Abstract: The present application pertains to a cAMP receptor protein mutant, a microorganism containing same, and an L-amino acid production method using same.
Specification
Title of the invention: CAMP-receptive protein variant and L-amino acid production method using the same
Technical field
[One]
The present application relates to a cAMP-receiving protein variant, a microorganism including the same, and a method for preparing L-amino acid using the same.
[2]
Background
[3]
Cyclic AMP receptor protein (CRP) is the most well-known transcriptional regulator in E. coli, and is also called catabolite activator protein (CAP). CRP characteristically has a control mechanism dependent on a carbon source, and a representative one is'catabolite repression'. This action is triggered by the concentration of cyclic AMP (hereinafter referred to as'cAMP') in the cell.When a preferred carbon source such as glucose is present, the activity of adenylate cyclase is inhibited, resulting in lower cAMP, and expression of catabolite metabolic genes through this signal. Is suppressed. In the opposite case, the activity of adenylate cyclase is increased, and as a result, the expression of catabolite metabolic genes is initiated by suppressing repressors. In addition, CRP is known to play various roles such as intracellular signaling through cAMP, osmotic regulation, coping with emergencies in cells, biofilm generation, nitrogen fixation, and iron transport.
[4]
As reported, 418 E. coli genes are known to be regulated by CRP, but the mechanism has not been elucidated in detail yet (J Biol Eng. (2009) 24;3:13). With such a wide range of regulatory capabilities, CRP has the potential to show various phenotypes by mutation, and due to such advantages, it is being studied as a suitable target for redesigning strains at the cellular level that can be applied in various environments. Recently, a method of changing the expression of the gene to be regulated by changing the degree of DNA binding by amino acid mutations in CRP selected by bioinformatics (Nucleic Acids Research, (2009) 37: 2493-2503) and zinc finger DNA binding. A variety of experiments such as selecting E. coli that are resistant to heat, osmotic and low temperature (Nucleic Acids Research, (2008) 36: e102) are made by fusing the site and CRP to create an artificial transcription factor (ATF). In other words, the change in CRP expression is likely to be a good tool for producing microorganisms with useful traits by promoting changes in gene expression at a wide range of levels.
[5]
Detailed description of the invention
Technical challenge
[6]
The present inventors have completed the present application by discovering a novel variant protein containing one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, and confirming that the variant protein increases the production capacity of L-amino acids.
[7]
Means of solving the task
[8]
One object of the present application is to provide a cAMP receptor protein variant.
[9]
Another object of the present application is to provide a polynucleotide encoding the cAMP receptor protein variant.
[10]
Another object of the present application is to provide a vector containing the polynucleotide.
[11]
Another object of the present application is to provide a microorganism of the genus Escherichia, including the mutant.
[12]
Another object of the present application is to provide a method for producing L-amino acids comprising culturing the microorganisms of the genus Escherichia in a medium.
[13]
Another object of the present application is to provide the use of the mutant or the microorganism of the genus Escherichia including the mutant to produce L-amino acids.
[14]
Effects of the Invention
[15]
In the case of culturing a microorganism of the genus Escherichia that produces L-amino acids, including the cAMP-receptive protein variant of the present application, it is possible to produce L-amino acids in high yield. Accordingly, from an industrial perspective, it is possible to expect effects such as reduction of manufacturing cost and convenience of production.
[16]
Best mode for carrying out the invention
[17]
This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present application belong to the scope of the present application. In addition, it cannot be considered that the scope of the present application is limited by the specific description described below.
[18]
[19]
One aspect of the present application for achieving the above object is to provide a cAMP-receiving protein variant comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1. Specifically, the present application provides a cAMP-receptive protein variant comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, and the amino acid substitution includes that the 196th amino acid from the N-terminus is substituted with glutamine. More specifically, it is to provide a cAMP-receptive protein variant, including the 196th amino acid substitution with glutamine in the amino acid sequence of SEQ ID NO: 1.
[20]
[21]
In the present application, the term "cAMP receptor protein (CRP)" is the most commonly known transcriptional regulator in E. coli and is also called a'dual regulator' because it has the functions of an activator and an inhibitor by itself. Generally, RNA polymerization in which the first active site at the carboxy terminus and the second active site at the amino terminus are responsible for transcription by binding to a symmetrical DNA sequence with 22 bases located in front of the structural gene to induce bending of the DNA. It acts as an activator by interacting with an enzyme, and in the case of acting as an inhibitor, preempts the position so that the active protein cannot bind to the active site, or converts to a structure that does not bind to the active site by binding to the active protein. It is known to take the method of letting go. The cAMP receptor protein is a cAMP receptor protein encoded by the crp gene.
[22]
The "cAMP receptor protein (CRP)" of the present application may be used in combination with a catabolite activator protein (CAP), a CRP protein, a CAP protein, and the like.
[23]
In the present application, the CRP sequence can be obtained from GenBank of NCBI, a known database. For example, it may be a CRP derived from Escherichia sp. , and more specifically, may be a polypeptide/protein comprising the amino acid sequence set forth in SEQ ID NO: 1, but is not limited thereto. In addition, sequences having the same activity as the amino acid sequence may be included without limitation. In addition, the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80% or more homology or identity thereto may be included, but is not limited thereto. Specifically, the amino acid includes an amino acid having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with SEQ ID NO: 1 and SEQ ID NO: I can. In addition, it is apparent that proteins having amino acid sequences in which some sequences are deleted, modified, substituted or added are also included within the scope of the present application, provided that they have homology or identity and an amino acid sequence exhibiting efficacy corresponding to the protein.
