acid sequence as set forth in SEQ ID NO: 14 comprises a primer sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 15, and/or SEQ ID NO: 16 or its complements or fragments thereof.

4. A primer comprising at least 10 contiguous nucleotides derived from the sequence as set forth in SEQ ID NO:14, or its complement, wherein said DNA molecule is capable of producing an amplicon comprising of sequence as set forth in SEQ ID NO: 12.

5. The primer as claimed in claim 4, wherein the primer is a pair comprising at least 15 contiguous nucleic acids each, wherein a first primer in said pair is selected from nucleic acid sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 15, and/or SEQ ID NO: 16; and a second primer sequence is as set forth in SEQ ID NO: 13, wherein said primer pair is capable of producing an amplicon comprising SEQ ID NO: 12 diagnostics for EE-6726 event.

6. A method of detecting the presence of EE-6726 event in a sample comprising the steps of: a. contacting a sample comprising the DNA of interest with a first primer selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 15, and/or SEQ ID NO: 16; or its complements or fragments thereof; and a second primer sequence as set forth in SEQ ID NO: 13 or its complements or fragments thereof; b. amplifying the said sample and producing an amplicon having the sequence SEQ ID NO: 12 for the event EE-6726; and c. analyzing the amplified products for the presence of SEQ ID NO: 12 for the EE-6726 event; and d. detecting the diagnostic amplicon as set forth in SEQ ID NO: 12.

7. The method as claimed in claim 6, wherein the DNA of interest comprises the sequences as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14, complements or fragments or combinations thereof.

8. The method as claimed in claim 6 or 7, wherein the sample is a brinjal tissue.

9. A method of determining zygosity of DNA in a biological sample comprising the event EE6726, said method comprising: a. contacting the biological sample with a first DNA primer selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 15, and/or SEQ ID NO: 16, complements or fragments or combinations thereof, a second DNA primer selected as set forth in SEQ ID NO: 13, complements or fragments thereof; and a third DNA primer as set forth in SEQ ID NO: 17, complements or fragments thereof; b. amplifying the DNA to produce an amplicon and detecting the presence of said DNA amplicon molecule; wherein presence of more than one DNA amplicon is indicative of heterozygosity of the transgenic brinjal event EE6726; wherein presence of one DNA amplicon comprising of sequence as set forth in SEQ ID No.12 is indicative of homozygosity of the transgenic brinjal event EE6726.

10. A DNA diagnostic kit for detecting the presence of EE-6726 event in a sample; said kit comprising: a. a first primer selected from SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 15, and/or SEQ ID NO: 16 or its complements or fragments thereof; and b. a second primer selected from SEQ ID NO: 13 or its complements or fragments thereof; wherein the sample is amplified with the said first and second primer producing an amplicon for the event EE-6726 for detecting the diagnostic amplicon as set forth in SEQ ID NO: 12.

11. A method of producing a progeny of an insect resistant brinjal plant comprising event EE6726, said method comprising: a. producing insect resistant brinjal plant by incorporating nucleic acid sequences as set forth in SEQ ID NO:7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11 and/or SEQ ID NO: 14, complements or fragments thereof comprising the transgene insertion and flanking genomic DNA of the brinjal event EE6726 to brinjal plant genome; b. crossing said insect resistant brinjal plant comprising the EE-6726 event with a brinjal plant without the said event; c. obtaining at least one progeny of brinjal plant derived from the said cross; and d. selecting a progeny of brinjal plant that is insect resistant and comprises nucleotide sequence of SEQ ID NO: 12.

12. An insect resistant brinjal plant, or parts thereof comprising at least one nucleic acid sequence selected from the group of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14 forms a part of the plant's genome.

13. The brinjal plant as claimed in claim 12 comprising a seed, nucleus, or part thereof capable of producing an amplicon comprising SEQ ID NO: 12 and diagnostic for EE-6726 event.

14. The seed as claimed in claim 13, wherein said seed comprises nucleic acid capable of producing an amplicon having SEQ ID NO: 12 diagnostics for EE-6726 event and having an accession number NCIMB 41810.

Specification

DESC:FIELD OF INVENTION
This invention relates to a novel transformation event EE-6726 of brinjal plant, Solanum melongena that exhibits tolerance to fruit and shoot borer. The invention also provides nucleic acid molecules that are unique to the event and methods related to the same. Kits and methods in conducting assays for detection of the event EE-6726 are also provided.

BACKGROUND OF INVENTION
Brinjal or eggplant (Solanum melongena L.) is an important solanaceous crop of sub tropics and tropics. It is a staple food in India and other countries in South and Southeast Asia where it is also known as brinjal, whereas the name eggplant has been derived from the shape of the fruit of some varieties, which are white and resemble in shape to chicken eggs. It comes in a variety of shapes and colors. It is one of the most common, popular and principal vegetable crops grown throughout the country except higher altitudes.

The popularity of brinjal is due to its versatile nature and this crop can adopt to different agro climatic regions and also grown throughout the year. It is a perennial but grown commercially as an annual crop. A number of cultivars are grown in India, consumer preference being dependent upon fruit colour, size and shape.

The benefits of eggplant do not stop with the farmers, it is beneficial for human health because it is high in fiber and water, rich in antioxidants, and a good source of vitamins and minerals. Brinjal plants are susceptible to insect infestation in all areas of the world in which the plants are cultivated. However, in recent years the production of brinjal in the Indian sub-continent has been seriously affected due to a steady increase in the insect pest infestation, especially the fruit and shoot borer, Leucinodes orbonalis (Guen). Eggplant farmers suffer significant yield losses at 51-73% annually due to the Eggplant Fruit and Shoot Borer (FSB) Leucinodes orbonalis Guenée (Lepidoptera: Crambidae). The adult female lay eggs on the buds and growing fruits. The larvae, upon hatching, bore into the fruits and shoots causing severe damage and rendering the fruits inedible. The young larvae of the fruit and shoot borer, bore into petioles and midribs of large leaves and tender shoots causing shoot tips to wilt and later they bore into flower buds and fruits. The affected fruits lose their market value over and above the considerable reduction in yield. In India, it has been estimated that fruit and shoot borer causes damage to fruits ranging from 25.8 - 92.5 % and yield reduction from 20.7 - 60%.

Caterpillars damage eggplant shoots and flowers, but the most serious damage is caused by their boring into the fruit and rendering it unmarketable. Farmers routinely spray broad-spectrum insecticides, often two to three times per week, and, in some cases, twice a day. Consequently, over 100 sprays per season may be applied, resulting in high residues on the fruit. Farmers lose anywhere from 30 to 60% of the crop yield to EFSB despite the high use of insecticides. The cost of insecticide treatments accounts for 35 to 40% of the total cost of cultivation of brinjal. Such an insecticide-dependent strategy poses both environmental and health concerns.

Farmers use large quantities of chemical insecticides singly or in combination to get blemish free fruits, which fetch premium prices in the market. This practice of indiscriminate use of insecticides leads to build up of pesticide residues in the produce, destruction of natural enemies, pest resurgence and environmental pollution. Recombinant DNA technology has been applied to plants for more than a decade to improve varieties due to their economic significance. Brinjal plants which exhibit improved characteristics as a result of the insertion of heterologous DNA sequences have been produced using such recombinant DNA technology and it exhibits following improvement.

To reduce pest-linked damage in brinjal crop as well as to protect the environment from adverse effects of pesticides, deploying the lepidopteran specific cry1Ac or cry2Ab gene under the control of a suitable promoter for a high level of expression in brinjal have been developed to provide an effective built-in control for fruit and shoot borer. This would result in bringing down the cultivation costs of brinjal, as contribution of chemical pesticides to brinjal cultivation is sizable.

Transgenic plants with Bacillus thuringensis (Bt) gene developed to date produce one Cry toxins constitutively, conferring continuous pest insect resistance without affecting non target insects. One of the main issues related to use of this technology is the potential for development of resistance by target insect pests due to intense selection pressure. Although altered toxin binding is the best-characterized mechanism of resistance, alteration of any step in the toxin mode of action can result in decreased susceptibility.
The source organism for cry2Abgene is Bacillus thuringiensis (Bt), which is a gram positive bacterium synthesizing insecticidal crystalline (Cry) inclusions during sporulation. The cry2Abgene encodes the Cry2Ab protein (?-endotoxins) and is highly specific to Lepidopteran larvae. Cry2Ab protein must be ingested by the insect to exhibit insecticidal activity. The protein in its crystalline form is insoluble in aqueous solution at neutral or acidic pH however the pH of the larval insect gut is alkaline which favors solubilization of the protein crystal. The solubilized protein is subsequently activated by the proteases in the insect gut. The activated protein, diffuses through the peritrophic membrane of the insect to the midgut epithelium. Here it binds to specific high affinity receptors on the surface of the midgut epithelium of target insects. Pores are formed in the membrane leading to leakage of intracellular content (eg. K+) into the gut lumen and water into the epithelial gut cells. The larval gut epithelial cells swell due to osmotic pressure and lyse. The gut becomes paralyzed as a consequence of changes in electrolytes and pH in the gut resulting into starvation and death of larvae.
A number of groups have carried out transformation of brinjal using different methods. The most successful of the methods are Agrobacterium-mediated methods for transformation (Kumar et. al.1998, Nicola et. al.1998, Fári et. al.1995, Rotino et. al.1990).

The expression of a foreign gene in plants is known to be influenced by the location of the transgene in the genome of the plant. Variations in transgene expression occur due to insertion into chromatin regions which may be more transcriptionally active (euchromatin) or less active (heterochromatin). Examples of these are methylated regions in which gene expression is suppressed, or in the proximity of transcriptional regulation elements like enhancers and
suppressor, which increase or decrease gene expression respectively. Therefore, it is necessary to screen a, large number of independent transformation event for the expression of the transgene and to identify the event showing desired expression of the heterologous inserted gene. Such selection often requires greenhouse and field trials with many events over multiple years, in multiple locations, and under a variety of conditions so that a significant amount of agronomic,
phenotypic, and molecular data may be collected. The resulting data and observations must then be analyzed by teams of scientists and agronomists with the goal of selecting a commercially suitable event. Such an event, once selected, may then be used for introgressing the desirable trait into other genetic backgrounds using plant breeding methods, and thus producing a number of different crop varieties that contain the desirable trait and are suitably adapted to specific local
growing conditions.

It is advantageous to be able to detect presence of a particular event in order to determine whether progeny of a sexual cross contain a transgenes of interest. In addition, a method for detecting a particular event may be helpful for complying with regulations requiring pre-market
approval of sale of seeds to produce transgenic crop plants and foods derived from such plants, for example, or for use in environmental monitoring, monitoring traits in crops in field, or monitoring products derived from a crop harvest, as well as for use in ensuring compliance of parties subject to regulatory or contractual terms.

It is possible to detect the presence of a transgene by any nucleic acid detection method known in
the art including but not limited to thermal amplification (PCR). For detection of a particular DNA construct that has been used for transforming various plant varieties, these detection methods generally focus on frequently used genetic elements, such as promoters, terminators, marker genes, etc., because for many DNA constructs, the coding sequence region is interchangeable. As a result, such methods may not be useful for discriminating between separate events produced from the same DNA construct or very similar constructs. These methods can be used, however, if the sequence of chromosomal DNA adjacent to the inserted DNA ("flanking DNA") is known. Specifically, one primer included sequence from within the T- DNA insert and a second primer included sequence from genomic DNA flanking the T- DNA.

SUMMARY OF THE INVENTION

In an aspect, the present invention provides a recombinant DNA comprising at least one junction sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and /or SEQ ID NO: 14, complements or fragments thereof comprising a transgene insertion and flanking genomic DNA of the brinjal event EE-6726.

The recombinant DNA of the present invention comprises at least one junction sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and /or SEQ ID NO: 14 comprises a sequence as set forth in SEQ ID NO: 12, and or its complement thereof, or a portion of SEQ ID NO: 12 or its complement thereof.

The recombinant DNA of the present invention comprises a primer sequence. The nucleic acid sequence as set forth in SEQ ID NO: 14 comprises a primer sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 15, and/or SEQ ID NO: 16 or its complements or fragments thereof.

The present invention further provides a primer comprising at least 10 contiguous nucleotides derived from the sequence as set forth in SEQ ID NO:14, or its complement, wherein the said DNA molecule is capable of producing an amplicon comprising of sequence as set forth in SEQ ID NO: 12.

