1. A method of producing cellulase from the cellulase-producing fungus i.e. Mucor ellipsoideus strain CBS 126271, isolated from the gut of termite comprising the following steps (1) to (4): 1) collection of the dead Indian White Termite and ; 2) isolating the fungus from the gut of the termite; 3) primary screening of cellulase enzyme is carried out by carboxymethyl cellulose agar plate method and; 4) submerged fermentation method for enzyme production followed by the cellulase assay.

2. The method for producing cellulase according to claim 1, wherein the fungus with narrow ellipsoidal sporangiospores is Mucor ellipsoideus strain CBS 126271.

3. The method for producing cellulase according to claim 1, wherein the aqueous media for cellulase production from the fungus comprises of KH2PO4, K2HPO4, MgSO4.7H2O, FeSO4.7H2O, NaCl, Carboxymethyl cellulose (medium viscosity), agar and a pH of 6.5.

4. The method for producing cellulase according to claim 1 or 3, wherein the cellulose is isolated from liquid culture involving Submerged Fermentation method.

5. The method for producing cellulase according to claim 1, wherein onion peel is used as an additional substrate for increasing the cellulase enzyme activity.

6. The method for producing cellulase according to claim 5, wherein the xylanolytic enzyme opened the surface area of onion skin that can be assessed by cellulase for the hydrolysis of cellulose.

7. The method for producing cellulase according to claim 1, wherein the Cellulase production is optimized using central composite design (CCD) based response surface methodology . 13

8. The method for producing cellulase according to claim 7, wherein the parameters are selected as substrate concentration ranges from(2-6%), temperature (25-350C), incubation days (4-6).

[0001] The present invention relates to a strain of Mucor ellipsoideus
strain CBS 126271, which is a novel microorganism strain belonging to the
genus Mucor and has high ability to produce cellulase.
[0002] The invention also relates to a method for producing cellulase
using a microorganism from the gut of termite.
BACKGROUND OF INVENTION
[0003] "Cellulase" is a generic term for a group of enzymes that
catalyze an enzyme reaction system in which cellulose is hydrolyzed to
glucose, cellobiose or cellooligotose. Depending on the catalytic mechanism,
enzymes refer to filter paper enzymes, carboxymethyl cellulase, cellobiase and
the like. Cellulase degrades cellulose into glucose as a degradation end product
via interactions in these enzymes.
[0004] “Hemicellulase" is a generic term for a group of enzymes that
catalyze an enzyme reaction system in which hemicellulose is hydrolyzed to
xylose, arabinose, mannose, galactose or the like. Depending on the catalytic
mechanism, the enzyme refers to xylanase, arabinase, arabinosidase,
mannanase, galactanase, xylosidase, mannosidase and the like.
[0005] Microorganisms belonging to the genus Aspergillus, Penicillium
and the like have been used as a cellulase-producing fungus of cellulase.
However, the use of such microorganisms is not sufficient to fulfil the
requirement of cellulase, as this enzyme is more in demand. So new microbes
with modified mechanism will play an important role for maximum production
of cellulase of industrial benefits.
3
[0006] Therefore, for the purpose of economical and practical
use of biomass, there is a great demand for microorganisms having a
higher ability to produce cellulase than only known to produce
cellulase.