[24]
In the present application, the term "variant" is different from the recited sequence in which one or more amino acids are conservative substitution and/or modification, but the function of the protein ( functions) or properties are retained. Variant polypeptides differ from the identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one of the polypeptide sequences and evaluating the properties of the modified polypeptide. That is, the ability of the variant form may be increased, unchanged, or decreased compared to the native protein. Such variants can generally be identified by modifying one of the polypeptide sequences and evaluating the reactivity of the modified polypeptide. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed. Other variants may include variants in which a portion of the mature protein has been removed from the N- and/or C-terminus.
[25]
In the present application, the term "conservative substitution" means replacing one amino acid with another amino acid having similar structural and/or chemical properties. Such variants may still retain one or more biological activities, while having, for example, one or more conservative substitutions. Such amino acid substitutions can generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; Negatively charged (acidic) amino acids include glutamic acid and arpartic acid; Aromatic amino acids include phenylalanine, tryptophan and tyrosine, and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, proline, glycine and tryptophan.
[26]
In addition, variant forms may include deletion or addition of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide can be conjugated with a signal (or leader) sequence at the N-terminus of the protein involved in the transfer of the protein co-translationally or post-translationally. In addition, the polypeptide may be conjugated with other sequences or linkers to identify, purify, or synthesize the polypeptide.
[27]
In the present application, the term "cAMP-receptor protein variant" is a cAMP-receptor protein variant comprising one or more amino acid substitutions in the amino acid sequence of a polypeptide having cAMP-receptor protein activity, and the amino acid substitution is the amino acid at position 196 from the N-terminus Includes those substituted with other amino acids. Specifically, it includes protein variants in which the amino acid at position 196 in the amino acid sequence of a polypeptide having AMP-receptive protein activity is substituted with another amino acid and the amino acid at position 196 is substituted with another amino acid. For example, the protein variant includes a protein variant in which a mutation at position 196 from the N-terminus in the amino acid sequence of SEQ ID NO: 1 has occurred. More specifically, the protein variant may be a protein in which the 196th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. The'other amino acid' is not limited as long as it is an amino acid other than the 196th amino acid, L-leucine. Specifically, the variant may be a protein in which the 196th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with a hydrophilic amino acid. The hydrophilic amino acid may be one of L-glutamine, L-serine, L-threonine, L-tyrosine, L-cysteine and L-asparagine. More specifically, the variant may be a protein in which the 196th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with glutamine, but is not limited thereto.
[28]
In addition, the variant has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 1 and/or SEQ ID NO: 1. Eggplant means that the amino acid at position 196 from the N-terminus has been mutated.
[29]
In the present application, the term "cAMP-receptive protein variant" refers to the cAMP-receiving protein variant is a variant CRP protein, a CRP variant, a variant cAMP-receiving protein, a variant CAP protein, a CAP variant, a variant catabolism activating protein, and catabolism It can be used interchangeably with water activated protein variants.
[30]
For the purpose of the present application, in the case of a microorganism containing the cAMP-receiving protein variant, the amount of L-amino acid production is increased compared to the microorganism in which the cAMP-receiving protein variant is not present. The CRP mutant is characterized in that it has gene regulation activity so as to increase the L-amino acid production ability compared to the natural wild-type or non-mutant cAMP-receptive protein. This is meaningful in that the production of L-amino acids can be increased through the microorganism into which the CRP variant of the present application has been introduced. Specifically, the L-amino acid may be L-threonine or L-tryptophan, but any L-amino acid that can be produced by introducing or containing the mutant cAMP-receptive protein is included without limitation.
[31]
[32]
The cAMP-receiving protein variant may be, for example, a variant consisting of SEQ ID NO: 3, including an amino acid sequence in which the 196th amino acid in the amino acid sequence represented by SEQ ID NO: 1 is substituted with another amino acid. A variant in which the 196th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with glutamine may be composed of SEQ ID NO: 3, but is not limited thereto. In addition, the CRP variant may include the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence having 80% or more homology or identity thereto, but is not limited thereto. Specifically, the CRP variant of the present application has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 3 and SEQ ID NO: 3 It may contain proteins. In addition, if an amino acid sequence that has such homology or identity and exhibits efficacy corresponding to the protein, in addition to the amino acid sequence at position 196, proteins having an amino acid sequence in which some sequences are deleted, modified, substituted or added are also within the scope of the present application. Inclusion is self-evident.
[33]
That is, even if it is described in the present application as'a protein having an amino acid sequence described with a specific sequence number', if it has the same or corresponding activity as a protein consisting of the amino acid sequence of the corresponding sequence number, some sequences are deleted, modified, It is obvious that proteins with substituted, conservative substitutions or added amino acid sequences can also be used in the present application. For example, if it has the same or corresponding activity as the mutant protein, the addition of a sequence that does not change the function of the protein before or after the amino acid sequence, a mutation that may occur naturally, or a silent mutation or conservation thereof It does not exclude an enemy substitution, and it is obvious that even if it has such sequence addition or mutation, it falls within the scope of the present application.
[34]
[35]
In the present application, the term'homology' or'identity' means the degree to which two given amino acid sequences or base sequences are related to each other, and may be expressed as a percentage.
[36]
The terms homology and identity can often be used interchangeably.
[37]
The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and the default gap penalty established by the program used can be used together. Substantially, homologous or identical sequences are generally at least about 50%, 60%, 70%, 80% of the sequence full or full-length in medium or high stringent conditions. Or it can hybridize to 90% or more. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotide.
[38]
Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: Can be determined using a known computer algorithm such as the "FASTA" program using default parameters as in 2444. Alternatively, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073) For example, homology, similarity, or identity can be determined using BLAST, or ClustalW of the National Center for Biotechnology Information.