In yet another aspect, the primer of the present invention is a pair of primers comprising of at least 15 contiguous nucleic acids each, wherein a first primer in said pair is selected from nucleic acid sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 15, and/or SEQ ID NO: 16; and a second primer sequence is as set forth in SEQ ID NO: 13, wherein said primer pair is capable of producing an amplicon comprising SEQ ID NO: 12 diagnostics for EE-6726 event.

In another aspect, the present invention provides a method of detecting the presence of EE-6726 event in a sample comprising the steps of contacting a sample comprising the DNA of interest with a first primer selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 15, and/or SEQ ID NO: 16; or its complements or fragments thereof; and a second primer sequence as set forth in SEQ ID NO: 13 or its complements or fragments thereof. The sample is then amplified producing an amplicon having the sequence SEQ ID NO: 12 for the event EE-6726. The amplified products are then analyzed and detected for the presence of diagnostic amplicon as set forth in SEQ ID NO: 12 for the EE-6726 event. The DNA of interest comprises the sequences as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14, complements or fragments or combinations thereof. The sample according to the present invention is a brinjal tissue.

In another aspect, the present invention provides a method of determining zygosity of DNA in a biological sample comprising the event EE6726. The method comprises contacting the biological sample with a first DNA primer selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 15, and/or SEQ ID NO: 16, complements or fragments or combinations thereof, a second DNA primer selected as set forth in SEQ ID NO: 13, complements or fragments thereof; and a third DNA primer as set forth in SEQ ID NO: 17, complements or fragments thereof. The biological sample can be amplified to produce an amplicon. The presence of said amplicon is detected where the presence of a DNA amplicon having a nucleotide sequence different from the nucleotide sequence comprising the amplicon sequence as set forth in SEQ ID NO:12 is indicative of heterozygosity of the transgenic brinjal event EE6726. The presence of a DNA amplicon having a nucleotide sequence identical to the nucleotide sequence comprising the amplicon sequence as set forth in SEQ ID NO: 12 is indicative of homozygosity of the transgenic brinjal event EE6726.

In another aspect, a DNA diagnostic kit for detecting the presence of EE-6726 event in a sample is provided. The DNA detection kit according to the present invention comprises a first primer selected from SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 15, and/or SEQ ID NO: 16 or its complements or fragments thereof; and a second primer selected from SEQ ID NO: 13 or its complements or fragments thereof. The sample is amplified with the said first and second primer producing an amplicon for the event EE-6726 for detecting the diagnostic amplicon as set forth in SEQ ID NO: 12.

The present invention also provides a method of producing a progeny of an insect resistant brinjal plant. The method comprises producing insect resistant brinjal plant by incorporating nucleic acid sequences as set forth in SEQ ID NO:7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11 and/or SEQ ID NO: 14, complements or fragments thereof comprising the transgene insertion and flanking genomic DNA of the brinjal event EE6726 to brinjal plant genome. The insect resistant brinjal plant comprising the EE-6726 event is crossed with a brinjal plant without the said event obtaining at least one progeny of brinjal plant derived from the said cross. The progeny of brinjal plant is selected that is insect resistant and comprises nucleotide sequence of SEQ ID NO: 12.

In an aspect, an insect resistant brinjal plant, or parts thereof is provided. The brinjal plant according to the present invention comprises at least one nucleic acid sequence selected from the group of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14 forms a part of the plant's genome.

The present invention also provides a brinjal plant comprising a seed, nucleus, or part thereof capable of producing an amplicon comprising SEQ ID NO: 12 and diagnostic for EE-6726 event. The seed of the brinjal plant of the present invention has an accession number NCIMB 41810.

BRIEF DESCTIPTION OF THE DRAWINGS
Figure 1 is a map of the construct pMH01010

Figure 2 is a digital image of gel of EE-6726 event using the event specific primers

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NO: 1 is the nucleic acid sequence representing the 5' region of T-DNA expression cassette (MHIP-8 primer).

SEQ ID NO: 2 is the adapter primer sequence used for amplification of T-DNA flanking genomic DNA sequence (AP primer).

SEQ ID NO: 3 is the nucleic acid sequence representing the 5' region of T-DNA expression cassette (MHIP-9 primer).

SEQ ID NO: 4 is the adapter primer sequence used for amplification of T-DNA flanking genomic DNA sequence (NAP-primer).

SEQ ID NO: 5 is the nucleic acid sequence used for sequencing the amplified fragment cloned in
pGEMT vector (T7 primer).

SEQ ID NO: 6 is the nucleic acid sequence used for sequencing the amplified fragment cloned in pGEMT vector (SP6 primer)

SEQ ID NO: 7 consists of a part of the adapter sequence (base pairs 1-30) adjacent to which is brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 31 to 368) from right border side the flanking genomic DNA sequence is followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 369 to 798).

SEQ ID NO: 8 consists of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 200) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 201 to 400).

SEQ ID NO: 9 consists of a brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 100) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 101 to 200).

SEQ ID NO: 10 consists of a brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 75) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 76 to150).

SEQ ID NO: 11 consists of a brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 50) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 51 to100).

SEQ ID NO: 12 consists of a brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 10) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 11 to 20).

SEQ ID NO: 13 is reverse primer designed in the T-DNA flanking genomic DNA region (MHTBJ-11).

SEQ ID NO: 14 represents EE-6726 event T-DNA flanking genomic DNA starting from SEQ ID No.13 from to cry2Ab gene.

SEQ ID NO: 15 is a primer sequence designed in the T-DNA region which when used in combination with SEQ ID No: 13 would act as a diagnostic tool for identification of EE-6726 event.

SEQ ID NO:16 is a primer sequence designed in the T-DNA region which when used in combination with SEQ ID No: 13 would act as a diagnostic tool for identification of EE-6726 event.
SEQ ID NO:17 represents a part of the T-DNA flanking genomic DNA sequence of EE-6726 event from left border side. This is a primer sequence designed in the T-DNA region which when used in combination with SEQ ID No: 3 and SEQ ID No: 13 would act as a diagnostic tool for identification of EE-6726 event. (MHTBJ-8)

DETAILED DESCRIPTION OF THE INVENTION
The following definitions and methods are provided to better define the present invention and to
guide those of ordinary skill in the art in the practice of the invention. Unless otherwise noted,
terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.

Definitions

As used herein, the term "comprising" means "including but not limited to".

The term "event" refers to a DNA molecule comprising the inserted DNA and the flanking brinjal genomic DNA immediately adjacent to either side of the inserted DNA. This DNA molecule is created by the act of inserting the transgenic DNA into the genome of the plant, i.e., by the act of transformation. This DNA molecule therefore comprises a nucleic acid sequence that is both specific to the event and that is unique to the genome of the plant into which the transgenic DNA has been inserted, in that this nucleic acid sequence contains both the sequence of a particular region of plant genomic DNA and of the transgenic DNA insert. The event comprises insertion of transgenic DNA into the chromosome/genome of the plant. An "event" is produced by: (i) transformation of a plant cell with a nucleic acid construct that includes a transgene of interest, (ii) regeneration of a population of plants resulting from the insertion of the transgene into the genome of the plant, and (iii) selection of a particular plant characterized by insertion of the transgene into a particular location in the plant's genome. The term “event” refers to the original transformant and any progeny produced by a sexual outcross between the original transformant or its descendants bearing the heterologous gene, and another brinjal variety.

As used herein, the term "brinjal" means Solanum melongena and includes all plant varieties that can be bred with brinjal, including wild brinjal species as well as those plants belonging to Solanum that permit breeding between species.

"Fruit and shoot borer" refers to pests causing damage to brinjal. Larva bores into tender shoots and causes withering of terminal shoots / dead hearts - also bores petioles of leaves, flower buds and developing buds, causes withering of leaves, shedding of buds and make fruits unfit for consumption. Attacked fruits are with boreholes plugged with excreta. Fruits become out of shape also.

As used herein, the term "recombinant" refers to a form of DNA and/or protein and/or an organism that would not normally be found in nature and as such was created by human intervention. Such human intervention may produce a recombinant DNA molecule and/or a recombinant plant.

As used herein, a "recombinant DNA molecule" is a DNA molecule comprising a combination of DNA molecules that would not naturally occur together and is the result of human intervention, e.g., a DNA molecule that is comprised of a combination of at least two DNA molecules heterologous to each other, and/or a DNA molecule that is artificially synthesized and comprises a nucleic acid sequence that deviates from the nucleic acid sequence that would normally exist in nature, and/or a DNA molecule that comprises a transgene artificially incorporated into a host cell's genomic DNA and the associated flanking DNA of the host cell's genome.

As used herein, a "recombinant plant" is a plant that would not normally exist in nature, is the result of human intervention, and contains a transgene and/or heterologous DNA molecule incorporated into its genome. As a result of such genomic alteration, the recombinant plant is distinctly different from the related wild type plant.

As used herein, the term "transgene" refers to a nucleic acid molecule artificially incorporated into a host cell's genome. Such transgene may be heterologous to the host cell. The term "transgenic plant" refers to a plant comprising such a transgene.

As used herein, the term "heterologous" refers to a first molecule not normally found in combination with a second molecule in nature. For example, a molecule may be derived from a first species and inserted into the genome of a second species. The molecule would thus be heterologous to the host and artificially incorporated into a host cell's genome.

As used herein, the term "chimeric" refers to a single DNA molecule produced by fusing a first DNA molecule to a second DNA molecule, where neither first nor second DNA molecule would normally be found in that configuration, i.e., fused to the other. The chimeric DNA molecule is thus a new DNA molecule not otherwise normally found in nature.

As used herein, the term "DNA", "DNA molecule", "nucleic acid molecule" refers to a DNA molecule of genomic or synthetic origin, i.e., a polymer of deoxyribonucleic acid bases or a nucleic acid molecule, read from the 5 ' (upstream) end to the 3' (downstream) end.

As used herein, the term "DNA sequence", "nucleic acid sequence" or "nucleic acid sequence" refers to the nucleic acid sequence of a DNA molecule.

A "junction sequence" or "junction region" refers to the DNA sequence and/or corresponding DNA molecule that spans the inserted transgenic DNA and the adjacent flanking genomic DNA.

A "primer" is typically a highly purified, nucleic acid that is designed for use in specific annealing or hybridization methods that involve thermal amplification. A pair of primers may be used with template DNA, such as a sample of brinjal genomic DNA, in a thermal amplification, such as polymerase chain reaction (PCR), to produce an amplicon, where the amplicon produced from such reaction would have a DNA sequence corresponding to sequence of the template DNA located between the two sites where the primers hybridized to the template.

As used herein, an "amplicon" is a piece or fragment of DNA that has been synthesized using amplification techniques. The term “amplicon” or “amplified DNA” refers to the product of nucleic acid amplification of a target nucleic acid sequence that is part of nucleic acid template.

The term "specific for (a target sequence)" indicates that a primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target sequence.

The term “DNA cassette” refers to the DNA sequence with the promoter for driving the Heterologous Gene/DNA and an appropriate terminator which when present together regulates a gene expression.

As used herein, "progeny" includes any plant, seed, plant cell, and/or regenerable plant part.

As used herein, a "plant part" includes but are not limited to pollen, ovule, pod, flower, and root or stem tissue, fibers, and leaves. Plant parts may be viable, nonviable, regenerable, and/or non-regenerable.

The present invention provides a transgenic brinjal event EE-6726 that exhibits commercially acceptable tolerance to fruit and shoot borer. Brinjal, Solanum melongena, has been genetically modified to resist Lepidopteran pests, thus, to remove the negative impact on brinjal production by these pests. This was accomplished by the insertion of the DNA cassette that encodes the insecticidal Cry 2Ab protein from Bacillus thuringiensis. This invention further relates to plants, plant parts, progeny plants which contain at least the nucleic acid sequences comprising the said DNA cassette, and to methods and compositions of matter for use in detecting the presence of said sequences in a sample.

The arrangement of the inserted DNA in brinjal event EE-6726 in relation to the surrounding brinjal plant genomic DNA is specific and unique for brinjal event EE-6726. This DNA molecule is also an integral part of the brinjal chromosome of event EE-6726 containing plants and as such is static in the plant and may be passed on to progeny of the plant.

The present invention provides the original transformant that includes the transgene inserted into the particular location in the plant's genome and progeny of the transformant that include the transgene inserted into the particular location in the plant's genome. Such progeny may be produced by a sexual outcross between the transformant, or its progeny, and another plant. Such other plant may be a transgenic plant comprising the same or different transgene and/or a non-transgenic plant, such as one from a different variety. Even after repeated back-crossing to a recurrent parent, the inserted DNA and flanking DNA from the transformed parent is present in the progeny of the cross at the same genomic location.