[0007] The above information is presented as background information
only to help the reader to understand the present invention. Applicants have
made no determination and make no assertion as to whether any of the above
might be applicable as Prior Art with regard to the present application.
OBJECT OF INVENTION
[0008] The principal object of the embodiments herein is to overcome
the drawbacks in the prior art and provide a method for improved cellulase
production from the novel strain of fungus.
SUMMARY OF INVENTION
[0009] Accordingly, the embodiments herein disclose producing
cellulase from the isolated fungus Mucor ellipsoideus present in termite gut.
[0010] Accordingly, the embodiments herein disclose an improved
method of producing cellulase for the said stain of fungus. The method
includes obtaining the white termite and primary screening of cellulase.
Further, the method includes, quantitative screening followed by submerged
fermentation. Furthermore, the method includes, performing cellulase assay
followed by response surface methodology in turn leading to yield of enzyme.
[0011] Experimental factors (substrate concentration, temperature and
incubation days) have been found to have significant effect on cellulase
production as determined during preliminary optimization studies. RSM using
4
a three level central composite design has been applied to optimize the
response of these variables, with cellulase activity analyzed using the analysis
of variance (ANOVA) combined with the Fischer test to evaluate if a given
term has a significant effect (p≤ 0.05). The optimum levels of the variables
have been obtained by graphical and numerical analysis using Design Expert
program.
[0012] These and other aspects of the embodiments herein will be
better appreciated and understood when considered in conjunction with the
following description. It should be understood, however, that the following
descriptions, while indicating preferred embodiments and numerous specific
details thereof, are given by way of illustration and not of limitation. Many
changes and modifications may be made within the scope of the embodiments
herein without departing from the spirit thereof, and the embodiments herein
include all such modifications.
DETAILED DESCRIPTION OF INVENTION
[0013] Termites are destructive to agriculture, forestry, and buildings,
but they can also promote agro-ecosystem balance through the degradation of
cellulosic materials. Termite-triggered cellulose digestion may be clarified
through microbial metabolism of cellulose products. Termites and fungi have
established symbiotic relationships.
[0014] Cellulase is an important enzyme which can be obtained from
cheap agro wastes, by using submerged fermentation, this enzyme has various
unique industrial applications and it has been considered as major group of
industrial enzyme. Cellulase nowadays is being used both commercially and
industrially on a large scale. They account for a significant fraction of
industrial enzyme market. Industrially important enzymes have traditionally
been obtained from submerged fermentation (SmF) because of the ease in
5
handling and greater control of environmental factors such as temperature and
pH.
[0015] The embodiments herein and the various features and
advantageous details thereof are explained more fully with reference to the
non-limiting embodiments that are detailed in the following description.
Descriptions of well-known components and processing techniques are omitted
so as to not unnecessarily obscure the embodiments herein. Also, the various
embodiments described herein are not necessarily mutually exclusive, as some
embodiments can be combined with one or more other embodiments to form
new embodiments. The term “or” as used herein, refers to an on-exclusive or,
unless otherwise indicated. The examples used herein are intended merely to
facilitate an understanding of ways in which the embodiments herein can be
practiced and to further enable those skilled in the art to practice the
embodiments herein. Accordingly, the examples should not be construed as
limiting the scope of the embodiments herein.
[0016] Accordingly, embodiments herein describe a method for
production of cellulase enzyme from the fungal strain from gut of termite. In
particular steps of the present invention are as follows:
[0017] Isolation of novel strain CBS 126271 from termite gut.
[0018] Primary screening of fungus by growing on Carboxy methyl
cellulose agar plate for cellulase producers and Light orange hydrolysis area
confirming this.
[0019] Enzyme liquid medium for increasing the enzyme activity of
cellulase-producing strains.
[0020] Cellulase assay
6
Detailed ways
Isolation and characterization of strain:
[0021] Example 1: Sample collection - To minimize contamination,
alcohol-sterilized gloves, forceps and autoclaved glass containers wrapped in
aluminum foil have been used to obtain termites Odontotermes obesus (white
Indian termite) from the field. At the Banasthali University, Rajasthan, about
50 termites were gathered from decaying tree trunk, dry wood and moist
termite soil nest in sterile bottles.
[0022] Example 2: Media Preparation- Potato Dextrose Agar (PDA)
(3.9g) was taken and dissolved in 90 ml distilled water and volume was made
up to 100 ml. The media was autoclaved for 20 mints at 15 psi. after that 0.33
µl of streptomycin sulphate (35mg/liter) was added into the media to avoid
bacterial contamination.
[0023] Example 3: Strain Isolation - 12 ml media was poured into the
sterile disposable plate and the plates were allowed to solidify. For the isolation
of microbes from the termite, gut process has been conducted. Ten employee
termites were surface-sterilized by 70 percent ethanol followed by rinsing with
distilled water and air dried for 5 minutes. Under aseptic circumstances, each
termite was divided into its head and body parts separately; and the corpses
were crushed using glass tubes. The paste from the whole intestine of the
termites was selected with a couple of sterilized forceps. Sample was spread on
the potato dextrose agar (PDA) surface. Controls were handled in the same
way as treatments, with the exception of not adding termites to the petriplates.
Plates have been incubated for 4 days at 28°C. On the corresponding medium,
morphologically distinct colonies appeared on the plates. The pure fungal