[39]
The homology, similarity or identity of a polynucleotide or polypeptide can be found in, for example, Smith and Waterman, Adv. Appl. As known in Math (1981) 2:482, for example, Needleman et al. (1970), J Mol Biol. 48: 443 can be determined by comparing sequence information using a GAP computer program. In summary, the GAP program is defined as the total number of symbols in the shorter of the two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). The default parameters for the GAP program are (1) a monolithic comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps. Thus, as used herein, the term “homology” or “identity” refers to the relevance between sequences.
[40]
[41]
Another aspect of the present application is to provide a polynucleotide encoding the CRP variant, or a vector including the polynucleotide.
[42]
In the present application, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide units are connected in a long chain by covalent bonds, and is a DNA or RNA strand having a predetermined length or more, and more specifically, the variant protein. It means an encoding polynucleotide fragment.
[43]
The polynucleotide encoding the CRP variant of the present application may be included without limitation as long as it is a polynucleotide sequence encoding the cAMP-receptive protein variant of the present application. The polynucleotide encoding the CRP variant may be included without limitation as long as it is a sequence encoding a variant protein in which the 196th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. Specifically, it may be a polynucleotide sequence encoding a variant in which the 196th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with glutamine. For example, the polynucleotide encoding the CRP variant of the present application may be a polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 3, but is not limited thereto. More specifically, it may be composed of a polynucleotide sequence consisting of SEQ ID NO: 4, but is not limited thereto. The polynucleotide may be modified in a variety of coding regions within a range that does not change the amino acid sequence of the protein due to codon degeneracy or in consideration of a codon preferred in an organism to express the protein. . Therefore, it is apparent that a polynucleotide that can be translated into a polypeptide consisting of the amino acid sequence of SEQ ID NO: 3 or a polypeptide having homology or identity thereto by codon degeneracy may also be included.
[44]
In addition, a probe that can be prepared from a known gene sequence, for example, a complementary sequence for all or part of the nucleotide sequence and hydride under stringent conditions, and the 196th amino acid in the amino acid sequence of SEQ ID NO: 1 Any sequence encoding a substituted CRP variant may be included without limitation.
[45]
The "stringent condition" refers to a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homolog). For example, between genes with high homology or identity, 80% or more, 85% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, Particularly, under the condition that genes with 99% or more homology or identity are hybridized, and genes with lower homology or identity are not hybridized, or at 60°C, which is a washing condition for common southern hybridization , 1 X SSC, 0.1% SDS, specifically 60° C., 0.1 X SSC, 0.1% SDS, more specifically 68° C., 0.1 X SSC, at a salt concentration and temperature corresponding to 0.1% SDS, once, specifically Conditions for washing 2 times to 3 times can be listed as examples.
[46]
Hybridization requires that two nucleic acids have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments that are complementary to the entire sequence.
[47]
Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. Further, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.
[48]
The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[49]
[50]
The term "vector" as used in the present application is a DNA preparation containing the base sequence of a polynucleotide encoding the variant protein of interest operably linked to a suitable regulatory sequence so that the variant protein of interest can be expressed in a suitable host. Means. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. Vectors can be transformed into a suitable host cell and then replicated or function independently of the host genome and can be integrated into the genome itself.
[51]
The vector used in the present application is not particularly limited as long as it can be replicated in the host cell, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR system, pUC system, pBluescriptII system , pGEM system, pTZ system, pCL system, pET system, etc. can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, and the like can be used.
[52]
For example, a polynucleotide encoding a target mutant protein in a chromosome may be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming whether the chromosome is inserted may be additionally included. Selectable markers are used to select cells transformed with a vector, that is, to confirm the insertion of a nucleic acid molecule of interest, and selectable phenotypes such as drug resistance, nutrient demand, resistance to cytotoxic agents, or expression of surface variant proteins. Markers that give s can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected. As another aspect of the present application, the present application is to provide a microorganism that produces L-amino acids, including the variant protein or polynucleotide encoding the variant protein. Specifically, the microorganism containing the mutant protein and/or the polynucleotide encoding the mutant protein may be a microorganism produced by transformation with a vector containing the polynucleotide encoding the mutant protein, but is not limited thereto. .
[53]
In the present application, the term "transformation" means introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. Transformed polynucleotides may include all of them, whether inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self-expression. The expression cassette may generally include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
[54]
In addition, the term "operably linked" in the above means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target variant protein of the present application.
[55]
[56]
Another aspect of the present application is to provide a microorganism of the genus Escherichia sp. , including the cAMP-receptive protein variant .
[57]
The term "microorganism including a CRP variant" as used in the present application may mean a microorganism that has been recombined to express the CRP variant of the present application. For example, it refers to a host cell or microorganism capable of expressing the variant by transforming with a vector comprising a polynucleotide encoding a CRP variant or a polynucleotide encoding a CRP variant. Specifically, for the purposes of the present application, the microorganism is a microorganism expressing a cAMP-receptive protein variant comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, and the amino acid substitution is performed by replacing the 196th amino acid from the N-terminus with glutamine. , It may be a microorganism expressing a mutant protein having a cAMP-receptive protein activity, but is not limited thereto.
[58]
Microorganisms including the CRP variant may be any microorganism capable of producing L-amino acids, such as L-threonine or L-tryptophan, including the CRP variant, but are not limited thereto. For example, the microorganism containing the CRP variant may be a recombinant microorganism having an increased L-amino acid production ability by expressing the CRP variant in a natural wild-type microorganism or a microorganism producing L-amino acid. The recombinant microorganism having an increased L-amino acid production ability may be a microorganism having an increased L-amino acid production capacity compared to a natural wild-type microorganism or an unmodified microorganism, and the L-amino acid may be L-threonine or L-tryptophan. However, it is not limited thereto.