Event EE-6726 comprises an integrated transgenic expression cassette that confers tolerance to fruit and shoot borer to the brinjal plant.

Brinjal plants were transformed with a gene (cry2Ab) from Bacillus thuringiensis encoding crystal protein (Cry2Ab) that confers resistance to lepidopteran insects by selectively damaging their midgut lining. Cry2Ab is endotoxins that act as insecticides. Cry2Ab is useful for controlling a broad spectrum of pests.

The recombinant DNA described herein results from insertion of transgene into the brinjal genomic DNA, which may ultimately result in the expression of a recombinant RNA and/or protein molecule in that organism. A recombinant plant is a brinjal plant described herein as comprising event EE-6726.

In an aspect, the present invention thus provides a recombinant DNA comprising at least one junction sequence and their corresponding nucleic acid sequences. The junction sequences of the present invention is as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14, complements or fragments thereof comprising the transgene insertion and flanking genomic DNA of brinjal event EE-6726. The junction sequences of the present invention as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14, complements or fragments thereof are disclosed with reference to only one strand of the two complementary nucleic acid sequence strands. By implication, the complementary sequences (i.e. the sequences of the complementary strand), also referred to in the art as the reverse complementary sequences, are within the scope of the invention and are expressly intended to be within the scope of the subject matter claimed.

In an aspect, the junction sequences may be arbitrarily represented by the nucleic acid sequence as set forth in SEQ ID NO: 7 consisting of a part of the adapter sequence (base pairs 1-30) adjacent to which is brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 31 to 368) from right border side. The flanking genomic DNA sequence is followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 369 to 798). In another aspect, the junction sequence may be represented by the nucleic acid sequence as set forth in SEQ ID NO: 8 consisting of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 200) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 201 to 400). In a further aspect, the junction sequence may be represented by the nucleic acid sequence as set forth in SEQ ID NO: 9 consisting of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 100) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 101 to 200). In another aspect, the junction sequences may be represented by the nucleic acid sequence nucleic acid sequence as set forth in SEQ ID NO: 10 consisting of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 75) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 76 to150). In yet another aspect, the junction sequences may be represented by the nucleic acid sequence nucleic acid sequence as set forth in SEQ ID NO: 11 consisting of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 50) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 51 to100). In another aspect, the junction sequences may be represented by the nucleic acid sequence as set forth in SEQ ID NO: 14 consisting of EE-6726 event T-DNA flanking genomic DNA starting from SEQ ID No.13 to cry2Ab gene. These recombinant nucleic acids are present in brinjal EE-6726 event as part of the genome. The identification of one or more of nucleic acid sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 14 in a sample derived from a brinjal plant, seed, or plant part is determinative that the DNA was obtained from brinjal event EE-6726 and is diagnostic for the presence of brinjal event EE-6726.

In an embodiment, the present invention provides at least one junction sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14, comprises a sequence as set forth in SEQ ID NO: 12, and or the complement thereof, or a portion of SEQ ID NO: 12 or its complement or fragments thereof. SEQ ID NO:12 consists of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 10) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 11 to 20).
The invention thus provides a DNA molecule that contains at least one of the nucleic acid sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 14. Any segment of DNA derived from transgenic brinjal event EE-6726 that is sufficient to include at least one of the sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 14 and comprises SEQ ID NO: 12 is within the scope of the invention. In addition, any nucleic acid comprising a sequence complementary to any of the sequences described within this paragraph is within the scope of the invention.

The nucleic acid sequence corresponding to the nucleic acid sequence of the inserted transgenic
DNA and substantial segments of the brinjal genomic DNA flanking right border end of the inserted transgenic DNA is provided herein as SEQ ID NO: 12 or complement thereof. A subsection of the inserted transgenic DNA is provided as SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 14 or complement thereof.

The brinjal event EE-6726 further comprises a region spanning the 5' end where the transgenic DNA is inserted into the genomic DNA, referred to herein as the 5' junction.

The sequence of the heterologous DNA inserts, junction sequences, or flanking sequences from brinjal event EE-6726 can be verified (and corrected if necessary) by amplifying such sequences from the event using primers derived from the sequences provided herein followed by standard DNA sequencing of the amplicon or of the cloned DNA.

The invention provides exemplary DNA molecules that can be used either as primers or probes for diagnosing the presence of DNA derived from a brinjal plant comprising event EE-6726 in a sample. Such primers or probes are specific for a target nucleic acid sequence and as such are useful for the identification of brinjal event EE-6726 nucleic acid sequence by the methods of the invention described herein.

A primer can be typically designed to hybridize to a complementary target DNA strand to form a
hybrid between the primer and the target DNA strand, and the presence of the primer is a point of recognition by a polymerase to begin extension of the primer (i.e., polymerization of additional nucleic acids into a lengthening nucleic acid molecule) using as a template the target DNA strand.

The present invention thus provides recombinant DNA wherein the nucleic acid sequence as set forth in SEQ ID NO: 14 comprises a primer sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 15, and/or SEQ ID NO: 16 or its complements or fragments thereof. The primer sequences of the present invention can be used specifically in combinations to amplify the transgenic insertion locus for use as a diagnostic tool. The primers of the present invention were designed to amplify the transgenic insertion locus for use as a diagnostic tool. For the amplification of the EE-6726 event, any primer pair derived from SEQ ID NO: 14 that when used in DNA amplification reaction produces a DNA amplicon consisting of SEQ ID 12 is diagnostic for EE-6726 event is an aspect of the present invention. Any modification of the method of the present invention that use DNA molecules or complements thereof to produce an amplicon DNA molecule diagnostic for EE-6726 event can be apparent to the person ordinarily skilled of the art.

The present invention further provides that primers comprising at least 10 contiguous nucleotides selected from a sequence as set forth in SEQ ID NO:14, or its complement, wherein the said DNA molecule is capable of producing an amplicon comprising of sequence as set forth in SEQ ID NO: 12. The primers can be a pair comprising at least 15 contiguous nucleic acids each. The primer can comprise a first primer and a second primer. In one aspect, the first primer is a forward primer and the second primer is a reverse primer. The primer pairs of the present invention can be used for diagnosis of the event.

In an aspect, the first primer in said pair can be selected from nucleic acid sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 15, and/or SEQ ID NO: 16. The second primer sequence can be as set forth in SEQ ID NO: 13. A primer pair is capable of producing an amplicon comprising SEQ ID NO: 12 diagnostics for EE-6726 event. For example, the first primer in said pair can be a nucleic acid sequence as set forth in SEQ ID NO: 3 and the second primer sequence can be SEQ ID NO: 13, wherein said primer pair is capable of producing an amplicon comprising SEQ ID NO: 12 diagnostics for EE-6726 event. If SEQ ID NO: 13 primer if used with SEQ ID No:15 will produce an amplicon of 1150 base pair, or with SEQ ID NO: 16 will amplify 1420 base pair from EE-6726 event.

Primer pairs, as used in the invention, are intended to refer to use of two primers binding to the opposite strands of a double stranded nucleic acid segment for the purpose of amplifying linearly the nucleic acid segment between the positions targeted for binding by the individual members of
the primer pair, typically in a thermal amplification reaction or other conventional nucleic-acid amplification methods. Exemplary DNA molecules useful as primers as set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 15, and/or SEQ ID NO: 16 or its complements or fragments thereof.

Any number of methods well known to those skilled in the art can be used to isolate and manipulate a DNA molecule, or fragment thereof, disclosed in the invention. For example, PCR
(polymerase chain reaction) technology can be used to amplify a particular DNA molecule and/or to produce variants of the original molecule. DNA molecules, or fragment thereof, can also be obtained by other techniques such as by directly synthesizing the fragment by chemical means, as is commonly practiced by using an automated oligo nucleic acid synthesizer.

The DNA molecules and corresponding nucleic acid sequences provided herein are therefore useful for, among other things, identifying brinjal event EE-6726, selecting plant varieties or hybrids comprising brinjal event EE-6726, detecting the presence of DNA derived from the transgenic brinjal event EE-6726 in a sample, detecting the presence of DNA derived from the transgenic brinjal event EE-6726 along with any other brinjal event in a sample and monitoring samples for the presence and/or absence of brinjal event EE-6726 or plant parts derived from brinjal plants comprising event EE-6726.

In another aspect, a method of detecting the presence of EE-6726 event in a sample is provided. The method comprises contacting a sample comprising the DNA of interest with a first primer selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 15, and/or SEQ ID NO: 16; or its complements or fragments thereof; and a second primer sequence as set forth in SEQ ID NO: 13 or its complements or fragments thereof. The sample is amplified producing an amplicon having the sequence SEQ ID NO: 12 for the event EE-6726. The amplified product is analyzed for the presence of SEQ ID NO: 12 for the EE-6726 event. The diagnostic amplicon is detected as set forth in SEQ ID NO: 12. The sample comprising the DNA of interest can include a recombinant DNA molecule as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14 and/or complements or fragments or combinations thereof. The sample can be a brinjal tissue.

The detection of a nucleic acid sequence specific for event EE-6726 in the amplicon is determinative and/or diagnostic for the presence of the brinjal event EE-6726 specific DNA in the sample. An example of a primer pair that is capable of producing an amplicon from event EE-6726 DNA under conditions appropriate for DNA amplification of nucleic acid sequence as set forth in SEQ ID NO: 3 and SEQ ID NO: 13, SEQ ID NO: 15 and SEQ ID NO: 13, and/or SEQ ID NO: 16 and SEQ ID NO: 13 or its complements or fragments thereof. Other primer pairs may be readily designed by one skilled in the art.

In another aspect, the present invention provides a method of determining zygosity of DNA in a biological sample comprising the event EE6726. The method according to the present invention comprises contacting the biological sample with a first DNA primer selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 15, and/or SEQ ID NO: 16, complements or fragments or combinations thereof, a second DNA primer selected as set forth in SEQ ID NO: 13, complements or fragments thereof; and a third DNA primer as set forth in SEQ ID NO: 17, complements or fragments thereof. The sample containing DNA is then amplified to produce an amplicon. The presence of said DNA amplicon molecule is detected by gel electrophoresis. The presence of more than one DNA amplicon band is indicative of heterozygosity of the transgenic brinjal event EE-6726. The presence of one DNA amplicon band comprising of sequence as set forth in SEQ ID No.12 is indicative of homozygosity of the transgenic brinjal event EE-6726. In an aspect, homozygosity is desirable in transgenic plants to ensure the stable integration and inheritance of transgene. The method of the present invention provides a simple and cost-effective method of determining zygosity of DNA in a biological sample comprising the event EE-6726.

In further aspect, a DNA diagnostic kit for detecting the presence or EE-6726 is provided. The kit in one aspect comprises a primer pair useful for producing an amplicon comprising SEQ ID No. 12 useful for detecting the presence and/or absence of DNA derived from transgenic brinjal event EE-6726 in a sample. Such a kit would employ a method comprising contacting a target DNA sample with a primer pair as described herein, then performing a nucleic acid amplification reaction sufficient to produce an amplicon comprising a DNA molecule having SEQ ID NO:12; having at least one nucleic acid sequence as set forth in SEQ ID NO:7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11 and/or SEQ ID NO: 14 or complement thereof, and then detecting the presence and/or absence of the amplicon. Such a method may also include sequencing the amplicon or a fragment thereof, which would be determinative of, i.e. diagnostic for, the presence of the brinjal event EE-6726 specific DNA in the target DNA sample.
The DNA diagnostic kit according to the present invention comprises a first primer selected from SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 15, and/or SEQ ID NO: 16 or its complements or fragments thereof; and a second primer selected from SEQ ID NO: 13 or its complements or fragments thereof. The sample is amplified with the said first and second primer producing an amplicon for the event EE-6726 for detecting the diagnostic amplicon as set forth in SEQ ID NO: 12. In an embodiment, the diagnostic kit for detecting the detecting the presence of EE-6726 event in a sample comprises a forward primer selected from SEQ ID NO: 3 or its complements or fragments thereof; and a reverse primer selected from SEQ ID NO: 13 or its complement or fragments thereof.

DNA detection kits are provided that are useful for the identification of brinjal event EE-6726 DNA in a sample and can also be applied to methods for breeding brinjal plants containing the appropriate event DNA. Such kits contain DNA primers and/or probes comprising fragments of nucleic acid sequence as set forth in SEQ ID NO:1, SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 15; and/or SEQ ID NO: 16 or its complement or fragments thereof. Nucleic-acid amplification can be accomplished by any of the various nucleic- acid amplification methods known in the art, including thermal amplification methods. Many techniques are known in the art for detecting, quantifying, and/or sequencing the amplicon produced by these methods.