isolate colonies were stored for long-term storage at -80°C. In order to acquire
pure cultures, fungi were sub cultured two to three times. From these pure
cultures, white spore fungi were chosen because these fungi grew again and
7
again. In triplicates, we conducted the same isolation operation. Based on their
colour and colony growth features, these white spore fungi have been visually
distinguished. Thereafter subcultures were produced every 3 days to preserve
the pure cultures.
[0024] Example 4: Carboxymethyle cellulase agar plate screening
for cellulase producers: The confirmation of cellulase enzyme primary
screening was carried out by carboxymethyl cellulose agar plate method (Islam
and Roy, 2018). Carboxymethyle cellulase agar plate media (CMC) was
prepared (Table 1) and boiled to dissolve it. At 121°C, media was autoclaved at
15 psi for 20 minutes. In the sterile disposable petriplate, 10 ml of media was
poured and plate was placed till solidification. Using a sterile inoculating loop,
fungal spores were removed from the slant and spores were stretched
longitudinally to the CMC plates under the laminar air flow. CMC plates were
incubated at 28°C for 3 days.
Table 1 - Carboxymethyl cellulose agar media for screening of cellulase
(Patagundi et al., 2014)
Composition Quantity (g/100ml)
KH2PO4 0.1
K2HPO4 0.1
MgSO4.7H2O 0.04
FeSO4.7H2O 0.0001
NaCl 0.005
Agar 1.8
Carboxymethyl cellulose (medium
viscosity)
1grm
8
pH 6.5
[0025] Example 5: Congo red was subsequently removed and 1 M
NaCl was added for 15 minutes (Table 2). Light orange hydrolysis area
developed around colonies. For further processing, the fungal colonies that
generated area around them were chosen.
Table 2 Staining solution for screening of cellulase (Patagundi et al., 2014)
Composition Qunatity (g/100ml )
1% Congo red dye
Congo red dye 1
1M NaCl
NaCl 5.85
[0026] Example 6: Identification of isolated strain: Microscopic
analysis using lactophenol blue: Based on morphological research, Mathew et
al. (2016) recognized the fungi Aspergillus niger. The pale blue background of
the lactophenol stain fungi is a profound blue color. Lactic acid functions as a
preservative fungus in the lactophenol cotton blue. The part of the phenol kills
the fungi; the fungi were stained with the cotton blue. Staining with lacto
phenol and cotton blue, morphological characteristics of fungal isolates were
explored using light microscopy. lactophenol and cotton blue stain were
dropped in the center of slide. Using an inoculating or teasing needle, a tiny
tuft of the fungus (2-3 mm) was transmitted to the drop and teased softly.
Preparation was examined for the existence of distinctive mycelia and other
structures under low and high, dry magnification.
9
[0027] Cellulase production was carried out under submerged
fermentation in 250 mL Erlenmeyer flask. Media was prepared, all the
components were dissolved, pH was set and volume was made up to 100 ml. 8
ml sterile distilled water was taken and transferred into the six days old slant of
Mucor ellipsoideus and slant was shaken vigorously so that spores of Mucor
ellipsoideus came into the water. 0.1 ml of incoulum was transferred into the
10 ml of media containing boiling tube. Boiling tubes were placed at different
temperature (25-35°C) for different incubation days (4-6 days). To extract
crude protein from the medium, the fermentation broth was filtered using the
whatman filter paper no 1 after 6 days of incubation. The filtrate with crude
enzyme was collected and the dry weight of mycelium was measured.
Submerged fermentation (SmF) was used because of the ease in handling and
greater control of environmental factors such as temperature and pH.
[0028] Cellulase assay (FPase) was carried out by following standard
assay protocol (Nathan et al., 2014). Cellulase production was optimized using
central composite design (CCD) based response surface methodology (RSM).
The parameters and their ranges were: substrate concentration (2-6%),
Temperature (25-350C), incubation days (4-6). Total 20 runs were carried out
for optimization study. We have used onion peel as an additional substrate for
increasing the cellulase enzyme activity (This is due to the fact that the
xylanolytic enzyme opened the surface area of the skin of the onion then
cellulase can access the cellulose for hydrolysis). Each experiment was carried
out in triplicates. After optimization of cellulase production, it was further used
for enzymatic hydrolysis of pretreated substrate.
One unit of enzyme activity was defined as the amount of glucose released per
ml of enzyme solution per minute.
10
[0029] Cellulase production was optimized using central composite
design (CCD) based response surface methodology (RSM). Improving the
economics of such processes will involve cost reduction in cellulase production
which may be achieved by better bioprocesses and genetic improvement
(Physical and Chemical mutagenesis) of cellulase producers to yield more of
the enzyme.
[0030] Molecular identification of fungi by ITS (Internal Transcribed
Spaces) rRNA sequencing: For their ITS-based microbial identification, the
fungal isolates with cellulase production potential were transferred to the
National Center for Microbial Resources (NCMR) Pune, Maharashtra.
[0031] Molecular Identification- Identification of isolates was done
through sequencing of 16S ribosomal RNA gene based on ITS and the
identification report was generate using NCBI Database and the confidence in
identification is limited by both the availability and the extent of homology
shown by ~550 bp sequence of your sample with its closet neighbour in the
database. Identified strain is Mucor ellipsoideus strain CBS 126271, Accession
no is MH863952.1 and similarity is 100% The 16S rRNA gene sequences were
compared using BLAST (http://www.ncbi.nih.gosv) to those in the Genebank
database (Boratyn et al. 2013).
[0032] Sequence Text (in FASTA format):
>A_JAN_19_151
[0033] ATTTTGGAGGCCATCCATTTCGGTCGCTTTCTATCTTTTTTATA
TTAAAAAAAATATAGGCAGTTAAAACTTAATAGCCATAGTAGATTT
AAAGCGTCTCAAGATATCGTTACGCTCAGATCTATTCAAACAAAAT
ATTTGAATAAGGGTTGTTTTTGATACTGAAACAGGCGTACTCATTGG
AATACCAATGAGTGCAAGTTGCGTTCAAAGACTCGATGATTCACTG
11
AATATGCAATTCACACTAGTTATCGCACTTTGCTACGTTCTTCATCG
ATGCGAGAACCAAGAGATCCATTGTTAAAAGTTGTTTTATAGATTTT
TTAGGTCTATGTTACAATATTAAAACTGAATTCTTTTGGTAAATAAT
AATTGGGTACCAAGCATCAAGCTTGATTATGACTAGGTTAACATTCT
ATATACCTACCCTTATAGTATATAGTCATCCCCTTATATGTCATAAA
TAAAACAGTTCACAGTAAATAAGA