[59]
[60]
In the present application, the term "microorganism producing L-amino acid" includes all wild-type microorganisms or microorganisms that have undergone natural or artificial genetic modification, such as insertion of an external gene or enhancement or inactivation of an endogenous gene. As a microorganism whose specific mechanism is weakened or strengthened due to a cause, it may be a microorganism having a genetic mutation or enhanced activity for the production of a desired L-amino acid. For the purposes of the present application, the microorganism producing the L-amino acid may include the mutant protein and have increased production capacity of the desired L-amino acid. Specifically, in the present application, the microorganism producing L-amino acid or the microorganism having the ability to produce L-amino acid is strengthened or weakened part of the gene in the L-amino acid biosynthetic pathway, or part of the gene in the L-amino acid degradation pathway is strengthened or weakened. It may be a microorganism.
[61]
[62]
The'unmodified microorganism' refers to a natural strain itself, a microorganism that does not contain the CRP variant, or a microorganism that is not transformed with a vector containing a polynucleotide encoding the CRP variant. The'microorganism' may include both prokaryotic and eukaryotic microorganisms as long as it is a microorganism capable of producing L-amino acid. For example , Escherichia genus, Erwinia genus, Serratia genus, Providencia genus, Corynebacterium genus, and Brevibacterium genus Microbial strains to which it belongs may be included. Specifically, it may be a microorganism of the genus Escherichia, more specifically, it may be E. coli, but is not limited thereto.
[63]
[64]
As another aspect of the present application, there is provided a method for producing L-amino acids comprising culturing a microorganism of the genus Escherichia that produces L-amino acids including the cAMP-receptive protein variant in a medium.
[65]
The terms'cAMP receptor protein variant', and'L-amino acid' are as described above.
[66]
In the above method, the step of culturing the microorganism is not particularly limited, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, or the like. At this time, the culture conditions are not particularly limited thereto, but a basic compound (eg, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) is used to provide an appropriate pH (eg, pH 5 to 9, specifically Is capable of adjusting pH 6 to 8, most specifically pH 6.8), and maintaining aerobic conditions by introducing oxygen or an oxygen-containing gas mixture into the culture. The culture temperature can be maintained at 20 to 45 ℃, specifically 25 to 40 ℃, and can be cultured for about 10 to 160 hours, but is not limited thereto. The L-amino acid produced by the culture may be secreted into the medium or may remain in the cells.
[67]
In addition, the culture medium used is a carbon source such as sugars and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molase, starch and cellulose), fats and fats (e.g., soybean oil, sunflower seeds). Oil, peanut oil and coconut oil), fatty acids (such as palmitic acid, stearic acid, and linoleic acid), alcohols (such as glycerol and ethanol), and organic acids (such as acetic acid) can be used individually or in combination. , Is not limited thereto. Nitrogen sources include nitrogen-containing organic compounds (e.g. peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea), or inorganic compounds (e.g. ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and Ammonium nitrate) or the like may be used individually or in combination, but is not limited thereto. Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and a sodium-containing salt corresponding thereto may be used individually or in combination as a source of phosphorus, but are not limited thereto. In addition, the medium may contain essential growth-promoting substances such as other metal salts (eg, magnesium sulfate or iron sulfate), amino acids and vitamins.
[68]
The method may further include recovering L-amino acid from the microorganism or medium.
[69]
The method of recovering the L-amino acid produced in the culturing step of the present application may collect the desired L-amino acid from the culture medium using a suitable method known in the art according to the culture method. For example, centrifugation, filtration, anion exchange chromatography, crystallization and HPLC, etc. may be used, and a desired L-amino acid may be recovered from a medium or microorganism using a suitable method known in the art.
[70]
In addition, the recovery step may include a purification process, and may be performed using a suitable method known in the art. Accordingly, the recovered L-amino acid may be a purified form or a microbial fermentation broth containing L-amino acid (Introduction to Biotechnology and Genetic Engineering, AJ Nair., 2008).
[71]
In another aspect of the present application, there is provided a use of a cAMP-receptive protein variant comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1 for the production of L-amino acids.
[72]
As yet another aspect of the present application, there is provided a use of a microorganism of the genus Escherichia, including the cAMP-receiving protein variant for the production of L-amino acids.
[73]
The terms'cAMP receptor protein variant', and'L-amino acid' are as described above.
[74]
Mode for carrying out the invention
[75]
Hereinafter, the present application will be described in more detail by examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited by these examples, and will be apparent to those of ordinary skill in the art to which the present application belongs.
[76]
[77]
Example 1. A recombinant vector pCC1BAC- crp Preparation of
[78]
[79]
1-1. Preparation of gene crp fragment
[80]
In order to obtain about 0.96 kb of the DNA fragment of SEQ ID NO: 5 including the gene crp and the expression control site, the chromosomal DNA (gDNA) of the E. coli wild line W3110 was extracted using Qiagen's Genomic-tip system, and the above PCR (polymerase chain reaction) was performed using a PCR HL premix kit (manufactured by BIONEER, hereinafter the same) using gDNA as a template. PCR for amplifying the gene crp fragment site was performed using the primers of SEQ ID NOs: 6 and 7 at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and 72°C for 2 minutes. ) Was repeated 27 times.
[81]
The PCR result was digested with EcoR I to obtain a 0.96 Kb-sized DNA fragment (hereinafter referred to as " crp fragment") by electrophoresis on a 0.8% agarose gel, followed by elution.