The kits and detection methods of the invention are useful for, among other things, identifying
brinjal event EE-6726, selecting plant varieties or hybrids comprising brinjal event EE-6726, detecting the presence of DNA derived from the transgenic brinjal plants comprising event EE-6726 in a sample, and monitoring samples for the presence and/or absence of brinjal plants comprising event EE-6726 or plant parts derived from brinjal plants comprising event EE-6726.

The present invention also provides a method of producing a progeny of an insect resistant brinjal plant. The method of producing a transgenic brinjal plant resistant to insect pests comprising transforming a brinjal cell with the DNA construct pMHO1010. The method comprises producing insect resistant brinjal plant by incorporating nucleic acid sequences as set forth in SEQ ID NO:7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11 and/or SEQ ID NO: 14, complements or fragments thereof comprising the transgene insertion and flanking genomic DNA of the brinjal event EE-6726 to brinjal plant genome. Crossing said insect resistant brinjal plant comprising the EE-6726 event with a brinjal plant without the said event and obtaining at least one progeny of brinjal plant derived from the said cross. The progeny of brinjal plant is selected that is insect resistant and comprises nucleotide sequence of SEQ ID NO: 12.

In yet another aspect, the present invention provides an insect resistant brinjal plant, or parts thereof. The present invention also provides an insect resistant transgenic brinjal plant comprising an event EE-6726. The present invention relates to an insect resistant transgenic brinjal plant comprising an elite event EE-6726. The transgenic plant is characterized by harboring the cry2Ab gene under the control of CaMV e35S promoter at a specific locus in the brinjal genome. Further, the invention discloses a method for detection of an event EE-6726 in transgenic brinjal plant. The invention further provides a kit for identification of the transgenic plants comprising the event EE-6726.

The brinjal plant according to the present invention comprises at least one nucleic acid sequence selected from the group of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14 forms a part of the plant's genome. The present invention also provides a brinjal plant, seed, nucleus, or part thereof comprising at least one nucleic acid sequence selected from the group of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14 that is capable of producing an amplicon comprising SEQ ID NO: 12 and diagnostic for EE-6726 event. The seed according to the present invention is capable of producing an amplicon comprising SEQ ID NO: 12 and is diagnostic for EE-6726 event and having an accession number NCIMB 41810.

The invention thus provides brinjal plants, progeny, seeds, plant cells, and plant parts (such as pollen, ovule, pod, flower tissue, root tissue, stem tissue, and leaf tissue). These plants, progeny,
seeds, plant cells, plant parts, and commodity products contain a detectable amount of a nucleic acid of the invention, i.e., such as a nucleic acid having at least one of the nucleic acid sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and /or SEQ ID NO: 14, complements or fragments thereof. Plants, progeny, seeds, plant cells, and plant parts of the invention may also contain one or more additional transgenes. Such transgene may be any nucleic acid sequence encoding a protein or RNA molecule conferring a desirable trait including but not limited to increased insect resistance, increased water use efficiency, increased yield performance, increased drought resistance, increased seed quality, improved nutritional quality, and/or increased herbicide tolerance, in which the desirable trait is measured with respect to a brinjal plant lacking such additional transgene.

The present invention provides brinjal plants, progeny, seeds, plant cells, and plant part such as pollen, ovule, pod, flower, root or stem tissue, and leaves derived from a transgenic brinjal plant comprising event EE-6726. A representative sample of brinjal seed comprising event EE-6726 has been deposited according to the Budapest Treaty with the National Collection of Industrial, Food and Marine Bacteria (NCIMB). The NCIMB repository has assigned the Patent Deposit Designation 41810 to the event EE-6726 comprising seed.

Plants of the present invention may pass along the event DNA, including the transgene, to progeny. The progeny comprising the event DNA derived from an ancestor plant and/or comprising a DNA molecule having at least one nucleic acid sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and /or SEQ ID NO: 14, complements or fragments thereof. Plants, progeny, and seeds may be homozygous or heterozygous for the transgene. Progeny may be grown from seeds produced by a brinjal event EE-6726 containing plant and/or from seeds produced by a plant fertilized with pollen from a brinjal event EE-6726 containing plant.

A varietal or hybrid seed or plant of the present invention may thus be derived by crossing a first parent that lacks the specific and unique DNA of the brinjal event EE-6726 with a second parent comprising brinjal event EE-6726, resulting in a hybrid comprising the specific and unique DNA of the brinjal event EE-6726. Each parent can be a hybrid or an inbred/varietal so long as the cross or breeding results in a plant or seed of the invention, i.e., a seed having at least one allele containing the DNA of brinjal event EE-6726 and/or a DNA molecule having at least one nucleic acid sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 and /or SEQ ID NO: 14. Two different transgenic plants may thus be crossed to produce hybrid offspring that contain two independently segregating, added, exogenous genes. For example, the EE-6726 containing fruit and shoot borer tolerant brinjal can be crossed with other transgenic brinjal plants to produce a plant having the characteristics of both transgenic parents. One example of this would-be a cross of EE-6726 containing fruit and shoot borer tolerant brinjal with a plant having one or more additional traits such as herbicide tolerance and/or insect control, resulting in a progeny plant or seed that is tolerant to fruit and shoot borer and has at least one or more additional traits. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation.

The invention provides methods for controlling insects and methods for producing plants with
brinjal event EE-6726. A method for controlling insects in a field is provided and consists of planting brinjal event EE-6726 containing varietal or hybrid plants in a field and exposing plants to fruit and shoot borer in the field without injuring the EE-6726 containing plants. A brinjal plant that tolerates fruit and shoot borer may be produced by sexually crossing an event EE-6726 containing plant comprising a DNA molecule having at least one nucleic acid sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 14 with another brinjal plant and thereby producing seed, which is then grown into progeny plants. These progeny plants may then be exposed to fruit and shoot borer to select the progeny plants that are tolerant to fruit and shoot borer insects. Alternatively, these progeny plants may be analyzed using diagnostic methods to select the progeny plants that contain the event EE-6726 DNA. The other plant used in the crossing may or may not be tolerant to fruit and shoot borer and may or may not be transgenic. The progeny plant and/or seed produced may be varietal or hybrid seed. In practicing this method, the step of sexually crossing one plant with another plant, i.e., cross-pollinating, may be accomplished or facilitated by human intervention, for example: by human hands collecting the pollen of one plant and contacting this
pollen with the style or stigma of a second plant; by human hands and/or actions removing, destroying, or covering the stamen or anthers of a plant (e.g., by detasseling or by application of a chemical gametocide) so that natural self-pollination is prevented, and cross-pollination would have to take place in order for fertilization to occur; by human placement of pollinating insects in a position for "directed pollination" (e.g., by placing beehives in orchards or fields or by caging
plants with pollinating insects); by human opening or removing of parts of the flower to allow for placement or contact of foreign pollen on the style or stigma (e.g., in soy which naturally has flowers that hinder or prevent cross-pollination, making them naturally obligate self-pollinators without human intervention); by selective placement of plants (e.g., intentionally planting plants in pollinating proximity); and/or by application of chemicals to precipitate flowering or to foster
receptivity (of the stigma for pollen).

A brinjal plant that is tolerant to brinjal fruit and shoot borer may be produced by selfing an event EE-6726 containing plant comprising a DNA molecule having at least one nucleic acid sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 14 and thereby producing seeds, which is then grown into progeny plants. These progeny plants may then be exposed to fruit and shoot borer to select for progeny plants that are tolerant to fruit and shoot borer. Alternatively, these progeny plants may be analyzed using diagnostic methods to select for progeny plants that contain the event EE-6726 DNA. In practicing this method, the step of sexually crossing one plant with itself, i.e., self-pollinating or selfing, may be accomplished or facilitated by human intervention, for example: by human hands collecting the pollen of the plant and contacting this pollen with the style or stigma of the same plant and then optionally preventing further fertilization of the plant; by human hands and/or actions removing, destroying, or covering the stamen or anthers of other nearby plants (e.g., by detasseling or by application of a chemical gametocide) so that natural cross-pollination is prevented and self-pollination would have to take place in order for fertilization to occur; by human placement of pollinating insects in a position for "directed pollination" (e.g., by caging a plant alone with pollinating insects); by human manipulation of the flower or its parts to allow for self-pollination; by selective placement of plants (e.g., intentionally planting plants beyond pollinating proximity); and/or by application of chemicals to precipitate flowering or to foster receptivity (of the stigma for pollen).

Progeny of brinjal plants and seeds encompassed by these methods and produced by using these methods will be distinct from other brinjal plants, for example because the progeny of brinjal plants and seeds: are recombinant and as such created by human intervention; are fruit and shoot borer tolerant; contain at least one allele that consists of the transgene DNA of the invention; and/or contain a detectable amount of a DNA molecule comprising at least one nucleic acid sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 14. A seed may be selected from an individual progeny plant, and so long as the seed comprises a DNA molecule having at least one nucleic acid sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID
NO: 11 or SEQ ID NO: 14, it will be within the scope of the invention.

The invention provides a transgenic plant comprising a DNA molecule having at least one nucleic acid sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 14present in its genome. In this process, recombinant DNA is inserted into a plant cell's genome to create a transgenic plant cell that is
separate and unique from naturally occurring plant cells. This transgenic plant cell can then be cultured using modern techniques. The new plant cell's genetic composition and phenotype is a technical effect created by the integration of the heterologous DNA into the genome of the cell. Another aspect of the invention is a method using modern plant tissue culture techniques to produce transgenic plants.

The methods of the invention are therefore useful for, among other things, controlling insects in a field while growing plants for the purpose of producing seed and/or plant parts comprising brinjal event EE-6726 for agricultural or research purposes, selecting for progeny comprising brinjal event EE-6726 for plant breeding or research purposes, and producing progeny plants and seeds comprising brinjal event EE-6726.

The plants, progeny, seeds, plant cells, plant parts (such as pollen, ovule, pod, flower, root or stem tissue, and leaves), and commodity products of the invention may be evaluated for DNA composition, gene expression, and/or protein expression. Such evaluation may be done by using
any standard method such as PCR, for detection and/or the detection kits provided herein.

The present invention provides efficient method for transforming plant, plant cells and tissues of brinjal (Solanum melongena) using Agrobacterium mediated method for conferring resistance to insect pests. In one aspect, Agrobacterium tumefaciens strain LBA4404can be used. The strain of Agrobacterium tumefaciens can be obtained from commercial sources known to a person skilled in the art. Some commonly available commercial strains are EHA 101, EHA 105, LBA 4404 and the like.

The DNA cassette was inserted into the genome of brinjal through Agrobacterium transformation using a DNA fragment derived from vector pMH01010 to produce brinjal event EE-6726.

The method of producing a transgenic Brinjal plant resistant to insect pests according to the present invention comprising transforming a brinjal cell with the DNA construct pMHO1010. The fertile brinjal plant obtained from the said brinjal cell can be self-pollinated or crossed with
compatible brinjal varieties to produce insect resistant brinjal plant.

Insecticidal cry2Ab gene from Bacillus thuringiensis has been transferred into brinjal line BJ60208 developed by MAHYCO. The present invention provides an efficient method for transforming plant, plant cells and tissues of brinjal (Solanum melongena) plant using Agrobacterium- mediated transformation method for conferring resistance to insect pests.

The vector pMHO1010 (Figure 1) containing cry2Ab gene under the control of CaMVe35S promoter and ve10518 terminator; was transformed in the Agrobacterium tumefaciens cells. The recombinant Agrobacterium tumefaciens was inoculated into a suitable medium for its growth. Agrobacterium cells were inoculated into 25 ml of sterile LB medium (Table 1) at 28°C with shaking at 175 rpm with the respective antibiotics.

The explants for transformation are selected from a group consisting of cotyledon with petiole, hypocotyls, embryo, immature embryo, leaf lamina, cotyledonary axil, shoot tip, anther, root and callus or any other suitable explant. The details of the transformation of the brinjal (Solanum melongena) plant are provided in Example 1. Explants were inoculated in recombinant Agrobacterium suspension (preferably 15 minutes), blotted dry on sterile filter paper and later transferred to petri plates containing suitable growth medium for co-cultivation.

After the co-cultivation (2 to 5 days preferably 3 days of co-cultivation), these explants were were transferred on selection medium B1KC (Table 1) medium with kanamycin 50 mg/l and cefatoxime 250 mg/l for a period of 2 weeks.

Transformants regenerated on the selection medium were transferred to rooting medium and the rooted plants were hardened and established in green house.