We claim:

1. A method of producing cellulase from the cellulase-producing fungus i.e. Mucor
ellipsoideus strain CBS 126271, isolated from the gut of termite comprising the
following steps (1) to (4):
1) collection of the dead Indian White Termite and ;
2) isolating the fungus from the gut of the termite;
3) primary screening of cellulase enzyme is carried out by carboxymethyl
cellulose agar plate method and;
4) submerged fermentation method for enzyme production followed by the
cellulase assay.
2. The method for producing cellulase according to claim 1, wherein the fungus with
narrow ellipsoidal sporangiospores is Mucor ellipsoideus strain CBS 126271.
3. The method for producing cellulase according to claim 1, wherein the aqueous
media for cellulase production from the fungus comprises of KH2PO4, K2HPO4,
MgSO4.7H2O, FeSO4.7H2O, NaCl, Carboxymethyl cellulose (medium viscosity),
agar and a pH of 6.5.
4. The method for producing cellulase according to claim 1 or 3, wherein the
cellulose is isolated from liquid culture involving Submerged Fermentation method.
5. The method for producing cellulase according to claim 1, wherein onion peel is
used as an additional substrate for increasing the cellulase enzyme activity.
6. The method for producing cellulase according to claim 5, wherein the xylanolytic
enzyme opened the surface area of onion skin that can be assessed by cellulase for
the hydrolysis of cellulose.
7. The method for producing cellulase according to claim 1, wherein the Cellulase
production is optimized using central composite design (CCD) based response
surface methodology .
13
8. The method for producing cellulase according to claim 7, wherein the parameters
are selected as substrate concentration ranges from(2-6%), temperature (25-350C),
incubation days (4-6).