[82]
[Table 1]
Sequence number Primer name Sequence (5'-3')
6 crp-F CACGAATTCTTTGCTACTCCACTGCGTCA
7 crp-R ACACGAATTCTTAACGAGTGCCGTAAACG
[83]
[84]
1-2. A recombinant vector pCC1BAC- CRP production of
[85]
Copycontrol pCC1BAC vector (EPICENTRE, USA) was treated with EcoR I, electrophoresed on a 0.8% agarose gel, and then eluted, and the crp fragment obtained in Example 1-1 was ligated to pCC1BAC. -A crp plasmid was prepared.
[86]
[87]
Example 2. Construction of recombinant vector pCC1BAC- crp variant library
[88]
[89]
2-1. Preparation of mutant crp fragment using error-prone PCR
[90]
PCR was performed using clonetech's diversify PCR random mutagenesis kit (catalog #: K1830-1, Table III, mutagenesis reactions 4) using the wild-type E. coli W3110 chromosome DNA as a template. Specifically, PCR repeated 27 times a cycle consisting of 30 seconds of denaturation at 94°C and 1 minute of elongation at 68°C using the primers of SEQ ID NOs: 6 and 7 used in Example 1-1. Performed.
[91]
The PCR result was digested with EcoR I to obtain a 0.96 Kb-sized mutated crp fragment (hereinafter referred to as " crp m fragment") by electrophoresis on a 0.8% agarose gel, followed by elution.
[92]
[93]
2-2. Construction of recombinant vector pCC1BAC- crp variant library
[94]
Vector pCC1BAC was prepared by treatment with restriction enzyme EcoR I, followed by treatment with alkaline phosphatase (NEB). The crp m fragments obtained in Example 2-1 were ligated to the prepared vector, and transformed into TransforMax EPI300 Electrocompetent E.coli (EPICENTRE, USA) by electroporation. As for the transformed strain, colonies were selected in LB solid medium (15 ug/ml) containing chloramphenicol. Collecting the colonies thus obtained, a plasmid prep was performed to prepare a pCC1BAC- crp m library.
[95]
[96]
Example 3. Introduction of threonine-producing strains of crp variant library and selection of cells with improved growth
[97]
[98]
3-1. Introduction of threonine-producing strains of pCC1BAC- crp m library
[99]
The pCC1BAC- crp m library obtained in Example 2 was transformed into an electro-competent cell of a threonine-producing microorganism KCCM10541 using electroporation and introduced. E. coli KCCM10541 (Korean Patent No. 10-0576342) used in this example is E. coli in which the galR gene is inactivated from E. coli KFCC10718 (Korean Patent No. 10-0058286) that produces L-threonine .
[100]
As a control for the microorganism into which the pCC1BAC- crp m library was introduced, KCCM10541/pCC1BAC- crp(WT) was prepared by transforming KCCM10541 with pCC1BAC- crp in the same manner as above .
[101]
[102]
3-2. Comparison of growth rates of recombinant microorganisms
[103]
After dispensing the M9 minimal medium containing 1% glucose and 0.2 g/L of yeast extract into a deep well microplate, the transformant and control strain prepared in Example 3-1 were inoculated. . Using a micro size constant temperature incubator shaker (TAITEC, Japan) (37°C, 200 rpm condition), the strains with improved growth were grown by culturing the strain for 20 hours by the HTS (High Throughput Screening) method. It was selected, and finally one strain was selected among them (Table 2).
[104]
In the case of the KCCM10541 strain into which the wild-type crp gene was introduced, it was confirmed that the OD increased slightly due to the additional introduction of the crp , but the OD of the transformant with improved growth was measured higher than that of the wild-type crp after the same incubation time . In addition, sequence analysis was performed after plasmid mini-prep for the selected crp variants, and the results are summarized in Table 2.
[105]
[Table 2] Information on transformants with improved growth after introduction of the library of crp m threonine producing strains
Strain OD600 transition
KCCM10541/pCC1BAC 2.3 -
KCCM10541/pCC1BAC- crp(WT) 2.8 -
KCCM10541/pCC1BAC- crpTM9 3.5 L196Q
[106]
[107]
3-3. Comparison of threonine titers of recombinant microorganisms
[108]
In order to measure the threonine titer of the recombinant microorganism selected in Example 3-2, it was confirmed that L-threonine productivity was improved by culturing in a threonine titer medium prepared according to the composition of Table 3 below.
[109]
[Table 3] Composition of threonine titer medium
Composition Concentration (per liter)
Glucose 70 g
KH 2 PO 4 2 g
(NH 4 ) 2 SO 4 25 g
MgSO 4 7H 2 O 1 g
FeSO 4 7H 2 O 5 mg
MnSO 4 4H 2 O 5 mg
Yeast extract 2 g
Calcium carbonate 30 g
pH 6.8
[110]
[111]
Specifically, E. coli KCCM10541/pCC1BAC- crp (WT) and E. coli KCCM10541/pCC1BAC- crpTM9 cultured overnight in LB solid medium in a 33° C. incubator were inoculated with one platinum each in the 25 mL titer medium of Table 3 above. Next, it was incubated in an incubator at 33° C. and 200 rpm for 48 hours to compare the sugar consumption rate and threonine concentration.
[112]
As a result, as shown in Table 4 below, the KCCM10541/pCC1BAC- crp(WT) strain, which is a control, consumed 26.1 g/L of sugar at 24 hours, but the strain introduced with the mutant crpTM9 was about 16% compared to the parent strain, wild type. It was confirmed that the sugar consumption rate was improved by about 11% compared to the strain to which additional crp was introduced.