Detailed procedure of transformation of brinjal plant with the pMHO1010 construct is provided in the Example 1.

Another embodiment of the present invention is to provide a method of identification of the flanking sequence around the transgenic insertion site for the event EE-6726 by PCR amplification. Nucleic acid amplification can be accomplished by any of the various nucleic acid
amplification methods known in the art, including the polymerase chain reaction (PCR).

Transgenic insertion and neighboring flanking brinjal DNA were purified by agarose gel electrophoresis and cloned. The cloned fragment was sequenced by methods known in the art. The sequence flanking the junction of the insertion is shown in nucleic acid sequence as set forth
in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 14.

Another embodiment of the present invention is to provide diagnostic methods for identification
of the EE-6726 event. Details of PCR method of identification of the EE-6726 event are given in Example 4.

The present invention also provides a synthetic oligo nucleic acid for the detection of the presence of brinjal plant EE-6726 event, wherein the sequence of said oligo nucleic acid is selected from a group consisting nucleic acid sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 14.

The present invention further relates to a transgenic plant or seed having the brinjal plant EE-6726 event, wherein the genome of said EE-6726 event comprises of nucleic acid sequence as set forth in SEQ ID NO: 7 or SEQ ID NO: 8 or SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 and/or SEQ ID NO: 14 comprising of SEQ ID NO: 12 or complement thereof.

While the invention is broadly as defined above, it will be appreciated by those persons skilled in the art that it is not limited thereto and that it also includes embodiments of which the following description gives examples. The following examples are included to demonstrate examples of certain preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches the inventors have found function well in the practice of the invention, and thus can be considered to constitute examples of preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Examples:
In the present invention the cry2Ab gene of Bacillus thruingiensis has been transferred into brinjal line 60208 developed by MAHYCO which has the following characters:
Fruit color: Purple, white variegated Fruit shape: Oval Plant habit: Bushy
Fruit development: In clusters
Calyx: Spiny
Independent transformation events were screened to identify a brinjal EE-6726 event. All events underwent transgene segregation analysis and protein expression evaluation to determine the optimum event for commercialization. Details are provided in the Example 2.

Molecular characterization of the brinjal plant EE-6726 event was carried out. Details are provided in the Example 3. Further diagnostic methods for identification of the brinjal plant EE-6726 event was carried out details are provided in Example 4.

The brinjal event EE-6726 was chosen on the basis of a number of criteria. Segregation analysis over three generations indicated that there is a single locus of insertion of the cry 2Ab gene in this line. This was confirmed by DNA blot analysis. Protein quantification studies using quantitative ELISA were performed on a number of brinjal single insertion events. These studies indicated that the EE-6726 line expressed the Cry2Ab protein, and that the expression of the inserted gene was stable in a number of different genetic backgrounds, over multiple generations. Phenotypic analysis of the EE-6726 event bearing line showed that it was morphologically indistinguishable from the non-transformed parent line from which it was derived, and therefore most suitable for further backcross breeding.
Nucleic acid amplification can be accomplished by any of the various nucleic acid amplification
methods known in the art, including the polymerase chain reaction (PCR). A variety of amplification methods are known in the art and are described in PCR protocols: a guide to methods and applications (ed. Innis et al., Academic Press, San Diego, 1990). Transgenic insertion and neighboring flanking brinjal DNA were purified by agarose gel electrophoresis and cloned. The cloned fragment was sequenced by methods known in the art.

Example 1: Transformation of Brinjal
Sterilization and inoculation of seeds
Seeds from a proprietary brinjal line of Maharashtra Hybrid Seeds Company Ltd. were surface sterilised in a 50 ml plastic centrifuge tube with 1.5 % NaOCl for 10 min. with vigorous shaking (20 ml NaOCl for 500 seeds). After 5 min the solution was decanted, and the seeds were washed 5 times with sterile distilled water. The seeds were blotted dry on sterile filter paper for 1 hr. and inoculated on MS0 medium (Table 1) in bottles at 10 seeds/bottle. The seeds were maintained at 25°C for 12-15 days to germinate with a photoperiod regime of 16 hrs light and 8 hrs darkness.
Agrobacterium cultures
A day before co-cultivation was to be done, a culture of the Agrobacterium strain harboring the transformation vector was grown overnight in 25 ml liquid LB medium (Table 1) at 28°C with shaking at 175 rpm with the respective antibiotics. This overnight culture was started with a loopful of bacterial cells taken from a freshly-streaked solid medium plate containing the same antibiotics.
Explant preparation
On the day of co-cultivation, cotyledons from 2-15 days old seedlings were removed and cut longitudinally in half through the midrib and used as explants. The explants were kept in petridishes on sterile filter papers soaked in liquid MS medium (Table 1) to prevent the explants from drying out.
Co-cultivation
The overnight grown bacterial culture was centrifuged at 10000 rpm for 10 min. The supernatant was discarded, and the pellet resuspended in liquid. MS medium (25 ml) and mixed well (Table 1). 25 ?l of 100mM acetosyringone was added to the bacterial culture which was then placed in the incubator for growth with shaking for a further 2 hr. The optical density (OD) of the bacterial culture was measured at 600 nm until an OD of 1.5 to 1.8 was reached. The explants were incubated in the bacterial culture in a petridish or a glass beaker for 10 min with slow stirring. The explants were then blotted on a sterile filter paper to remove excess bacteria and placed on co-cultivation medium B1AsP (Please find the media composition in table) for the three days for co-cultivation. (15 explants/ plate). The plates were incubated under light at 25°C for three days with a photoperiod regime of 16 hrs light + 8 hrs darkness.
Positive and negative controls were also maintained in each experiment. Positive controls were explants regenerated on medium without antibiotics to check the tissue culture regeneration, whereas negative controls are explants maintained on antibiotic-containing media to make sure the antibiotic is checking the growth.
Selection (B1KC medium)
After 3 days the explants were transferred on selection medium B1KC (Table 1) medium with kanamycin 50 mg/l and cefatoxime 250 mg/l for a period of 2 weeks. Transformed explants produce calli at the cut end of explants, and non- transformed explants bleach. Putative transformed explants were maintained on fresh selection medium B1KC again for two weeks. This was repeated for a total period of 6 weeks on selection medium. At the end of the sixth week, green meristematic tissues/calli develops.
Shoot Regeneration (B2KC medium)
Green meristematic tissues were transferred onto regeneration medium, B2 KC (Table 1), with kanamycin 50 mg/l and cefotaxime 250mg/l for a period 2 weeks. The calli were subcultured three times every 2 weeks (3 selections) on fresh medium resulting in small green shoot buds developing from the calli.
Shoot Elongation (B3KC medium)
The shoot buds were transferred onto B3KC medium (Table 1) with kanamycin 50 mg/lit and cefotaxime 250mg/l for a period of 2 weeks. The shoot buds were twice subcultured every 2 weeks (2 selections) on fresh medium. At the end of the fourth week, the shoot buds elongate and are ready for rooting. Sometimes on the elongation medium rooting may begin. If rooting starts on the elongation medium the plantlets were left undisturbed in order to avoid damage to the roots.
Rooting (B4KC medium)
The shoots were transferred onto rooting medium B4KC (Table 1) with kanamycin 50 mg/l and cefotaxime 250mg/li for a period of 2 weeks. The shoots were subcultured every 2 weeks till rooting occurred.
Hardening
The rooted plants were washed with sterile distilled water thoroughly to remove the gelling agent (agar or phytagel). The plants were treated with 0.1 % Bavistin for at least 1 hr. before transferring to cups containing mixture of promix (60%) and soil (40%). The plants were covered with polythene bags for 7 days. After 7 days, the polythene bags were cut from the corners to allow the hardening process to begin, which is completed in about 2 weeks

Table 1: Composition of media used in brinjal transformation
Sr. No. Medium Composition Purpose
1 LB Solid Trytone 10gm/L, Yeast extract 5gm/L, NaCl 10 gm/L, pH 7.0, Agar 15gm/L Bacterial culture
2 LB liquid Trytone 10gm/L, Yeast extract 5gm/L, NaCl 10 gm/L, pH 7.0 Bacteria inoculation.
3 MS liquid MS Salts (Murashige and Skoog 1962), MS Vitamins, Sucrose 3%, pH 5.8 Bacteria resuspension
4 MS0 MS Salts B5 Vitamins B5 vitamins (Gamborg et al. 1968), Sucrose 3%, pH 5.8, Agar 0.8% Seed inoculation
5 B1As MS Salts , B5 Vitamins, NAA 0.05mg/L, Zeatin 2mg/L, Glucose 1.5%, Acetosyringone 100uM pH 5.8, Phytagel 0.35% Co-cultivation
6 B1KC MS Salts, B5 Vitamins, NAA 0.05mg/L, Zeatin 2mg/L, Glucose 1.5%, Kanamycin 50 mg/l, Cefotaxime 250 mg/l , pH 5.8, Agar 0.8% Selection.
7 B2KC MS Salts, B5 Vitamins, BAP 2.5mg/L, Kinetin 1mg/l ,l Adenine(freebase) 2mg/L, IAA 0.5mg/l, Sucrose 3%, Kanamycin 50 mg/l, Cefotaxime 250 mg/l , pH 5.8, Agar 0.8% Shoot Bud Regeneration
8 B3KC MS Salts, MS Vitamins, IAA 0.5mg/l , Glucose 1.5%, Kanamycin 50 mg/l, Cefotaxime 250 mg/l , pH 5.8, Agar 0.8% Shoot Elongation.
9 B4KC MS Salts, B5 Vitamins, Glucose 0.75%, Kanamycin 50mg/L, Cefotaxime 250mg/L, pH 5.8, Phytagel 0.35%. Rooting.


Example 2: Identification of brinjal plant EE-6726 elite event
A large number (>50) of independent transformation events were generated in order to maximize the chance of a high-transgene-expressing, genetically stable event for production of commercial transgenic brinjal lines. All brinjal plants coming out of the transformation experiments were analyzed for presence of the cry2Ab gene by PCR, and the positive plants subjected to ELISA for determining the expressivity of the transgene. The initial transformants (T0) were advanced to the next generation by selfing, and the T1 progeny plants were checked by PCR to determine the segregation of the transgene. The expected T1 segregation ratio for the transgene in a line with a single cry2Ab gene insertion is 3:1 based on Mendelian genetics. Further, as cry2Ab acts as a dominant gene when introduced as a transgene, the expression of the gene was monitored by ELISA in the T1 generation. Again, in a single insertion event, the expected ratio of Cry2Ab expressing plants to non-expressing plants is 3:1. Insect bioassays were carried out on tissue from selected lines in order to determine which lines would have better efficacy against the fruit and shoot borer pest. Southern blot analysis of selected individual transformation events was carried out to confirm the number of loci (insert copy number) at which the transgene integrated in the brinjal genome.
Based on the above criteria, transformed lines were selected which displayed segregation characteristics of single locus insertion events and showed effective tolerance to fruit and shoot borer. Conversely, those lines that were found to have abnormal segregation ratios and/or low efficacy against the pest were not taken further. The lines selected for advancement were grown in the greenhouse and Cry2Ab protein was estimated through the life of the crop by quantitative ELISA, which enables determination of the highest protein expressing lines. The tissues analyzed were leaf, shoot, stem, flower and root. After a careful analysis of the above parameters, event EE-6726 was found to be the best available event, in terms of Cry2Ab expression, efficacy against the pest and genetic stability over three generations. Marker-free status of the selected event was confirmed by various analysis such as PCR, GUS assays, kanamycin sensitivity test and Southern hybridisation. The EE-6726 elite event was used for further breeding for developing fruit and shoot borer tolerant brinjal.
Example 3: Molecular characterization of the EE-6726 elite event
The transgenic brinjal event EE-6726 was analyzed to identify brinjal genomic DNA sequences flanking the cry2Ab gene expression cassette using the method of Cottage et al., (Plant Molecular Biology Reporter, December 2001). Plant genomic DNA was extracted from fresh young leaves of EE-6726 event bearing plants using the method known in the art. Genomic DNA (2µg) was digested with EcoR V enzyme in 20 µl of reaction volume using standard buffers. The digestion reaction was incubated at 370 C overnight. The digestion product was then incubated at 800 C for enzyme inactivation and was precipitated with 3M sodium acetate and ethanol. DNA was air dried and dissolved in 23 µl sterile distilled water. Digested DNA was ligated to the annealed adapter in ligase buffer supplied by the manufacturer. The sequences of the adapters are as below

ADAP 1: 5’ – cta ata cga ctc act ata ggg ctc gag cgg ccg ccc ggg cag gt – 3’
ADAP 2: 5’- P-acc tgc cc-H2N -3’

Both the adapters were at first annealed to each other and then ligated to the digested genomic DNA of EE-6726 event. The ligation mixture was incubated at 160C for overnight and was diluted to 100 ?l using sterile water. The adapter library was subjected to first round of PCR amplification using the following primer combination

MHIP-8 - 5’- CCA GTC CGG TGT AAG AAC GG -3’ SEQ ID NO: 1
AP - 5’- GGA TCC TAA TAC GAC TCA CTA TAG GGC-3’ SEQ ID NO: 2

The details of restriction digestion, ligation and PCR are given below:

Restriction digestion:
Genomic DNA 12.0 ?l (2 ?g)
10X Reaction buffer 2.0 ?l (final concentration 1x)
EcoR V enzyme 1.0 ?l (10units/ ?l)
Sterile water Make up the volume to 20.0 ?l.