[113]
In addition, in the case of L-threonine production, when cultured for 48 hours, the strain to which the wild-type crp was additionally introduced produced 29.0 g/L, but the mutant strain obtained above produced L -It was confirmed that the production of threonine was increased to 30.8 g/L, showing an increase of about 7% compared to the parent strain and about 6% compared to the strain to which the wild-type crp was additionally introduced.
[114]
This is seen as a good mutant trait capable of increasing the yield and increasing the sugar consumption ability of the cells by the introduction of the crp variant, and thus it is expected to greatly contribute to the improvement of production efficiency during fermentation.
[115]
[Table 4] Comparison of titer of threonine strains containing crp variant
Strain Sugar consumed (g/L)* Threonine (g/L)**
KCCM10541/pCC1BAC 25.0 28.8
KCCM10541/pCC1BAC- crp(WT) 26.1 29.0
KCCM10541/pCC1BAC- crpTM9 29.0 30.8
[116]
* 24 hour measurement, ** 48 hour measurement
[117]
[118]
Example 4. Introduction of the tryptophan-producing strain of the pCC1BAC- crpTM9 variant
[119]
[120]
4-1. Introduction of the screening strain of pCC1BAC- crpTM9
[121]
The pCC1BAC- crpTM9 obtained in Example 3 was transformed into an electro-competent cell of a tryptophan-producing strain KCCM11166P by electroporation and introduced. KCCM11166P used in this example is an L-tryptophan-producing Escherichia coli in which the tehB gene is deleted and the activity of NAD kinase is enhanced (Korean Patent No. 10-1261147).
[122]
As a control for the microorganism into which pCC1BAC- crpTM9 was introduced, KCCM11166P/pCC1BAC- crp(WT) was prepared by transforming KCCM11166P with pCC1BAC- crp(WT) in the same manner as above .
[123]
[124]
4-2. Comparison of growth rates of recombinant microorganisms
[125]
After dispensing the M9 minimal medium containing 1% glucose and 0.2 g/L of yeast extract into a deep well microplate, transformants and control strains prepared as described in Example 4-1 were inoculated. Using a micro size constant temperature incubator shaker (TAITEC, Japan) (37°C, 200 rpm condition), incubate the strain for 16 hours by HTS (High Throughput Screening) method, and KCCM11166P/pCC1BAC- crpTM9 It was confirmed that the growth of the transformant was improved (Table 5).
[126]
The KCCM11166P strain into which the wild-type crp gene was introduced showed an equivalent level of OD when measured after the same incubation time by the additional introduction of crp , but it was confirmed that the OD of the transformant with improved growth was measured higher than that of the wild-type crp .
[127]
[Table 5] Transformant information with improved growth after TM9 introduction of crp tryptophan-producing strain
Strain OD600 transition
KCCM11166P/pCC1BAC 3.4 -
KCCM11166P/pCC1BAC- crp(WT) 3.5 -
KCCM11166P/pCC1BAC- crpTM9 3,7 L196Q
[128]
[129]
4-3. Comparison of tryptophan titers of recombinant microorganisms
[130]
In order to measure the tryptophan titer of the recombinant microorganism prepared in Example 4-2, it was confirmed that L-tryptophan production efficiency was improved by culturing in a tryptophan titer medium prepared according to the composition of Table 6 below.
[131]
[Table 6] Tryptophan titer medium composition
Composition Concentration (per liter)
Glucose 60 g
K 2 HPO 4 1 g
(NH 4 ) 2 SO 4 10 g
NaCl 1 g
MgSO 4 7H 2 O 1 g
Sodium citrate 5 g
Yeast extract 2 g
Calcium carbonate 40 g
Sodium citrate 5 g
Phenylalanine 0.15 g
Tyrosine 0.1 g
pH 6.8
[132]
[133]
Specifically, Escherichia coli KCCM11166P/pCC1BAC- crp(WT) and Escherichia coli KCCM11166P/pCC1BAC- crpTM9 cultured overnight on an LB solid medium in a 37°C incubator were inoculated with one platinum each in the 25 mL titer medium of Table 6 above. Then, it was incubated in an incubator at 37° C. and 200 rpm for 48 hours to compare the sugar consumption rate and tryptophan concentration.
[134]
As a result, as shown in Table 7 below, the KCCM11166P/pCC1BAC- crp(WT) strain, which is a control, consumed 30.2 g/L of sugar at 22 hours, but the strain introduced with the mutant crpTM9 was about 7% compared to the parent strain, It was confirmed that the sugar consumption rate improved by about 6% compared to the strain to which the wild-type crp was additionally introduced.
[135]
In the case of L-tryptophan production, when cultured for 48 hours, the strain to which additional wild-type crp was introduced produced 8.4 g/L, but the mutant strains obtained above produced L-tryptophan production despite the increase in culture rate It was confirmed that the concentration was increased to 9.1 g/L, showing an increase of about 8% compared to the parent strain and about 10% compared to the strain to which the wild-type crp was added.
[136]
This is seen as a good mutant trait that can increase the sugar consumption capacity of the cells and improve the yield by the introduction of the crp variant, and it seems that it can greatly contribute to the productivity improvement during fermentation.