Ligation:
Digested Genomic DNA 23.0 ?l (2 ?g)
Annealed adapters 3.0 ?l (100 ng/?l)
10X Reaction buffer 3.0 ?l (final concentration 1x)
T4-ligase enzyme 1.0 ?l (5units/ ?l)
Sterile water Make up the volume to 30.0 ?l


First round PCR reaction mix:
Reagents Amount to be added
Nuclease-free water Make up to 25 ?l
10X reaction buffer (with MgCl2) 2.5 ?l
10mM dNTPs 0.5 ?l
Primer MHIP-8 (100ng/?l) 1.0 ?l
Primer AP (100 ng/?l) 1.0 ?l
Taq DNA polymerase (5 units/?l) 0.5 ?l
DNA template 3.0 ?l

Thermal Cycler program:

Temperature Time Cycles
95°C 5 minutes 1
94°C
58°C
68°C 30 seconds
30 seconds
4 minutes 40
68°C 10 minutes 1
4°C Hold

The second round of PCR was carried out to amplify the specific flanking region adjacent to the inserted heterologous gene. The template used for second round PCR was first round PCR product which was diluted 5 times. The details of the PCR are given below:

MHIP-9 - 5’- AAG AAC GGG TCT GTC CAT CC -3’ SEQ ID NO: 3
NAP - 5'- TAT AGG GCT CGA GCG GC -3’ SEQ ID NO: 4

Second round PCR reaction mix:
Reagents Amount to be added
Nuclease-free water Make up to 25 ?l
10X reaction buffer (with MgCl2) 2.5 ?l
10mM dNTPs 0.5 ?l
Primer MHIP-9 (100ng/?l) 1.0 ?l
Primer NAP (100 ng/?l) 1.0 ?l
Taq DNA polymerase (5 units/?l) 0.5 ?l
DNA template 3.0 ?l

Thermal Cycler program:
Temperature Time Cycles
950c 5 minutes 1
940c
580c
680c 30 seconds
30 seconds
4 minutes
40
680c 10 minutes 1
40c Hold

The PCR product was analyzed on a 1% agarose gel, and the amplified fragment was eluted from the agarose gel using a Qiagen DNA gel elution kit. A DNA fragment of 798 base pair amplified from the right border region of the T-DNA after two rounds of PCR (using primers MHIP-9 and NAP). The amplified fragment was cloned into pGEM-T Easy vector to obtain a recombinant clone. Plasmid DNA from this clone was isolated using standard methods known in the art. The cloned fragment was sequenced using T7 (SEQ ID NO: 5) and SP6 (SEQ ID NO: 6) primers. The sequences of T7 and SP6 primers are as below;

T7:- 5’- TAA TAC GAC TCA CTA TAG GG - 3’ SEQ ID NO: 5
SP6:- 5’- TAT TTA GGT GAC ACT ATA G – 3’ SEQ ID NO: 6
The sequence obtained after sequencing the 798 bp fragment using T7 and Sp6 primers is provided in SEQ ID NO: 7

SEQ ID NO: 7
TATAGGGCTCGAGCGGCCGCCCGGGCAGGTATCGAACCTCCTTCAATTGATTGATTTGTCTATTTCTTAAAATTTTGAACCTCTTCCAAAAGAATCTTGATTCCATGAGTGATCCCACCCCACCCCATTTGCCATCCCTATTTAGGGTCATGAAGAGTTGTCAAATGGGGTCAACTCATCAACTTGCTTGTCCAATCTCTTTCAATGAATTTAACACAATTGTGTTTTGACACGTTAACTTTGTTGCAAAAAAACAAAAATGATTAAGACATAATCCCACAAATGTCAACTTAATGCTCAAAGAGATAGTGGGAGCAATGGTGACAACAACTTTCACTTGGACCTTTCTTCGGACCCTGCCTATAATAGTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGTTGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACATACGTCAGAAACCATTATTGCGCGTTCAAAAGTCGCCTAAGGTCACTATCAGCTAGCAAATATTTCTTGTCAAAAATGCTCCACTGACGTTCCATAAATTCCCCTCGGTATCCAATTAGAGTCTCATATTCACTCTCAATCCAAATAATCTGCAATGGCAATTACCTTATCCGCAACTTCTTTACCTATTTCCGCCCGGATCCTCTAGAGTCAACAGAGGTGGATGGACAGACCCGTTCTT
Note: Sequence in bold font at the start is the adapter sequence whereas the sequence base pairs 369 to 798 at the end is T-DNA vector sequence; the sequence in regular font represents the brinjal genomic DNA sequence flanking the EE-6726 event T-DNA region from right border side.

Sequence ID NO: 7 consists of a part of the adapter sequence (base pairs 1-30) adjacent to which is brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 31 to 368) from right border side The flanking genomic DNA sequence is followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 369 to 798).

SEQ ID NO: 8
GGTCAACTCATCAACTTGCTTGTCCAATCTCTTTCAATGAATTTAACACAATTGTGTTTTGACACGTTAACTTTGTTGCAAAAAAACAAAAATGATTAAGACATAATCCCACAAATGTCAACTTAATGCTCAAAGAGATAGTGGGAGCAATGGTGACAACAACTTTCACTTGGACCTTTCTTCGGACCCTGCCTATAATAGTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGTTGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACATACGTCAGAAA

Sequence ID NO: 8 consists of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 200) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 201 to 400).

SEQ ID NO: 9
ACATAATCCCACAAATGTCAACTTAATGCTCAAAGAGATAGTGGGAGCAATGGTGACAACAACTTTCACTTGGACCTTTCTTCGGACCCTGCCTATAATAGTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGA

Sequence ID NO: 9 consists of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 100) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 101 to 200).

SEQ ID NO: 10
ATGCTCAAAGAGATAGTGGGAGCAATGGTGACAACAACTTTCACTTGGACCTTTCTTCGGACCCTGCCTATAATAGTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGT

Sequence ID NO: 10 consists of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 75) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 76 to150).

SEQ ID NO: 11
TGGTGACAACAACTTTCACTTGGACCTTTCTTCGGACCCTGCCTATAATAGTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCAT

Sequence ID NO: 11 consists of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 50) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 51 to100).

SEQ ID NO: 12
GCCTATAATAGTCAAACACT

Sequence ID NO: 12 consists of brinjal T-DNA flanking genomic DNA sequence of EE-6726 event (base pairs 1 to 10) from right border side followed by partial T-DNA sequence of the vector used for transformation of EE-6726 event (base pairs 11 to 20).

SEQ ID NO: 14 (3261 bp)
GGTCATGAAGAGTTGTCAAATGGGGTCAACTCATCAACTTGCTTGTCCAATCTCTTTCAATGAATTTAACACAATTGTGTTTTGACACGTTAACTTTGTTGCAAAAAAACAAAAATGATTAAGACATAATCCCACAAATGTCAACTTAATGCTCAAAGAGATAGTGGGAGCAATGGTGACAACAACTTTCACTTGGACCTTTCTTCGGACCCTGCCTATAATAGTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGTTGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACATACGTCAGAAACCATTATTGCGCGTTCAAAAGTCGCCTAAGGTCACTATCAGCTAGCAAATATTTCTTGTCAAAAATGCTCCACTGACGTTCCATAAATTCCCCTCGGTATCCAATTAGAGTCTCATATTCACTCTCAATCCAAATAATCTGCAATGGCAATTACCTTATCCGCAACTTCTTTACCTATTTCCGCCCGGATCCTCTAGAGTCAACAGAGGTGGATGGACAGACCCGTTCTTACACCGGACTGGGCGCGGGATAGGATATTCAGATTGGGATGGGATTGAGCTTAAAGCCGGCGCTGAGACCATGCTCAAGGTAGGCAATGTCCTCAGCGTCGAGCCCGGCATCTATGTCGAGGGCATTGGTGGAGCGCGCTTCGGGGATACCGTGCTTGTAACTGAGACCGGATATGAGGCCCTCACTCCGCTTGATCTTGGCAAAGATATTTGACGCATTTATTAGTATGTGTTAATTTTCATTTGCAGTGCAGTATTTTCTATTCGATCTTTATGTAATTCGTTACAATTAATAAATATTCAAATCAGATTATTGACTGTCATTTGTATCTAGTCAATTTAATGGATATTTTTATTATAATATTGATGATATCTCAATCAAAACGTAGATAATAATAATATTTATTTAATATTTTTGCGTCGCACAGTGAAAATCTATATGAGATTACAAAATACCGACAACATTATTTAAGATACATAGACATTAACCCTGAGACTGTTGGACATCAACGGGTAGATTCCTTCATGCATAGCACCTCATTCTTGGGGACAAAAGCACGGTTTGGCCGTTCCATTGCTGCACGAACGAGCTTTGCTATATCCTCGGGTTGGATCATCTCATCAGGTCCAATCAAATTTGTCCAAGAACTCATGTTAGTCGCAACGAAACCGGGGCATATGTCGACCTGCAGGAATTCTCCTATCAGTACAGCGGCGAGATGTTAGTTGGCACCAGCATGATGTTCATGAGGTCGAACTGGGTGCCAGAGTTCAGGGTCACGTTGATGTCCAGCGGGACGTCGGAGTTGCTGCTGGCCACCACGTTGCCAATGTTGATGTCGCTGAAGCGGGCGCCGTTGTCGTTGACGCCATCATTGTTGGTCGTCGTGTTCACATTGGTGGCTGTGTACACCCTCCCGTTGATGGTGACCCTGATGGTGGAGTTGCCAATGGAGCTGACGCGCAGGTACAGGTTGTAGCTGTTGCCGTTGCCGCGCAGGGTGTACCTGGCGGTGGTGTTGTTCTGCTCGAACCTCAGGGAGTCGCCCTGGTTGCCGAACTTCTCGGAGATGAAGGTGCGTGTCTGGTTGTTCACTTGGGTGGCGTGGATTGGAGAGATGGTGAAGCCGGTGTAATCATTGGGCGCCAGGTGGATCATGGAGCCGTTCTCATGCACAGCGTGGATGTTGTTCTTCCTGTTATGGACGCTCACCATGTACGCCCTTGCACCTCCGGGCGTCCCGGACGGAGAGGCGATGTTCCTGATCTCGTTGTAGTGCAGTGGACGGCGGAGGTCCTCGTTGCGGACGACGAGAGGAACACCAGAGATGTTCCTGATGAAGTAGTCGGGGAAGTAGTTAGAATTCCCACGCGCCGTGAAGGCGCCGCTCCGGAGGCCAAGGGTGGTCTCGAAGGACTCGGTTTGCCAGTTGGTGACGGTGGCCACGCCCTCGCGGTCGGAGCCGCTGTCGAGCCAGGACCTCACGAACGGGGTGAGCAGCGGCGGCAGGAAGGTGGAGCAGTTGAAGTTCTGGTTGAACGGCGATGCACCAATGTCGCCGCTCGAGATGCCGCCGGAGTAGTTCACTCTGGCAGCAAGCAGAGCATGAGTTGTGGTGGAGCCGGGGAGGCCAACAATGTTGGGGAAGGTGTTGGAGAGGCGAGCACCAGAGAAGCCGTTGAGGACGTAGTTGGAGTTGACTTGGAACAACGAATACAGGAATGGCCAGTCCTGGCTGGTGAAGCTCTGAGTTTGTTGGGGACCAGAGCCGCTGGCGTAGAGGTTGGCGCCGCTGGACACCAGCAGGCTCTGGTACTTGAAGAGCGACCAGATGCTGACGTACTCGAACACGTTCAGGAACATGTAGGTCCTGAACTCCAGCATGTCGTGAAGCCTCGTATTGAGGCCCTTGAAGGCCGACTGGTAGGTGTTGATGCAATAGTTGGAGTAGTCCCTGGTGTAGTTCTTCAGGTAGTCGCGGTAGGTCCTCAGCGTGGCTGCAGAGATGCCCCACTCGTCAGCGTTGAGGATCACGTCACGAATGAAGGAGAGGTGCAGGTTGGCAGCCTGAGCAAAGAGTGGCAGCAGGAGCAGCTGGTAGCCTTGCATCTGGAACTGAGGCAAGCGGTTGAGGAACAGTTGTTGCATGGTGTTCACGGAAGAAGTGATGGACAGAGGCACCGCATTGCGGTTGGGGTTGAGGAAGTTGTCCACTTGGCGGTTGAACTCCTCCACGTTTGCTTGCAGACCCGTCAGCTCAGCGTTGACGCGAGCAAGGGTATCAGTGTTGAGGCGCTGGTTGAGAAACTTCTCGGTCTCCCTGAGGATGTCTTGCATGAGGTTGGTGGAGCCAGATGGAAAGATCAGGTTGCGGAGTTCCGAGAGGATGCGCTTCCCGACGAGAGAGCCGACCTTCTTGAGAAGGAAGCTGGCCACCGTGCCGACGATGGGGTCCAGGTACAGGCTGTGGTTGTTCTTCTTCCACTCCGTCCACTCCTTCTGAACAGTGTCGAGGCTCTTGTGCTGGAAGCTGAATGGATCATGCGCCGCGACGTTGTAGGCGTCGCAGATGGTGGTGCGACCAGAGTTCAGGACGGAGTTGTCCAT
Example 4: Diagnostic methods for identification of the EE-6726 event