[137]
[Table 7] Comparison of titer of tryptophan strains containing the crp variant
Strain Sugar consumed (g/L)* Tryptophan (g/L)**
KCCM11166P/pCC1BAC 29.0 8.2
KCCM11166P/pCC1BAC- crp(WT) 30.2 8.4
KCCM11166P/pCC1BAC- crpTM9 32.1 9.1
[138]
*22 hours measurement, ** 48 hours measurement
[139]
[140]
Example 5. Introduction of effective crp mutant endogenous vector to wild-type E. coli
[141]
[142]
5-1. Introduced effective pCC1BAC- crp variant wild-type threonine-producing strain
[143]
In order to confirm whether the vector including the crp variant type screened in Example 3 exhibits an equivalent effect even in the wild type strain, the vectors of pCC1BAC- crp(WT) and pCC1BAC- crpTM9 were transferred to a wild type derived strain capable of producing threonine. It was introduced by transformation using a perforation method. In addition, a strain into which pCC1BAC- crp(WT) was introduced was also prepared as a control .
[144]
The wild-type-derived strain capable of producing threonine used in this example is W3110::PcysK-ppc/pACYC184-thrABC, and W3110::PcysK-ppc/pACYC184-thrABC is phosphoenolpyruvate carboxylate on the chromosome. It is a strain that increases the amount of threonine produced by increasing the number of copies by replacing the native promoter of the ppc gene encoding boxyase with the promoter of the cysK gene and introducing the threonine biosynthesis operon gene in the form of a vector. Specifically, according to the method described in Korean Patent Registration No. 10-0966324, a W3110::PcycK-ppc strain was produced using pUCpcycKmloxP, and then pACYC184-thrABC (Korean Patent Registration No. 10-1865998) was added to the strain. Transformation was performed using electroporation.
[145]
The prepared strains were cultured in a threonine evaluation medium prepared according to the composition of Table 8 below, and the growth rate and L-threonine production ability were compared.
[146]
[Table 8] Composition of threonine evaluation medium
Composition Concentration (per liter)
Glucose 70 g
KH 2 PO 4 2 g
(NH 4 ) 2 SO 4 25 g
MgSO 4 7H 2 O 1 g
FeSO 4 7H 2 O 5 mg
MnSO 4 7H 2 O 5 mg
DL-methionine 0.15 g
Yeast extract 2 g
Calcium carbonate 30 g
pH 6.8
[147]
[148]
Specifically, W3110 cultured overnight in LB solid medium in a 33°C incubator, each strain was inoculated with one platinum in the 25 mL titer medium shown in Table 8, and then incubated at 33°C, 200 rpm for 48 hours During the culture, the results are shown in Table 9 below. As can be seen from the following results, this suggests that the mutant protein selected in the present application can efficiently produce threonine in high yield even in the wild-type strain.
[149]
[Table 9] Results of evaluation of wild type-derived cell growth and threonine production ability
Strain OD Threonine (g/L)**
W3110::PcysK-ppc/pACYC184-thrABC/pCC1BAC 10.8 1.5
W3110::PcysK-ppc/pACYC184-thrABC/ pCC1BAC- crp(WT) 11.0 1.6
W3110::PcysK-ppc/pACYC184-thrABC/pCC1BAC- crpTM9 13.0 2.4
[150]
[151]
5-2. Introduction of a tryptophan-producing strain derived from the wild-type of the effective pCC1BAC- crp variant
[152]
In order to confirm whether the vector including the crp variant type screened in Example 4 exhibits the same effect in the wild type strain, the vectors of pCC1BAC- crp(WT) and pCC1BAC- crpTM9 were transformed into a wild type derived strain capable of producing tryptophan ( transformation).
[153]
The wild-type-derived strain capable of producing tryptophan used in this example is W3110 trp△2/pCL-Dtrp_att-trpEDCBA, a vector in which the control mechanism of the tryptophan operon regulatory site is released, and the tryptophan operon expression is enhanced to produce an excessive amount of tryptophan. Is the introduced strain (Republic of Korea Patent Registration No. 10-1532129). The strains into which the vector was introduced were cultured in a tryptophan evaluation medium prepared according to the composition shown in Table 10 below, and L-tryptophan production ability was compared.
[154]
[Table 10] Tryptophan evaluation medium composition
Composition Concentration (per liter)
Glucose 2 g
K 2 HPO 4 1 g
(NH 4 ) 2 SO 4 12 g
NaCl 1 g
Na 2 HPO 4 H 2 O 5 g
MgSO 4 H 2 O 1 g
MnSO 4 H 2 O 15 mg
CuSO 4 H 2 O 3 mg
ZnSO 4 H 2 O 30 mg
Sodium citrate 1 g
Yeast extract 1 g
Phenylalanine 0.15 g
pH 6.8
[155]
[156]
Specifically, strains cultured overnight on LB solid medium in a 37°C incubator were inoculated into each of the 25 ml evaluation medium shown in Table 9 above, and then incubated at 37°C and 200 rpm for 48 hours. The OD and tryptophan concentrations by culture were compared and shown in Table 11. As can be seen from the following results, this suggests that the mutant protein selected in the present application can efficiently produce tryptophan in high yield even in the wild-type strain.
[157]
[Table 11] Results of evaluation of wild type-derived cell growth and tryptophan production ability
Strain OD Tryptophan (g/L)**
W3110 trp△2/pCL-Dtrp_att-trpEDCBA/pCC1BAC 10.8 0.5
W3110 trp△2/pCL-Dtrp_att-trpEDCBA/pCC1BAC- crp(WT) 11.0 0.6
W3110 trp△2/pCL-Dtrp_att-trpEDCBA/pCC1BAC- crpTM9 12.3 0.8
[158]
[159]
The present inventors named the strain (KCCM11166P/pCC1BAC- crpTM9 ) with improved tryptophan production capacity and sugar consumption rate based on the KCCM11166P strain, pCC1BAC- crpTM9 , as "CA04-2808", and then the Korean microbial conservation, an international depository under the Budapest Treaty. It was deposited with the Center (KCCM) on November 7, 2018 and was given the accession number KCCM12374P.