To detect the presence or absence of the brinjal EE-6726 event, a molecular method was developed. The sequence analysis of the fragment shown as SEQ ID NO: 7 were carried out and primers were designed to amplify the transgenic insertion locus for use as a diagnostic tool. The two primers were used to amplify the transgenic insertion locus. The forward primer MHIP-9 (SEQ ID No.3) was designed in the EE-6726 T-DNA region while the reverse primer was designed in the T-DNA flanking genomic DNA region and was named as MHTBJ-11. The sequence of MHTBJ-11 primer is provided below as SEQ ID NO.13.

MHTBJ-11 - 5’- GGT CAT GAA GAG TTG TCA AAT G -3’ (SEQ ID NO: 13)

These primer pairs include, but are not limited to, SEQ ID NO: 3 and SEQ ID NO: 13. For the amplification of the EE-6726 event, any primer pair derived from SEQ ID NO: 7 that when used in DNA amplification reaction produces a DNA amplicon diagnostic for EE-6726 event is an aspect of the present invention. Below is provided SEQ ID No.14 consisting of EE-6726 event T-DNA flanking genomic DNA starting from SEQ ID No.13 from to cry2Ab gene.

SEQ ID No.14
GGTCATGAAGAGTTGTCAAATGGGGTCAACTCATCAACTTGCTTGTCCAATCTCTTTCAATGAATTTAACACAATTGTGTTTTGACACGTTAACTTTGTTGCAAAAAAACAAAAATGATTAAGACATAATCCCACAAATGTCAACTTAATGCTCAAAGAGATAGTGGGAGCAATGGTGACAACAACTTTCACTTGGACCTTTCTTCGGACCCTGCCTATAATAGTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGTTGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACATACGTCAGAAACCATTATTGCGCGTTCAAAAGTCGCCTAAGGTCACTATCAGCTAGCAAATATTTCTTGTCAAAAATGCTCCACTGACGTTCCATAAATTCCCCTCGGTATCCAATTAGAGTCTCATATTCACTCTCAATCCAAATAATCTGCAATGGCAATTACCTTATCCGCAACTTCTTTACCTATTTCCGCCCGGATCCTCTAGAGTCAACAGAGGTGGATGGACAGACCCGTTCTTACACCGGACTGGGCGCGGGATAGGATATTCAGATTGGGATGGGATTGAGCTTAAAGCCGGCGCTGAGACCATGCTCAAGGTAGGCAATGTCCTCAGCGTCGAGCCCGGCATCTATGTCGAGGGCATTGGTGGAGCGCGCTTCGGGGATACCGTGCTTGTAACTGAGACCGGATATGAGGCCCTCACTCCGCTTGATCTTGGCAAAGATATTTGACGCATTTATTAGTATGTGTTAATTTTCATTTGCAGTGCAGTATTTTCTATTCGATCTTTATGTAATTCGTTACAATTAATAAATATTCAAATCAGATTATTGACTGTCATTTGTATCTAGTCAATTTAATGGATATTTTTATTATAATATTGATGATATCTCAATCAAAACGTAGATAATAATAATATTTATTTAATATTTTTGCGTCGCACAGTGAAAATCTATATGAGATTACAAAATACCGACAACATTATTTAAGATACATAGACATTAACCCTGAGACTGTTGGACATCAACGGGTAGATTCCTTCATGCATAGCACCTCATTCTTGGGGACAAAAGCACGGTTTGGCCGTTCCATTGCTGCACGAACGAGCTTTGCTATATCCTCGGGTTGGATCATCTCATCAGGTCCAATCAAATTTGTCCAAGAACTCATGTTAGTCGCAACGAAACCGGGGCATATGTCGACCTGCAGGAATTCTCCTATCAGTACAGCGGCGAGATGTTAGTTGGCACCAGCATGATGTTCATGAGGTCGAACTGGGTGCCAGAGTTCAGGGTCACGTTGATGTCCAGCGGGACGTCGGAGTTGCTGCTGGCCACCACGTTGCCAATGTTGATGTCGCTGAAGCGGGCGCCGTTGTCGTTGACGCCATCATTGTTGGTCGTCGTGTTCACATTGGTGGCTGTGTACACCCTCCCGTTGATGGTGACCCTGATGGTGGAGTTGCCAATGGAGCTGACGCGCAGGTACAGGTTGTAGCTGTTGCCGTTGCCGCGCAGGGTGTACCTGGCGGTGGTGTTGTTCTGCTCGAACCTCAGGGAGTCGCCCTGGTTGCCGAACTTCTCGGAGATGAAGGTGCGTGTCTGGTTGTTCACTTGGGTGGCGTGGATTGGAGAGATGGTGAAGCCGGTGTAATCATTGGGCGCCAGGTGGATCATGGAGCCGTTCTCATGCACAGCGTGGATGTTGTTCTTCCTGTTATGGACGCTCACCATGTACGCCCTTGCACCTCCGGGCGTCCCGGACGGAGAGGCGATGTTCCTGATCTCGTTGTAGTGCAGTGGACGGCGGAGGTCCTCGTTGCGGACGACGAGAGGAACACCAGAGATGTTCCTGATGAAGTAGTCGGGGAAGTAGTTAGAATTCCCACGCGCCGTGAAGGCGCCGCTCCGGAGGCCAAGGGTGGTCTCGAAGGACTCGGTTTGCCAGTTGGTGACGGTGGCCACGCCCTCGCGGTCGGAGCCGCTGTCGAGCCAGGACCTCACGAACGGGGTGAGCAGCGGCGGCAGGAAGGTGGAGCAGTTGAAGTTCTGGTTGAACGGCGATGCACCAATGTCGCCGCTCGAGATGCCGCCGGAGTAGTTCACTCTGGCAGCAAGCAGAGCATGAGTTGTGGTGGAGCCGGGGAGGCCAACAATGTTGGGGAAGGTGTTGGAGAGGCGAGCACCAGAGAAGCCGTTGAGGACGTAGTTGGAGTTGACTTGGAACAACGAATACAGGAATGGCCAGTCCTGGCTGGTGAAGCTCTGAGTTTGTTGGGGACCAGAGCCGCTGGCGTAGAGGTTGGCGCCGCTGGACACCAGCAGGCTCTGGTACTTGAAGAGCGACCAGATGCTGACGTACTCGAACACGTTCAGGAACATGTAGGTCCTGAACTCCAGCATGTCGTGAAGCCTCGTATTGAGGCCCTTGAAGGCCGACTGGTAGGTGTTGATGCAATAGTTGGAGTAGTCCCTGGTGTAGTTCTTCAGGTAGTCGCGGTAGGTCCTCAGCGTGGCTGCAGAGATGCCCCACTCGTCAGCGTTGAGGATCACGTCACGAATGAAGGAGAGGTGCAGGTTGGCAGCCTGAGCAAAGAGTGGCAGCAGGAGCAGCTGGTAGCCTTGCATCTGGAACTGAGGCAAGCGGTTGAGGAACAGTTGTTGCATGGTGTTCACGGAAGAAGTGATGGACAGAGGCACCGCATTGCGGTTGGGGTTGAGGAAGTTGTCCACTTGGCGGTTGAACTCCTCCACGTTTGCTTGCAGACCCGTCAGCTCAGCGTTGACGCGAGCAAGGGTATCAGTGTTGAGGCGCTGGTTGAGAAACTTCTCGGTCTCCCTGAGGATGTCTTGCATGAGGTTGGTGGAGCCAGATGGAAAGATCAGGTTGCGGAGTTCCGAGAGGATGCGCTTCCCGACGAGAGAGCCGACCTTCTTGAGAAGGAAGCTGGCCACCGTGCCGACGATGGGGTCCAGGTACAGGCTGTGGTTGTTCTTCTTCCACTCCGTCCACTCCTTCTGAACAGTGTCGAGGCTCTTGTGCTGGAAGCTGAATGGATCATGCGCCGCGACGTTGTAGGCGTCGCAGATGGTGGTGCGACCAGAGTTCAGGACGGAGTTGTCCAT

However, any modification of these methods that use DNA molecules or complements thereof to produce an amplicon DNA molecule diagnostic for EE-6726 event can be apparent to the person ordinarily skilled of the art. For example, if SEQ ID: 13 primer if used in combination with primer 1 will produce an amplicon of 1150 base pair, or in combination with primer 2 will amplify 1420 base pair from EE-6726 event. The sequences of primer 1 and 2 are as below.

Primer 1:- 5’- GTC TCA GGG TTA ATG TCT ATG -3’ SEQ ID NO.15
Primer 2:- 5’- TGG CAC CCA GTT CGA CCT C - 3’ SEQ ID NO.16

For the analysis it is important to have positive and negative controls. The PCR method was designed in order to distinguish the EE-6726 event from the other brinjal transgenic events and non-transgenic lines. Genomic DNA from brinjal EE-6726 event was isolated from leaves using the method described by Dellaporta et al; (1983). Genomic DNA was also isolated from other brinjal transgenic events and non-transgenic brinjal lines as controls for the PCR detection method. A control reaction having no DNA in the reaction mixture was also included. The genomic DNA from different plants were subjected to amplification using two primers namely SEQ ID NO: 3 and SEQ ID NO: 13. The details are as follows.
Event specific PRC reaction mix:
Reagents Amount to be added
Nuclease-free water Make up to 20 ?l
10X reaction buffer (with MgCl2) 2.0 ?l
10mM dNTPs 0.4 ?l
Primer MHIP-9 (100 ng/?l) 0.5 ?l
Primer MHTBJ-11 (100 ng/?l) 0.5 ?l
Taq DNA polymerase (5 units/?l) 0.3 ?l
DNA template 2.0 ?l

Thermal Cycler program:
Temperature Time Cycles
95°C 5 minutes 1
95°C
58°C
72°C 30 seconds
30 seconds
1minute
35
72°C 5 minutes 1
4°C Hold ---

The amplified product was analyzed on 1% agarose gel by electrophoresis. The results obtained are shown in Figure 2. From the figure it is evident that 653 bp fragment amplified only from the brinjal EE-6726 event whereas no amplification was observed in other transgenic events and non-transgenic brinjal plants.

Example 5: Zygosity assay for brinjal EE-6726 elite event
Brinjal genomic DNA sequence flanking the left border region of the T-DNA was analyzed and a primer was designed having nucleotide sequence as shown in SEQ ID NO: 17. This primer when used in combination with the primers having nucleotide sequence as set forth in SEQ ID NO: 3 and SEQ ID NO: 13 obtained 653 base pairs fragment from the transgenic brinjal plant comprising EE-6726 elite event due to amplification of the transgene specific allele and a 382 base pairs fragment obtained from non-transgenic brinjal plant due to amplification of non-transgenic allele band from SEQ ID NO: 13 and SEQ ID NO: 17. The sequence of the MHTBJ-8 primer is provided below.

MHTBJ-8: 5’- GGT ATG TTT AAG ATC ACA TGA TTG -3’ SEQ ID NO: 17

Event specific zygosity PRC reaction mix:
Reagents Amount to be added
Nuclease-free water Make up to 20 ?l
10X reaction buffer (with MgCl2) 2.0 ?l
10mM dNTPs 0.4 ?l
Primer MHIP-9 (100 ng/?l) 0.5 ?l
Primer MHTBJ-11 (100 ng/?l) 0.5 ?l
Primer MHTBJ-8 (100 ng/?l) 0.5 ?l
Taq DNA polymerase (5 units/?l) 0.3 ?l
DNA template 2.0 ?l

Thermal Cycler program:
Temperature Time Cycles
95°C 5 minutes 1
95°C
58°C
72°C 30 seconds
40 seconds
1minute
35
72°C 5 minutes 1
4°C Hold ---

,CLAIMS:

1. A recombinant DNA comprising at least one junction sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and /or SEQ ID NO: 14, complements or fragments thereof comprising a transgene insertion and flanking genomic DNA of the brinjal event EE6726.
2. The recombinant DNA as claimed in claim 1, comprising at least one junction sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and /or SEQ ID NO: 14 comprises a sequence as set forth in SEQ ID NO: 12 and / or its complement thereof, or a portion of SEQ ID NO: 12 or its complement thereof.
3. The recombinant DNA as claimed in claim 1, wherein the nucleic acid sequence as set forth in SEQ ID NO: 14 comprises a primer sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 13, SEQ ID NO: 15, and/or SEQ ID NO: 16 or its complements or fragments thereof.
4. A primer comprising at least 10 contiguous nucleotides derived from the sequence as set forth in SEQ ID NO:14, or its complement, wherein said DNA molecule is capable of producing an amplicon comprising of sequence as set forth in SEQ ID NO: 12.
5. The primer as claimed in claim 4, wherein the primer is a pair comprising at least 15 contiguous nucleic acids each, wherein a first primer in said pair is selected from nucleic acid sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 15, and/or SEQ ID NO: 16; and a second primer sequence is as set forth in SEQ ID NO: 13, wherein said primer pair is capable of producing an amplicon comprising SEQ ID NO: 12 diagnostics for EE-6726 event.
6. A method of detecting the presence of EE-6726 event in a sample comprising the steps of:
a. contacting a sample comprising the DNA of interest with a first primer selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 15, and/or SEQ ID NO: 16; or its complements or fragments thereof; and a second primer sequence as set forth in SEQ ID NO: 13 or its complements or fragments thereof;
b. amplifying the said sample and producing an amplicon having the sequence SEQ ID NO: 12 for the event EE-6726; and
c. analyzing the amplified products for the presence of SEQ ID NO: 12 for the EE-6726 event; and
d. detecting the diagnostic amplicon as set forth in SEQ ID NO: 12.
7. The method as claimed in claim 6, wherein the DNA of interest comprises the sequences as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14, complements or fragments or combinations thereof.
8. The method as claimed in claim 6 or 7, wherein the sample is a brinjal tissue.
9. A method of determining zygosity of DNA in a biological sample comprising the event EE6726, said method comprising:
a. contacting the biological sample with a first DNA primer selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 15, and/or SEQ ID NO: 16, complements or fragments or combinations thereof, a second DNA primer selected as set forth in SEQ ID NO: 13, complements or fragments thereof; and a third DNA primer as set forth in SEQ ID NO: 17, complements or fragments thereof;
b. amplifying the DNA to produce an amplicon and detecting the presence of said DNA amplicon molecule;
wherein presence of more than one DNA amplicon is indicative of heterozygosity of the transgenic brinjal event EE6726;
wherein presence of one DNA amplicon comprising of sequence as set forth in SEQ ID No.12 is indicative of homozygosity of the transgenic brinjal event EE6726.
10. A DNA diagnostic kit for detecting the presence of EE-6726 event in a sample; said kit comprising:
a. a first primer selected from SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO: 15, and/or SEQ ID NO: 16 or its complements or fragments thereof; and
b. a second primer selected from SEQ ID NO: 13 or its complements or fragments thereof;
wherein the sample is amplified with the said first and second primer producing an amplicon for the event EE-6726 for detecting the diagnostic amplicon as set forth in SEQ ID NO: 12.
11. A method of producing a progeny of an insect resistant brinjal plant comprising event EE6726, said method comprising:
a. producing insect resistant brinjal plant by incorporating nucleic acid sequences as set forth in SEQ ID NO:7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11 and/or SEQ ID NO: 14, complements or fragments thereof comprising the transgene insertion and flanking genomic DNA of the brinjal event EE6726 to brinjal plant genome;
b. crossing said insect resistant brinjal plant comprising the EE-6726 event with a brinjal plant without the said event;
c. obtaining at least one progeny of brinjal plant derived from the said cross; and
d. selecting a progeny of brinjal plant that is insect resistant and comprises nucleotide sequence of SEQ ID NO: 12.
12. An insect resistant brinjal plant, or parts thereof comprising at least one nucleic acid sequence selected from the group of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and/or SEQ ID NO: 14 forms a part of the plant's genome.
13. The brinjal plant as claimed in claim 12 comprising a seed, nucleus, or part thereof capable of producing an amplicon comprising SEQ ID NO: 12 and diagnostic for EE-6726 event.
14. The seed as claimed in claim 13, wherein said seed comprises nucleic acid capable of producing an amplicon having SEQ ID NO: 12 diagnostics for EE-6726 event and having an accession number NCIMB 41810.

Documents

Application Documents

# Name Date
1 202021000170-Response to office action [21-08-2024(online)].pdf 2024-08-21
1 202021000170-SEQUENCE LISTING(PDF) [02-01-2020(online)].pdf 2020-01-02
2 202021000170-Response to office action [06-05-2024(online)].pdf 2024-05-06
2 202021000170-SEQUENCE LISTING [02-01-2020(online)].txt 2020-01-02
3 202021000170-PROVISIONAL SPECIFICATION [02-01-2020(online)].pdf 2020-01-02
3 202021000170-FORM 18 [16-10-2023(online)].pdf 2023-10-16
4 202021000170-FORM 3 [14-09-2022(online)].pdf 2022-09-14
4 202021000170-FORM 1 [02-01-2020(online)].pdf 2020-01-02
5 202021000170-DRAWINGS [02-01-2020(online)].pdf 2020-01-02
5 202021000170-CORRESPONDENCE(IPO)-(CERTIFIED COPY LETTER)-(16-4-2021).pdf 2021-10-19
6 202021000170-Proof of Right [22-07-2020(online)].pdf 2020-07-22
6 202021000170-ORIGINAL UR 6(1A) FORM 1-170321.pdf 2021-10-19
7 202021000170-PETITION UNDER RULE 137 [22-07-2020(online)].pdf 2020-07-22
7 202021000170-ORIGINAL UR 6(1A) FORM 26 & CERTIFICATE OF INCORPORATION-120221.pdf 2021-10-19
8 202021000170-SEQUENCE LISTING (.txt) [31-12-2020(online)].txt 2020-12-31
8 202021000170-ORIGINAL UR 6(1A) FORM 26-080121.pdf 2021-10-19
9 202021000170-FORM 3 [31-12-2020(online)].pdf 2020-12-31
9 Abstract1.jpg 2021-10-19
10 202021000170-ENDORSEMENT BY INVENTORS [31-12-2020(online)].pdf 2020-12-31
10 202021000170-FORM 3 [03-05-2021(online)].pdf 2021-05-03
11 202021000170-DRAWING [31-12-2020(online)].pdf 2020-12-31
11 202021000170-Response to office action [13-04-2021(online)].pdf 2021-04-13
12 202021000170-CERTIFIED COPIES-CERTIFICATE U-S 72 147 & UR 133-2 [23-03-2021(online)].pdf 2021-03-23
12 202021000170-CORRESPONDENCE-OTHERS [31-12-2020(online)].pdf 2020-12-31
13 202021000170-AMENDED DOCUMENTS [06-02-2021(online)].pdf 2021-02-06
13 202021000170-COMPLETE SPECIFICATION [31-12-2020(online)].pdf 2020-12-31
14 202021000170-FORM 13 [06-02-2021(online)].pdf 2021-02-06
14 202021000170-FORM-26 [02-01-2021(online)].pdf 2021-01-02
15 202021000170-Form 1 (Submitted on date of filing) [19-01-2021(online)].pdf 2021-01-19
15 202021000170-FORM-26 [06-02-2021(online)].pdf 2021-02-06
16 202021000170-Covering Letter [19-01-2021(online)].pdf 2021-01-19
16 202021000170-MARKED COPIES OF AMENDEMENTS [06-02-2021(online)].pdf 2021-02-06
17 202021000170-POA [06-02-2021(online)].pdf 2021-02-06
17 202021000170-CERTIFIED COPIES TRANSMISSION TO IB [19-01-2021(online)].pdf 2021-01-19
18 202021000170-RELEVANT DOCUMENTS [06-02-2021(online)].pdf 2021-02-06
19 202021000170-CERTIFIED COPIES TRANSMISSION TO IB [19-01-2021(online)].pdf 2021-01-19
19 202021000170-POA [06-02-2021(online)].pdf 2021-02-06
20 202021000170-Covering Letter [19-01-2021(online)].pdf 2021-01-19
20 202021000170-MARKED COPIES OF AMENDEMENTS [06-02-2021(online)].pdf 2021-02-06
21 202021000170-Form 1 (Submitted on date of filing) [19-01-2021(online)].pdf 2021-01-19
21 202021000170-FORM-26 [06-02-2021(online)].pdf 2021-02-06
22 202021000170-FORM 13 [06-02-2021(online)].pdf 2021-02-06
22 202021000170-FORM-26 [02-01-2021(online)].pdf 2021-01-02
23 202021000170-AMENDED DOCUMENTS [06-02-2021(online)].pdf 2021-02-06
23 202021000170-COMPLETE SPECIFICATION [31-12-2020(online)].pdf 2020-12-31
24 202021000170-CORRESPONDENCE-OTHERS [31-12-2020(online)].pdf 2020-12-31
24 202021000170-CERTIFIED COPIES-CERTIFICATE U-S 72 147 & UR 133-2 [23-03-2021(online)].pdf 2021-03-23
25 202021000170-DRAWING [31-12-2020(online)].pdf 2020-12-31
25 202021000170-Response to office action [13-04-2021(online)].pdf 2021-04-13
26 202021000170-ENDORSEMENT BY INVENTORS [31-12-2020(online)].pdf 2020-12-31
26 202021000170-FORM 3 [03-05-2021(online)].pdf 2021-05-03
27 202021000170-FORM 3 [31-12-2020(online)].pdf 2020-12-31
27 Abstract1.jpg 2021-10-19
28 202021000170-ORIGINAL UR 6(1A) FORM 26-080121.pdf 2021-10-19
28 202021000170-SEQUENCE LISTING (.txt) [31-12-2020(online)].txt 2020-12-31
29 202021000170-ORIGINAL UR 6(1A) FORM 26 & CERTIFICATE OF INCORPORATION-120221.pdf 2021-10-19
29 202021000170-PETITION UNDER RULE 137 [22-07-2020(online)].pdf 2020-07-22
30 202021000170-Proof of Right [22-07-2020(online)].pdf 2020-07-22
30 202021000170-ORIGINAL UR 6(1A) FORM 1-170321.pdf 2021-10-19
31 202021000170-DRAWINGS [02-01-2020(online)].pdf 2020-01-02
31 202021000170-CORRESPONDENCE(IPO)-(CERTIFIED COPY LETTER)-(16-4-2021).pdf 2021-10-19
32 202021000170-FORM 3 [14-09-2022(online)].pdf 2022-09-14
32 202021000170-FORM 1 [02-01-2020(online)].pdf 2020-01-02
33 202021000170-PROVISIONAL SPECIFICATION [02-01-2020(online)].pdf 2020-01-02
33 202021000170-FORM 18 [16-10-2023(online)].pdf 2023-10-16
34 202021000170-SEQUENCE LISTING [02-01-2020(online)].txt 2020-01-02
34 202021000170-Response to office action [06-05-2024(online)].pdf 2024-05-06
35 202021000170-SEQUENCE LISTING(PDF) [02-01-2020(online)].pdf 2020-01-02
35 202021000170-Response to office action [21-08-2024(online)].pdf 2024-08-21
36 202021000170-Response to office action [11-12-2024(online)].pdf 2024-12-11
37 202021000170-Response to office action [24-03-2025(online)].pdf 2025-03-24