[160]
[161]
The above results suggest that the ability to produce L-amino acids is increased while the sugar consumption rate is improved in the Escherichia microorganism into which the crp variant of the present application is introduced , and as a result, the production capacity of L-amino acids is increased compared to the unmodified strain. will be.
[162]
[163]
From the above description, those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed that all changes or modified forms derived from the meaning and scope of the claims to be described later, and equivalent concepts, rather than the detailed description above, are included in the scope of the present invention.
[164]
Claims
[Claim 1]
A cAMP receptor protein variant in which the 196th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with glutamine.
[Claim 2]
A polynucleotide encoding the cAMP receptor protein variant of claim 1.
[Claim 3]
A vector comprising a polynucleotide encoding the cAMP receptor protein variant of claim 1.
[Claim 4]
In the amino acid sequence of SEQ ID NO: 1, the 196th amino acid is substituted with glutamine, including a cAMP-receptive protein variant, Escherichia sp .
[Claim 5]
The microorganism of the genus Escherichia according to claim 4, wherein the microorganism of genus Escherichia is E. coli.
[Claim 6]
The microorganism of the genus Escherichia according to claim 4, wherein the microorganism of the genus Escherichia produces L-amino acids.
[Claim 7]
The microorganism of the genus Escherichia according to claim 6, wherein the L-amino acid is L-threonine or L-tryptophan.
[Claim 8]
A method for producing an L-amino acid comprising the step of culturing a microorganism of the genus Escherichia in a medium, including a cAMP-receptive protein variant, in which the 196th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with glutamine.
[Claim 9]
The method of claim 8, further comprising the step of recovering L-amino acid from the microorganism or medium.
[Claim 10]
The method of claim 8, wherein the L-amino acid is L-threonine or L-tryptophan.
[Claim 11]
A cAMP-receiving protein variant in which the 196th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with glutamine, or for the production of L-amino acids by microorganisms of the genus Escherichia containing the variant.
| # | Name | Date |
|---|---|---|
| 1 | 202017002745-STATEMENT OF UNDERTAKING (FORM 3) [22-01-2020(online)].pdf | 2020-01-22 |
| 2 | 202017002745-SEQUENCE LISTING(PDF) [22-01-2020(online)].pdf | 2020-01-22 |
| 3 | 202017002745-SEQUENCE LISTING [22-01-2020(online)].txt | 2020-01-22 |
| 4 | 202017002745-PRIORITY DOCUMENTS [22-01-2020(online)].pdf | 2020-01-22 |
| 5 | 202017002745-NOTIFICATION OF INT. APPLN. NO. & FILING DATE (PCT-RO-105) [22-01-2020(online)].pdf | 2020-01-22 |
| 6 | 202017002745-FORM 18 [22-01-2020(online)].pdf | 2020-01-22 |
| 7 | 202017002745-FORM 1 [22-01-2020(online)].pdf | 2020-01-22 |
| 8 | 202017002745-DECLARATION OF INVENTORSHIP (FORM 5) [22-01-2020(online)].pdf | 2020-01-22 |
| 9 | 202017002745-COMPLETE SPECIFICATION [22-01-2020(online)].pdf | 2020-01-22 |
| 10 | 202017002745-Correspondence-280120.pdf | 2020-01-29 |
| 11 | 202017002745-Proof of Right [12-03-2020(online)].pdf | 2020-03-12 |
| 12 | 202017002745-FORM-26 [12-03-2020(online)].pdf | 2020-03-12 |
| 13 | 202017002745-certified copy of translation [12-03-2020(online)].pdf | 2020-03-12 |
| 14 | 202017002745-ENDORSEMENT BY INVENTORS [14-07-2020(online)].pdf | 2020-07-14 |
| 15 | 202017002745-FORM 3 [22-07-2020(online)].pdf | 2020-07-22 |
| 16 | 202017002745.pdf | 2021-10-19 |
| 17 | 202017002745-Power of Attorney-160320.pdf | 2021-10-19 |
| 18 | 202017002745-OTHERS-160320.pdf | 2021-10-19 |
| 19 | 202017002745-OTHERS-160320-.pdf | 2021-10-19 |
| 20 | 202017002745-Form 5-230720.pdf | 2021-10-19 |
| 21 | 202017002745-Correspondence-230720.pdf | 2021-10-19 |
| 22 | 202017002745-Correspondence-160320.pdf | 2021-10-19 |
| 23 | 202017002745-FER.pdf | 2022-05-24 |
| 24 | 202017002745-FORM 4(ii) [23-11-2022(online)].pdf | 2022-11-23 |
| 25 | 202017002745-FORM 3 [23-12-2022(online)].pdf | 2022-12-23 |
| 26 | 202017002745-MARKED COPIES OF AMENDEMENTS [24-12-2022(online)].pdf | 2022-12-24 |
| 27 | 202017002745-FORM 13 [24-12-2022(online)].pdf | 2022-12-24 |
| 28 | 202017002745-FER_SER_REPLY [24-12-2022(online)].pdf | 2022-12-24 |
| 29 | 202017002745-CLAIMS [24-12-2022(online)].pdf | 2022-12-24 |
| 30 | 202017002745-AMMENDED DOCUMENTS [24-12-2022(online)].pdf | 2022-12-24 |
| 31 | 202017002745-PatentCertificate19-05-2023.pdf | 2023-05-19 |
| 32 | 202017002745-IntimationOfGrant19-05-2023.pdf | 2023-05-19 |
| 1 | SearchstrategyE_23-05-2022.pdf |